ID: 1100506621

View in Genome Browser
Species Human (GRCh38)
Location 12:95227202-95227224
Sequence TGTTCTATTGGAGGCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 677}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100506621_1100506625 15 Left 1100506621 12:95227202-95227224 CCAGGCTGGCCTCCAATAGAACA 0: 1
1: 0
2: 1
3: 16
4: 677
Right 1100506625 12:95227240-95227262 AGCCTCCACTTCCCAGGCTCAGG 0: 7
1: 266
2: 1260
3: 3078
4: 6210
1100506621_1100506624 9 Left 1100506621 12:95227202-95227224 CCAGGCTGGCCTCCAATAGAACA 0: 1
1: 0
2: 1
3: 16
4: 677
Right 1100506624 12:95227234-95227256 CACTGCAGCCTCCACTTCCCAGG 0: 190
1: 5949
2: 52733
3: 137567
4: 224841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100506621 Original CRISPR TGTTCTATTGGAGGCCAGCC TGG (reversed) Intronic
900085354 1:891836-891858 TGTTCCATTGCACTCCAGCCTGG - Intergenic
900231271 1:1559601-1559623 TGTGCTGTTGGACTCCAGCCAGG - Intronic
900304057 1:1994119-1994141 TGTGCCACTGCAGGCCAGCCTGG + Intronic
900734210 1:4285109-4285131 TGTGCTATTGCACTCCAGCCTGG + Intergenic
901009561 1:6192091-6192113 TGTGCCACTGCAGGCCAGCCTGG - Intronic
901539504 1:9906513-9906535 TGTGCTATTGCACTCCAGCCTGG + Intronic
901902940 1:12382143-12382165 TGTGCTATTGTACTCCAGCCCGG - Intronic
902068600 1:13712178-13712200 TGTGCCATTGCAGTCCAGCCTGG + Intronic
902080138 1:13815148-13815170 TGTTCCATTGTACACCAGCCTGG - Intronic
902352007 1:15863203-15863225 TGTGCCATTGGACTCCAGCCTGG + Intronic
902905644 1:19554776-19554798 TGCTCTATTGCACTCCAGCCTGG + Intergenic
903236485 1:21953933-21953955 TGTGCCATTGGACTCCAGCCTGG - Intergenic
903463722 1:23537408-23537430 TGTGCTATTGCACTCCAGCCTGG + Intergenic
903477688 1:23631118-23631140 TGTACCATTGCACGCCAGCCTGG + Intronic
903723609 1:25424429-25424451 TGTGCCATTGCAGTCCAGCCTGG - Intronic
903939373 1:26918616-26918638 TGTGCCATTGCACGCCAGCCTGG - Intronic
904045506 1:27605980-27606002 TGTCCTATAGGGGGCCAGCTAGG - Intergenic
904909037 1:33920496-33920518 TGTGCTATTGCACTCCAGCCAGG + Intronic
905011906 1:34753125-34753147 TGTTCTATTGGAGGTCTACTTGG + Intronic
905945157 1:41895510-41895532 TGTGCTAATGCAGGCCACCCAGG + Intronic
906773886 1:48511001-48511023 TGTTCTACTGCACTCCAGCCTGG + Intergenic
907025306 1:51112097-51112119 TCTTATGTTGGAGGCCTGCCAGG + Intronic
907058297 1:51393258-51393280 TGTGCCATTGCACGCCAGCCTGG - Intronic
907153618 1:52311832-52311854 TGTACTATTGCACTCCAGCCTGG - Intronic
907156662 1:52341174-52341196 TGTGCCATTGCACGCCAGCCTGG + Intronic
907210894 1:52820602-52820624 TGTGCCATTGGACTCCAGCCTGG + Intronic
907238146 1:53065310-53065332 TGTGCTACTGCAGTCCAGCCTGG + Intronic
907383624 1:54111182-54111204 TGGACTATCAGAGGCCAGCCTGG - Intronic
908698406 1:66870703-66870725 TGTGCTATTGCATTCCAGCCTGG + Intronic
909787367 1:79631888-79631910 TGTTATATTGGAGACAAGACTGG + Intergenic
910062191 1:83106988-83107010 TGTGCCATTGCACGCCAGCCTGG + Intergenic
910927577 1:92412415-92412437 TGTGCTACTGGACCCCAGCCTGG - Intergenic
910932586 1:92457448-92457470 TGTCCTATTGCACTCCAGCCTGG - Intergenic
911041057 1:93591429-93591451 TGTGCTATTGCACTCCAGCCTGG + Intronic
911763052 1:101639035-101639057 TGCACTATTGCACGCCAGCCAGG - Intergenic
912457503 1:109807666-109807688 TGTTTTCTTGGAAGCCAGGCTGG - Intergenic
912940016 1:114036564-114036586 TGTTCTCTGGAAGGCCTGCCTGG - Intergenic
913690178 1:121272115-121272137 TGCTCTATTGCACTCCAGCCTGG + Intronic
914147362 1:145007848-145007870 TGCTCTATTGCACTCCAGCCTGG - Intronic
917025599 1:170638101-170638123 TGTTCCATTGTACTCCAGCCTGG + Intergenic
917073924 1:171183636-171183658 TGTGCCATTGTACGCCAGCCTGG - Intergenic
917120926 1:171643925-171643947 TGTGCCATTGGACTCCAGCCTGG + Intronic
917317574 1:173741382-173741404 TGATCCATTGGAGGTCATCCTGG - Intronic
918458104 1:184746776-184746798 TGTTCTACTGTAGACCAGACTGG + Intronic
920477500 1:206290596-206290618 TGCTCTATTGCACTCCAGCCTGG + Intronic
920825148 1:209417938-209417960 TGATGAAGTGGAGGCCAGCCAGG - Intergenic
921197319 1:212771268-212771290 TGTGCCATTGGACTCCAGCCTGG + Intronic
921448360 1:215272904-215272926 TGTGCTATTGCACTCCAGCCTGG + Intergenic
922446568 1:225702988-225703010 TGTGCTATTGCACTCCAGCCTGG - Intergenic
922497930 1:226075019-226075041 TGTGCTATTGCACTCCAGCCTGG - Intergenic
922884130 1:229005048-229005070 AGCACTATGGGAGGCCAGCCTGG - Intergenic
923768582 1:236916174-236916196 TGTGCTATTGCACTCCAGCCTGG + Intergenic
924058589 1:240147534-240147556 TGTTCCATTGCACTCCAGCCTGG - Intronic
924555154 1:245112116-245112138 TGTGCCATTGCACGCCAGCCTGG - Intronic
924826244 1:247541964-247541986 TGTTCCACTGCAGTCCAGCCTGG + Intronic
1062868459 10:877335-877357 TGTTCTACTGCACTCCAGCCTGG + Intronic
1063670145 10:8093661-8093683 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1063842928 10:10092112-10092134 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1064072157 10:12239662-12239684 TGTGCTATTGCATTCCAGCCTGG + Intronic
1064268174 10:13841723-13841745 TATTATATAGGAGGCTAGCCAGG - Intronic
1064374394 10:14782631-14782653 CGTGCTATTGGACTCCAGCCTGG + Intergenic
1064474905 10:15676963-15676985 TGTGCTATTGCACTCCAGCCTGG + Intronic
1064629638 10:17296672-17296694 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1064638315 10:17390900-17390922 TGTGCCATTGCACGCCAGCCTGG - Intronic
1064654824 10:17546552-17546574 TGTGCTGTTGGACTCCAGCCTGG + Intergenic
1064763013 10:18641407-18641429 TGTGCTACTGCAGTCCAGCCTGG - Intronic
1064948037 10:20814556-20814578 TGTGCTATTGCATTCCAGCCCGG + Intronic
1065211787 10:23410916-23410938 TGTTCTACTGCACTCCAGCCTGG + Intergenic
1065615931 10:27523654-27523676 TGTGCTACTGCAGCCCAGCCTGG - Intronic
1065619089 10:27560568-27560590 TGTGCCATTGCAGTCCAGCCAGG + Intergenic
1065979729 10:30880385-30880407 TGTGCTATTGCACTCCAGCCTGG + Intronic
1066352221 10:34646707-34646729 TGTGCTATTGCACTCCAGCCTGG - Intronic
1066674557 10:37874683-37874705 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1068842414 10:61630366-61630388 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1069733758 10:70637744-70637766 TGTTGAATTTGAGACCAGCCTGG + Intergenic
1070651602 10:78240878-78240900 TGTACTATTGCACTCCAGCCTGG + Intergenic
1070760969 10:79024263-79024285 TCTTCCTTTGCAGGCCAGCCAGG - Intergenic
1070904937 10:80063628-80063650 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1071578470 10:86748241-86748263 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1074234531 10:111572184-111572206 TGTGCCATTGCACGCCAGCCTGG - Intergenic
1074235227 10:111578185-111578207 TGTCCTACTGGAAGCCATCCAGG - Intergenic
1074542101 10:114373579-114373601 TGTGCTATTGCACTCCAGCCTGG + Intronic
1074872403 10:117587512-117587534 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1075422819 10:122316221-122316243 TGTGCTATTGCATTCCAGCCTGG + Intronic
1077070612 11:669590-669612 TGTGCCATTGGATTCCAGCCTGG + Intronic
1078875467 11:15390831-15390853 TGTGCTACTGCATGCCAGCCTGG + Intergenic
1079864048 11:25712404-25712426 TGTGCCATTGCATGCCAGCCTGG + Intergenic
1079937218 11:26632470-26632492 TGTGCCATTGTAGTCCAGCCTGG + Intronic
1079989934 11:27235845-27235867 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1081409690 11:42743105-42743127 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1081490413 11:43563956-43563978 TGTGCCATTGCATGCCAGCCTGG - Intronic
1082030014 11:47597062-47597084 TGCTCCATTGCACGCCAGCCTGG - Intergenic
1082752577 11:57035131-57035153 TGTTTTATTGCACTCCAGCCTGG + Intergenic
1083589057 11:63881910-63881932 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1083649171 11:64191141-64191163 TGTGCTATTGCACTCCAGCCTGG + Intronic
1084360178 11:68664155-68664177 TGTGCTACTGCACGCCAGCCTGG + Intergenic
1084796054 11:71504770-71504792 GGTTCTATTGGAACACAGCCAGG - Intronic
1085090703 11:73710691-73710713 TGTGCTATTGCACTCCAGCCTGG + Intronic
1086346667 11:85903921-85903943 TGTTCCATTGCACTCCAGCCTGG + Intronic
1087273100 11:96131964-96131986 TGTGCTATTGCACTCCAGCCTGG + Intronic
1087508962 11:99066145-99066167 TGTGCTATTGAACTCCAGCCTGG - Intronic
1088236762 11:107733059-107733081 TGTGCTATTGCACCCCAGCCTGG + Intergenic
1088661660 11:112053276-112053298 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1089198465 11:116709255-116709277 TGTTCCACTGGATGCCAGCCTGG - Intergenic
1089415680 11:118288175-118288197 TGTTATATTGGAGGCCCATCTGG + Intergenic
1090063799 11:123486502-123486524 TGTGCTACTGCAGTCCAGCCTGG + Intergenic
1090401670 11:126453219-126453241 TGGTCTATTTGAGGACAACCTGG - Intronic
1091436104 12:474303-474325 TGTCCTATTGAAAGCCAGACTGG + Intronic
1091510515 12:1119593-1119615 TGTGCTATTGCACTCCAGCCTGG - Intronic
1091989445 12:4942999-4943021 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1092595829 12:10003870-10003892 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1093782519 12:23153447-23153469 TGTGCTATTGCACTCCAGCCCGG - Intergenic
1094327381 12:29255666-29255688 TGTGCTATTGCACACCAGCCTGG - Intronic
1094465212 12:30746348-30746370 TGTGCTATTGCACTCCAGCCTGG + Intronic
1094532557 12:31290761-31290783 TGTGCTATTGCACTCCAGCCTGG - Intronic
1095419228 12:42007916-42007938 TGTGCTATTGGACTCCAGTCTGG + Intergenic
1096302204 12:50440018-50440040 TGTCCTGTGGGAGGCCAGGCAGG + Intronic
1096340399 12:50793587-50793609 TGTGCTATTGCACTCCAGCCTGG + Intronic
1096631575 12:52930259-52930281 TGTGCTATTGCACTCCAGCCTGG - Intronic
1097007813 12:55931702-55931724 TGTTCTGTTAGCGGCCCGCCCGG + Intronic
1097129139 12:56797311-56797333 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1097207137 12:57332038-57332060 TGTACCATTGGATTCCAGCCTGG + Intronic
1098160157 12:67641989-67642011 TGTTCCATTGAACTCCAGCCTGG - Intergenic
1099064416 12:77955824-77955846 TGTGCTACTGCATGCCAGCCTGG + Intronic
1099226807 12:79979611-79979633 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
1099445238 12:82744024-82744046 TGTGCTCTGGGAGGCCAGGCGGG + Intronic
1099690202 12:85942199-85942221 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1099818205 12:87675329-87675351 TGTTTTATTGCACTCCAGCCTGG - Intergenic
1100225292 12:92550168-92550190 TGTGCCACTGCAGGCCAGCCTGG + Intergenic
1100347180 12:93743538-93743560 TGTTCTATTCGAGACCAGCCTGG - Intronic
1100457667 12:94767973-94767995 TGTGCTATTGCACTCCAGCCCGG + Intergenic
1100506621 12:95227202-95227224 TGTTCTATTGGAGGCCAGCCTGG - Intronic
1101343592 12:103864491-103864513 TGTCCTAATGCAGGCAAGCCTGG - Intergenic
1101564128 12:105889393-105889415 AGGTCAATTGGAGACCAGCCCGG + Intergenic
1101806110 12:108065367-108065389 TCTGCTAGTGGAGGCCTGCCTGG - Intergenic
1101856286 12:108446080-108446102 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1101896109 12:108758199-108758221 TGCGCTATTGGACTCCAGCCTGG - Intergenic
1101948525 12:109156482-109156504 TGTGCTATTGCACTCCAGCCTGG + Intronic
1101966350 12:109284832-109284854 TGCTCCAGTGGATGCCAGCCAGG + Intronic
1102334046 12:112062355-112062377 TGTTCTACTGCACTCCAGCCTGG + Intronic
1102496685 12:113324448-113324470 TGTGCTATTGTACTCCAGCCTGG - Intronic
1102835591 12:116055849-116055871 TGTGCCATTGGACTCCAGCCTGG + Intronic
1102851147 12:116246596-116246618 TGACCTATTTGAGACCAGCCTGG + Intronic
1103084948 12:118055656-118055678 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1103319887 12:120086193-120086215 TGTTCTATAGGAGTCCAGGAAGG - Intronic
1103391258 12:120575190-120575212 TGTGCCATTGCACGCCAGCCTGG + Intronic
1103538106 12:121647404-121647426 TGTGCTACTGGACTCCAGCCTGG + Intergenic
1103560532 12:121791167-121791189 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1103590276 12:121987249-121987271 TGTTCTAGGGGAGGCCTTCCTGG + Intronic
1104244805 12:127028723-127028745 TGTACTATTGCACTCCAGCCTGG - Intergenic
1105343110 13:19546531-19546553 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1105490998 13:20888129-20888151 TGTGCCATTGCATGCCAGCCTGG + Intronic
1105744356 13:23362951-23362973 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1105835421 13:24206846-24206868 TGTGCTATTGCACTCCAGCCTGG + Intronic
1106716620 13:32396015-32396037 TGTGCTATTGTACTCCAGCCTGG - Intronic
1106971881 13:35151069-35151091 TGTTCTACTGCACTCCAGCCTGG + Intronic
1107177307 13:37414330-37414352 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1107474442 13:40721674-40721696 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1108311727 13:49199062-49199084 AGTGCCACTGGAGGCCAGCCTGG - Intronic
1108445961 13:50509290-50509312 TGCTCTATTGCATTCCAGCCTGG - Intronic
1108708794 13:53013830-53013852 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1109036418 13:57267379-57267401 TGTACTACTGCATGCCAGCCTGG + Intergenic
1109292279 13:60491068-60491090 TGTGCTATTGCACTCCAGCCTGG + Intronic
1110005588 13:70262947-70262969 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1110175501 13:72550958-72550980 TGTGCCATTGCATGCCAGCCTGG - Intergenic
1110224425 13:73104875-73104897 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1110296100 13:73867975-73867997 TGTGCTATTGCACTCCAGCCTGG + Intronic
1110723175 13:78788555-78788577 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1110911499 13:80971557-80971579 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1111069760 13:83150310-83150332 TGTGCTACTGCAGCCCAGCCTGG - Intergenic
1111089989 13:83432747-83432769 TGTTCCATTGCATTCCAGCCTGG + Intergenic
1111648054 13:91056936-91056958 TGTTCTGTTGGTGGTCAGCTGGG + Intergenic
1111664131 13:91245756-91245778 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1111775399 13:92655376-92655398 TGTGCCATTGCATGCCAGCCTGG - Intronic
1111968740 13:94887947-94887969 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1112267714 13:97940513-97940535 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1112517259 13:100065216-100065238 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1112529859 13:100190629-100190651 TGTGCTATTGCACTCCAGCCTGG + Intronic
1113479853 13:110612559-110612581 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1114014969 14:18419829-18419851 TGCTCCATTGGACTCCAGCCTGG - Intergenic
1114172836 14:20291095-20291117 TGTCCCATTGCACGCCAGCCCGG - Intronic
1115554527 14:34534174-34534196 TGTGCTATTGCACTCCAGCCTGG - Intronic
1115889078 14:38006879-38006901 TGTGCCATTGGACTCCAGCCTGG + Intronic
1116314019 14:43363520-43363542 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1116607973 14:47027118-47027140 TGTGCTACTGCAGTCCAGCCTGG + Intronic
1118622422 14:67625634-67625656 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1118843803 14:69531076-69531098 TGTGCTATTGTACTCCAGCCTGG + Exonic
1118886635 14:69872614-69872636 TGTGCTACTGCAGTCCAGCCTGG + Intronic
1119304619 14:73597635-73597657 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1119466874 14:74865099-74865121 TGTTCCATTGCACTCCAGCCTGG + Intronic
1119785580 14:77311087-77311109 TGTACCATTGCAGTCCAGCCTGG + Intronic
1119820482 14:77611417-77611439 TGTGCTACTGCAGGCCAGGCTGG + Intronic
1119827434 14:77669121-77669143 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1120120095 14:80668694-80668716 TCTTCTATTTCAGGCCAGCTTGG - Intronic
1120126614 14:80751671-80751693 TGTTCCATTGCACTCCAGCCTGG - Intronic
1120455453 14:84724158-84724180 TGCGCTATTGCATGCCAGCCCGG + Intergenic
1121184320 14:91953379-91953401 TGTTCTACTGCACTCCAGCCTGG + Intergenic
1121219204 14:92273147-92273169 TGTGCTATTGCATTCCAGCCTGG + Intergenic
1121356912 14:93223349-93223371 TGTGCTATTGCACTCCAGCCTGG + Intronic
1121465784 14:94114833-94114855 TGTTCTTTTGGTTTCCAGCCAGG + Exonic
1121799107 14:96758526-96758548 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1122083963 14:99286562-99286584 TGTACTATTGCACTCCAGCCTGG + Intergenic
1202906262 14_GL000194v1_random:74108-74130 TGTGCCATTGGACACCAGCCTGG - Intergenic
1202869779 14_GL000225v1_random:151052-151074 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1125566332 15:40681727-40681749 TGTTCCATTGCACTCCAGCCTGG - Intergenic
1126171397 15:45698097-45698119 TGTGCTACTGCACGCCAGCCTGG + Intergenic
1126790002 15:52212310-52212332 TGTTCTCCTCAAGGCCAGCCAGG - Intronic
1126913432 15:53438717-53438739 GGTACTGTTGGAAGCCAGCCTGG - Intergenic
1126959051 15:53969640-53969662 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1128137463 15:65274528-65274550 TGTTCTACTGCACTCCAGCCTGG + Intronic
1128172172 15:65522560-65522582 TGCACTATTGGAATCCAGCCTGG + Intergenic
1128790548 15:70430471-70430493 TGTACCATTGTAGTCCAGCCTGG - Intergenic
1128825149 15:70708502-70708524 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1129779593 15:78261724-78261746 TGTGCTACTGCATGCCAGCCTGG - Intergenic
1129970606 15:79774804-79774826 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1130156270 15:81352861-81352883 TGTGCTATTGCACTCCAGCCTGG - Intronic
1130336684 15:82962631-82962653 TGTGCTATTGCACTCCAGCCTGG + Intronic
1130644387 15:85711057-85711079 TGTGCTATTGTACTCCAGCCTGG - Intronic
1130830746 15:87596324-87596346 TGTTTTATTGCACCCCAGCCTGG - Intergenic
1131176839 15:90214587-90214609 TGTGCTATTGCACTCCAGCCTGG + Intronic
1132594381 16:741493-741515 TGTTATCTTGGAGACCAGTCTGG + Intronic
1132907130 16:2288408-2288430 TGTTCTGTGTGACGCCAGCCTGG + Intronic
1133683927 16:8147758-8147780 TGTGCTACTGGACTCCAGCCTGG + Intergenic
1134018527 16:10906147-10906169 TGTGCCATTGCACGCCAGCCTGG + Intronic
1134111910 16:11520621-11520643 TGTGCTATTGCACGCCAGCCTGG + Intronic
1134480059 16:14611582-14611604 TGTGCCATTGCATGCCAGCCTGG - Intronic
1134483930 16:14641816-14641838 TGTGCTATTGCACTCCAGCCTGG + Intronic
1134630355 16:15751840-15751862 TGTGCCATTGGACTCCAGCCTGG - Intronic
1134684827 16:16151106-16151128 TGTGCCATTGCACGCCAGCCTGG - Intronic
1135028590 16:19018092-19018114 TGTGCTATTGCACTCCAGCCTGG + Intronic
1135560794 16:23475231-23475253 TGTTCGATTGCACTCCAGCCTGG - Intronic
1135684239 16:24485459-24485481 TGTGCTATTGTACTCCAGCCTGG - Intergenic
1136582813 16:31164097-31164119 TGCTCCATTGCACGCCAGCCTGG - Intergenic
1138186920 16:54983988-54984010 TGGTCTATTTGATCCCAGCCTGG + Intergenic
1138468192 16:57209715-57209737 TGCTCTACTGCACGCCAGCCTGG - Intronic
1138813949 16:60182913-60182935 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1139508863 16:67415089-67415111 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1139832266 16:69809722-69809744 TGCGCCATTGGATGCCAGCCTGG + Intronic
1139868920 16:70087812-70087834 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1140386466 16:74544355-74544377 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1140428547 16:74881827-74881849 TGTTCCATTGCACTCCAGCCTGG + Intronic
1141112453 16:81281400-81281422 TGTGCTATTGTACTCCAGCCTGG + Intronic
1141128864 16:81420917-81420939 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1141287945 16:82690122-82690144 TGTGCTATTGCACTCCAGCCTGG + Intronic
1141610019 16:85176030-85176052 TGTACCATTGCACGCCAGCCTGG - Intronic
1142770477 17:2093148-2093170 CGTTCTATTGCAATCCAGCCTGG + Intronic
1143946407 17:10596480-10596502 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1144164524 17:12596584-12596606 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1144650977 17:17006677-17006699 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
1145189871 17:20829724-20829746 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1145296384 17:21595902-21595924 TGTACTATTGCACTCCAGCCTGG + Intergenic
1146078823 17:29758790-29758812 TGTGCCATTGCATGCCAGCCTGG - Intronic
1146690641 17:34873197-34873219 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1147433976 17:40395237-40395259 TGTGCTATTGCACTCCAGCCTGG + Intronic
1147594399 17:41707291-41707313 TGTGCGATTGCACGCCAGCCTGG - Intergenic
1147781184 17:42943435-42943457 TGTGCTACTGCATGCCAGCCTGG - Intergenic
1148009239 17:44462251-44462273 TCTTCTATTCGAGGACACCCAGG - Intronic
1148147824 17:45377119-45377141 TGTACCATTGCACGCCAGCCTGG - Intergenic
1148354108 17:46963858-46963880 TGTGCTATTGCACTCCAGCCTGG - Intronic
1148616989 17:49008126-49008148 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1148939864 17:51199140-51199162 TGTGCTATTGCACTCCAGCCTGG - Intronic
1150536784 17:66051021-66051043 TGTGCTACTGGATGCCAGCTTGG - Intronic
1151189835 17:72390186-72390208 TGTTCCATTGAACTCCAGCCTGG - Intergenic
1151296064 17:73187018-73187040 TGTGCCATTGCACGCCAGCCTGG - Intergenic
1151317380 17:73331456-73331478 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
1151442838 17:74144468-74144490 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1151446271 17:74166425-74166447 TGTTCTACTGCACTCCAGCCTGG + Intergenic
1151525032 17:74659297-74659319 TGCTCTATTGCACTCCAGCCTGG - Intergenic
1151699271 17:75734178-75734200 TGTGCTATTGCACTCCAGCCTGG - Intronic
1152965976 18:114195-114217 AGTTCAATTTGAGACCAGCCTGG + Intergenic
1154416888 18:14180757-14180779 TGTGCCATTGGACACCAGCCTGG - Intergenic
1154927993 18:20957858-20957880 AGTTCAATTTGAGACCAGCCTGG - Intronic
1154998219 18:21661714-21661736 TGTGCTATTGCACTCCAGCCTGG - Intronic
1155153400 18:23139357-23139379 TGTGCTATTGCACTCCAGCCTGG + Intronic
1155346365 18:24861375-24861397 TTTTCCATAGGAGGCCAACCCGG + Intergenic
1158494134 18:57938314-57938336 TGTTCCATTGGAAGTAAGCCTGG + Intergenic
1159275372 18:66213097-66213119 TTTTCTATTAGAAGCCAGGCTGG - Intergenic
1160008823 18:75088639-75088661 TGTTCTAATGGAGGCCACACAGG + Intergenic
1160202607 18:76807946-76807968 TTCTCTGTTGGAGGCCCGCCCGG + Intronic
1160684193 19:425983-426005 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1160884114 19:1337041-1337063 TGTTCTACTGTACTCCAGCCTGG - Intergenic
1161391422 19:4023126-4023148 TGTGCTATTGCAGTCCAGCCTGG + Intronic
1161675121 19:5642400-5642422 TGTGCAATTGAAGTCCAGCCTGG + Intronic
1161941969 19:7410764-7410786 TGTGCTATTGCACTCCAGCCTGG + Intronic
1162336045 19:10061153-10061175 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
1162458685 19:10801562-10801584 TGTTCTACTGCACTCCAGCCTGG + Intronic
1163162433 19:15472547-15472569 TGTGCTATTGCACACCAGCCTGG + Intronic
1163345121 19:16736271-16736293 TGTACTACTGCATGCCAGCCTGG - Intronic
1163396051 19:17062162-17062184 TGCTCCATTGCATGCCAGCCTGG - Intronic
1163776522 19:19221522-19221544 TGTGCTATTGCACTCCAGCCTGG + Intronic
1163779281 19:19237997-19238019 TGTGCCATTGCACGCCAGCCTGG + Intronic
1163835880 19:19573771-19573793 TGTGCTATTGCACTCCAGCCTGG - Intronic
1164022096 19:21316828-21316850 TGTGCTATTGCACTCCAGCCTGG - Intronic
1164232726 19:23304770-23304792 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1164463468 19:28467857-28467879 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1164691717 19:30215766-30215788 TGTTTTATTTGAAGCCAGCAAGG + Intergenic
1164928795 19:32155448-32155470 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1165338429 19:35191401-35191423 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1165485929 19:36096132-36096154 TGTGCTATTGAACTCCAGCCTGG - Intronic
1165852530 19:38858147-38858169 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1165959340 19:39521351-39521373 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1166083659 19:40460926-40460948 TGTGCCATTGCACGCCAGCCTGG + Intronic
1166115273 19:40649530-40649552 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1166122986 19:40696619-40696641 TGTGCTATTGTACTCCAGCCTGG + Intronic
1166189378 19:41165674-41165696 TGTGCTATTGCATTCCAGCCTGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166814617 19:45535806-45535828 TGTGCTATTGCACTCCAGCCTGG - Intronic
1166830617 19:45637520-45637542 TGTGCTATTGCACTCCAGCCTGG - Intronic
1166989805 19:46685213-46685235 TGTACTATTGCACTCCAGCCTGG + Intronic
1167199316 19:48053411-48053433 TGTGCCATTGGACTCCAGCCTGG - Intronic
1167304252 19:48697736-48697758 TGTACCATTGCATGCCAGCCTGG - Intronic
1167517959 19:49934194-49934216 TGTTCTATTGCACTCCAGTCTGG + Intronic
1167881980 19:52467052-52467074 TGTTCTACTGCACTCCAGCCTGG - Intronic
1167894062 19:52566993-52567015 TGTCCTATTGCACTCCAGCCTGG - Intronic
1168340422 19:55620078-55620100 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1168344978 19:55645923-55645945 TGTGCCATTGGACTCCAGCCTGG - Intronic
1168369014 19:55815483-55815505 TGTTCCATTGCATTCCAGCCTGG + Intronic
1168395251 19:56041913-56041935 TGTGCCATTGCACGCCAGCCTGG + Intronic
1168568694 19:57445884-57445906 TGTTCCATTGCACTCCAGCCTGG + Intronic
925043426 2:751845-751867 TGTTCTATTTGGACCCAGCCTGG + Intergenic
925397447 2:3545501-3545523 TGTTTTATTGCAGGCAAGCAAGG - Exonic
926004389 2:9361609-9361631 TGTGCTACTGGACTCCAGCCTGG - Intronic
926057996 2:9787364-9787386 TGTTCTTATGGAGGGCAGGCAGG + Intergenic
927039647 2:19215617-19215639 TGTGCCATTGCACGCCAGCCTGG - Intergenic
927144699 2:20155361-20155383 TGTGCTATTGCATTCCAGCCTGG - Intergenic
929188039 2:39115456-39115478 TGTGCTATTGCACTCCAGCCTGG - Intronic
929339298 2:40793970-40793992 TTTTCTACTGATGGCCAGCCTGG + Intergenic
929501867 2:42497160-42497182 TGTGCCATTGGACTCCAGCCTGG + Intronic
929712823 2:44281916-44281938 TGTGCTATTGCACTCCAGCCTGG - Intronic
929921868 2:46178214-46178236 TGTGCTATTGCACTCCAGCCTGG + Intronic
930100385 2:47598780-47598802 TGCTCTGTGGGAGGCCATCCAGG - Intergenic
930515195 2:52398376-52398398 TGTACTATTGCACTCCAGCCTGG - Intergenic
930574415 2:53128200-53128222 TGTGCTACTGGACTCCAGCCTGG - Intergenic
930772787 2:55144563-55144585 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
931883775 2:66593673-66593695 TGTGCTATTGCACTCCAGCCTGG - Intergenic
933080988 2:77985796-77985818 TGTACTATTGCACTCCAGCCTGG - Intergenic
933281599 2:80338030-80338052 TGTGCTACTGCAGTCCAGCCTGG - Intronic
933312082 2:80673275-80673297 TGTGCTATTGCACTCCAGCCTGG + Intergenic
933779638 2:85792487-85792509 TGTTCAGTGGGAAGCCAGCCCGG + Intergenic
934050256 2:88204459-88204481 TGTGCTATTGCACTCCAGCCTGG - Intergenic
934500358 2:94856481-94856503 TGTGCCATTGGACACCAGCCTGG + Intergenic
934588117 2:95523778-95523800 TGTGCTATTGCACTCCAGCCTGG + Intergenic
935976263 2:108581891-108581913 TGTGCCATTGGACTCCAGCCTGG + Intronic
937061955 2:118987414-118987436 TGTTCTCTTAGAGTCCAGCGAGG + Intronic
938424278 2:131171566-131171588 TGTTCTGTTGTACTCCAGCCTGG - Intronic
940004880 2:149001400-149001422 TGTCCTGTTGGGGGCCAGCAGGG + Intronic
940737145 2:157466404-157466426 TGTGCTATTGTACTCCAGCCTGG + Intronic
941834840 2:170004865-170004887 TGTGCTATTGCACTCCAGCCTGG + Intronic
944581265 2:201134589-201134611 TGTGCTATTGCACTCCAGCCTGG + Intronic
944914162 2:204340579-204340601 TGTGCTATTGCACTCCAGCCTGG + Intergenic
945786051 2:214239072-214239094 TGTGCTATTGCACTCCAGCCTGG - Intronic
946862872 2:224016460-224016482 TGTGCTATTGCACTCCAGCCTGG + Intronic
947622541 2:231600021-231600043 TGTGCTATTGCACTCCAGCCTGG - Intergenic
947827274 2:233114909-233114931 TGTGCCATTGCAGTCCAGCCTGG - Intronic
948008104 2:234627355-234627377 TGTGCTATTGCACTCCAGCCTGG + Intergenic
948391780 2:237616683-237616705 TGTTCTGCTTGAGGCCAGCCTGG + Intergenic
1168773260 20:429268-429290 TGTGCTATTGCACTCCAGCCTGG - Intronic
1169052422 20:2592106-2592128 TGTGCTATTGCACTCCAGCCTGG + Intronic
1169124621 20:3118426-3118448 TGTGCTATTGCACTCCAGCCTGG + Intronic
1169369488 20:5017669-5017691 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1169405756 20:5319654-5319676 TGTTCTATTGCACTCCAGCTTGG - Intergenic
1170114581 20:12843595-12843617 AGTTCAGTTGGAGACCAGCCTGG + Intergenic
1171891578 20:30723171-30723193 TGTGCCATTGGACACCAGCCTGG + Intronic
1171977077 20:31602195-31602217 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1172030995 20:31981997-31982019 AGTGCTATTGGAGGACAGCCAGG - Intronic
1172521975 20:35573356-35573378 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1172691391 20:36792946-36792968 TGTGCTATTGCACTCCAGCCTGG - Intronic
1173221063 20:41133606-41133628 TGTGCCATTGCACGCCAGCCTGG + Intergenic
1173791610 20:45831559-45831581 TGTGCCATTGGACTCCAGCCTGG + Intronic
1173892774 20:46526250-46526272 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1174579941 20:51564183-51564205 TGTCCTGCTGGAGGCCACCCTGG - Intergenic
1175148480 20:56914301-56914323 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1175376436 20:58528116-58528138 TGTGCTACTGGATTCCAGCCTGG + Intergenic
1175841962 20:62033691-62033713 TGTGCTATTGCACTCCAGCCTGG + Intronic
1176625616 21:9088886-9088908 TGTGCCATTGGACACCAGCCTGG - Intergenic
1176856449 21:13978519-13978541 TGTGCCATTGGACACCAGCCTGG + Intergenic
1177405214 21:20658109-20658131 TGCTCCATTGCAGTCCAGCCTGG + Intergenic
1177423840 21:20897137-20897159 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1177551563 21:22629302-22629324 TGTGCCATTGCATGCCAGCCTGG - Intergenic
1177733245 21:25056541-25056563 TGAACTATTGCACGCCAGCCTGG - Intergenic
1178466429 21:32852803-32852825 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1179638970 21:42734614-42734636 TGTGCTATTGCACTCCAGCCTGG - Intronic
1180439468 22:15350606-15350628 TGCTCCATTGGACTCCAGCCTGG - Intergenic
1180634711 22:17255088-17255110 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1180687385 22:17680169-17680191 TGTGCTATTGCACTCCAGCCTGG + Intronic
1181152907 22:20898032-20898054 TGTGCTATTGCACCCCAGCCTGG - Intergenic
1181170457 22:21005903-21005925 TGTTCCATTGTACTCCAGCCTGG + Intergenic
1181332242 22:22102117-22102139 TGTGCTACTGGACTCCAGCCTGG + Intergenic
1181571702 22:23771468-23771490 TGTTCCATTGCACTCCAGCCTGG - Intronic
1181867560 22:25871053-25871075 TGTCCTTTTGGAGGCCAGGCTGG + Intronic
1182352822 22:29708487-29708509 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1182495081 22:30701049-30701071 TGTGCTATTGCACTCCAGCCTGG + Intronic
1182672813 22:32011401-32011423 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1183399339 22:37592720-37592742 TGTTCTCTTAGTGGCCAGCAGGG - Intergenic
1183687899 22:39372492-39372514 TGTGCTATTGCATTCCAGCCTGG - Intronic
1183791883 22:40078478-40078500 TGTTCCATTGCACTCCAGCCAGG + Intronic
1184446424 22:44550068-44550090 TGTTCCATTGCACTCCAGCCTGG - Intergenic
1184934123 22:47706636-47706658 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1185054433 22:48571316-48571338 TGTTCTACTGCACTCCAGCCTGG - Intronic
949355538 3:3176690-3176712 TGTGCTATTGCACTCCAGCCTGG + Intronic
949919425 3:8989447-8989469 TGTTCTAGAGGAGGCCAGGCAGG - Intronic
950017165 3:9762418-9762440 TGTGCCATTGCACGCCAGCCTGG - Intronic
950117952 3:10463593-10463615 TGTTGGATTGGAGCCCAGGCAGG + Intronic
950380583 3:12611259-12611281 TGTGCTACTGGACTCCAGCCTGG - Intronic
950387650 3:12672679-12672701 TGTGCTATTGCACTCCAGCCTGG + Intergenic
951109743 3:18789060-18789082 TGTTTTTTTTGAGGCCAGTCTGG - Intergenic
951780841 3:26361660-26361682 TGTGCCATTGCAGGCCAGCCTGG - Intergenic
952018696 3:28990721-28990743 TGTGCCATTGGACTCCAGCCTGG - Intergenic
952064099 3:29547017-29547039 TGTGCTATTGCACTCCAGCCTGG - Intronic
952351256 3:32540635-32540657 TGTTCCATTGTACTCCAGCCTGG + Intronic
952968525 3:38636450-38636472 TGCTCTGCTGGAGGCCAGCTGGG - Intronic
952988418 3:38809112-38809134 TGTCATATTAGAGGCCAGGCAGG + Intergenic
953611246 3:44449333-44449355 TGACCTCTCGGAGGCCAGCCAGG + Intronic
953668627 3:44944191-44944213 TGTGCCATTGCAGTCCAGCCTGG - Intronic
954478235 3:50769766-50769788 TGTGCCATTGCAGTCCAGCCTGG + Intronic
954488219 3:50874458-50874480 TGTTCTACTGCACTCCAGCCTGG + Intronic
954670131 3:52286483-52286505 TGTGCCATTGCAGTCCAGCCTGG + Intronic
954723382 3:52585570-52585592 CGTGCTATTGCAGTCCAGCCTGG - Intronic
954845556 3:53552422-53552444 TGTGCAATTGCAGTCCAGCCTGG - Intronic
955164176 3:56494385-56494407 TGTGCTACTGGACTCCAGCCTGG + Intergenic
955285218 3:57633845-57633867 TGTGCTATTGCACTCCAGCCTGG + Intronic
956297225 3:67727890-67727912 TGTGCTATTGCACTCCAGCCTGG + Intergenic
956358081 3:68415989-68416011 CTTTCTATGGGAGGCCATCCTGG + Intronic
956425277 3:69128083-69128105 TGTGCTATTGCACTCCAGCCTGG - Intergenic
956633963 3:71344787-71344809 TGTGCCATTGCAGTCCAGCCTGG + Intronic
956985416 3:74693796-74693818 TGTACCATTGCATGCCAGCCTGG - Intergenic
957221512 3:77388986-77389008 TGTGCTATTGCACTCCAGCCTGG - Intronic
957409729 3:79824253-79824275 TCTACTAATGTAGGCCAGCCTGG + Intergenic
957926954 3:86826719-86826741 TGTGCCATTGCACGCCAGCCTGG + Intergenic
959148728 3:102581867-102581889 TGTGCTATTGCACTCCAGCCTGG + Intergenic
959208447 3:103343846-103343868 TGCTCTACTGGACTCCAGCCTGG - Intergenic
959725175 3:109534200-109534222 TGCTCTATTGTAGCCCAGGCTGG + Intergenic
960140396 3:114146653-114146675 TGTGCCATTGGACTCCAGCCTGG + Intronic
960818813 3:121704730-121704752 TGTGCTATTGCACTCCAGCCTGG + Intronic
961217964 3:125176110-125176132 TTTCCCCTTGGAGGCCAGCCCGG - Intronic
961484256 3:127206518-127206540 TGTCCTAGGGGAGGCCAGCTGGG - Intergenic
963148415 3:142018504-142018526 TGTTCCACTGCAGTCCAGCCTGG - Intronic
963150441 3:142040469-142040491 TGTGCTATTGCACTCCAGCCTGG - Intronic
964683665 3:159370265-159370287 TGGTCTGTTGGAGGCCAGCATGG - Intronic
964714194 3:159705005-159705027 TGTGCCATTGCAGTCCAGCCTGG - Intronic
965944555 3:174224653-174224675 TGTGCCATTGCACGCCAGCCTGG + Intronic
965985689 3:174750472-174750494 TGTGCTACTGCATGCCAGCCTGG - Intronic
966405891 3:179597762-179597784 TGTGCTATTGCACTCCAGCCTGG + Intronic
966465960 3:180231688-180231710 TGTGCTATTGCACTCCAGCCTGG + Intergenic
966522190 3:180885851-180885873 TGTGCTACTGCAGTCCAGCCTGG - Intronic
966522402 3:180888220-180888242 TGTGCTACTGGACTCCAGCCTGG - Intronic
966603798 3:181801618-181801640 TGTGCCATTGCACGCCAGCCTGG + Intergenic
966607620 3:181837392-181837414 TGTGCCATTGCATGCCAGCCTGG - Intergenic
966671171 3:182527815-182527837 TGTCCTATGGGAGGCCTGCAGGG + Intergenic
966757816 3:183387886-183387908 CGTGCTATTGCACGCCAGCCTGG + Intronic
966967632 3:185010953-185010975 TGTTCCATGGGACTCCAGCCTGG + Intronic
967438466 3:189478446-189478468 TGTGCTATTGCACTCCAGCCTGG - Intergenic
967695966 3:192530856-192530878 TGCTCCATTGCATGCCAGCCTGG - Intronic
967787652 3:193514764-193514786 TGTTTTACTGGAGACCAGCATGG - Exonic
967877491 3:194277112-194277134 TGATGAATGGGAGGCCAGCCAGG - Intergenic
968151003 3:196336530-196336552 TGTTTGATTGGCGGACAGCCAGG - Intronic
968255298 3:197264465-197264487 TGTGCCATTGGACTCCAGCCTGG - Intronic
969212774 4:5700576-5700598 GGTTCTCATGGAGGTCAGCCTGG - Intronic
969317800 4:6392588-6392610 TGATCTGTTGCAGGCCAGCAAGG + Intronic
971278333 4:25219054-25219076 TGTGCTATTGCACTCCAGCCTGG + Intronic
971425248 4:26509223-26509245 TGCTCTATTGCACTCCAGCCTGG + Intergenic
972332835 4:38079682-38079704 TGTGCCATTGCAGTCCAGCCTGG + Intronic
972376226 4:38473681-38473703 TGTGCTATTGCACTCCAGCCTGG - Intergenic
972799292 4:42456902-42456924 TGTTCATAGGGAGGCCAGCCTGG - Intronic
974102100 4:57428858-57428880 TGTGCCATTGGACTCCAGCCTGG - Intergenic
974146923 4:57960377-57960399 TGCTCTATTGCATTCCAGCCTGG - Intergenic
974727499 4:65814517-65814539 TGTGCTATTGCACTCCAGCCTGG + Intergenic
975094666 4:70444204-70444226 TGTTTTATTGGAGGCCACCGTGG - Intronic
975553869 4:75640383-75640405 TGTGCTATTGCACTCCAGCCTGG + Intergenic
975650647 4:76589421-76589443 TGTGCTATTGCACTCCAGCCTGG + Intronic
976662315 4:87552303-87552325 TGTGCCATTGGACTCCAGCCTGG + Intergenic
976958430 4:90934885-90934907 TGTGCCATTGCAGTCCAGCCTGG + Intronic
977593304 4:98850790-98850812 TGTGCTATTGCACTCCAGCCTGG + Intergenic
978300091 4:107258504-107258526 TTTTCTATTGGGATCCAGCCAGG + Intronic
978483669 4:109224894-109224916 TGCGCCATTGGACGCCAGCCTGG + Intronic
978506323 4:109461978-109462000 TGGTGTATGGGAGACCAGCCTGG + Intronic
978802711 4:112770660-112770682 TGTGCTATTGTACTCCAGCCTGG + Intergenic
978837070 4:113163718-113163740 TGTGCTATTGCACTCCAGCCTGG + Intronic
978875219 4:113632544-113632566 TGTGCTATTGCACTCCAGCCTGG + Intronic
979977399 4:127213738-127213760 TGTTCCATTGCATTCCAGCCTGG + Intergenic
980910536 4:138990006-138990028 TGTGCTATTGCACTCCAGCCTGG - Intergenic
981483491 4:145260840-145260862 TGTGCTATTGCACTCCAGCCTGG + Intergenic
981561149 4:146049757-146049779 TGTGCCATTGGACTCCAGCCTGG + Intergenic
981784655 4:148463563-148463585 TGTGCCATTGCATGCCAGCCTGG + Intergenic
984212428 4:176867074-176867096 TGTGCCACTGCAGGCCAGCCTGG - Intergenic
984376552 4:178938099-178938121 TGTTCAGCTGGAGGCCATCCTGG - Intergenic
984998107 4:185455837-185455859 TGTTCCATTGCACTCCAGCCCGG + Intronic
985001233 4:185485741-185485763 TGTGCTATTGCACTCCAGCCTGG - Intergenic
985029989 4:185780057-185780079 TGTGCTATTGCACTCCAGCCTGG - Intronic
986687597 5:10288235-10288257 TGCTCTGTTGGAGCCCAGGCTGG - Intronic
988060640 5:26163714-26163736 TGTGCTATTGCACTCCAGCCTGG + Intergenic
988793587 5:34631872-34631894 TGTACTATTGCACTCCAGCCTGG - Intergenic
988816041 5:34836137-34836159 TGTTCCATTGCACTCCAGCCTGG - Intergenic
989059625 5:37397423-37397445 TGTGCCATTGCACGCCAGCCTGG + Intronic
989775388 5:45200510-45200532 TGTGCCATTGCAGCCCAGCCTGG + Intergenic
990921872 5:60977383-60977405 TGTGCCATTGCAGTCCAGCCTGG + Intronic
991062245 5:62389440-62389462 TGTGCCACTGGAGTCCAGCCTGG + Intronic
991324943 5:65420423-65420445 TGTGCTATTGTACTCCAGCCTGG - Intronic
992507294 5:77399256-77399278 AGTAATATTGGAGGCCATCCCGG + Intronic
992777348 5:80100125-80100147 TGTACCATTGCATGCCAGCCTGG - Intergenic
993499499 5:88649265-88649287 AGCACTATTGGAGGCCAGCCTGG + Intergenic
994232425 5:97323483-97323505 TGTGCTATTGCACTCCAGCCTGG - Intergenic
995329287 5:110929249-110929271 TGTGCTACTGCAGTCCAGCCTGG - Intergenic
995431567 5:112085103-112085125 TGTGCCATTGTAGTCCAGCCTGG - Intergenic
995485607 5:112637102-112637124 TGTTCTATAGCACTCCAGCCCGG - Intergenic
996035560 5:118754603-118754625 TGTGCTACTGGACTCCAGCCTGG + Intergenic
996220524 5:120926842-120926864 TGTGCCATTGGAATCCAGCCTGG - Intergenic
996384950 5:122901155-122901177 TGTGCTATTGCACTCCAGCCTGG + Intronic
996434183 5:123415826-123415848 TGTGCTATTGCACTCCAGCCTGG + Intronic
997151812 5:131504416-131504438 TGTGCTATTGCACTCCAGCCTGG + Intronic
997475182 5:134138601-134138623 TGGTCTAGGGGAGCCCAGCCTGG - Intronic
997489388 5:134260581-134260603 TGTTCCATTGCACTCCAGCCTGG - Intergenic
997968852 5:138383904-138383926 TGTGCTATTGCACTCCAGCCTGG + Intronic
998116254 5:139539961-139539983 TGTGCTATTGCACTCCAGCCTGG - Intronic
998578147 5:143340524-143340546 TGTGCCATTGGACTCCAGCCTGG - Intronic
999658133 5:153830452-153830474 TGTACCATTGCATGCCAGCCTGG - Intergenic
999743187 5:154572583-154572605 TGTACTATTGCACTCCAGCCTGG + Intergenic
999778305 5:154828638-154828660 TGTGCTATTGCACTCCAGCCTGG - Intronic
1000960054 5:167589156-167589178 TGTGCCATTGCATGCCAGCCTGG + Intronic
1001036650 5:168301592-168301614 TGTGCTATTGCACTCCAGCCTGG + Intronic
1001120936 5:168979297-168979319 TGTGCACTTGGAGGCCAGACAGG + Intronic
1001379033 5:171290322-171290344 TGTGCTATTGCACTCCAGCCTGG + Intronic
1001897058 5:175391567-175391589 TGTGCTATTGTACTCCAGCCTGG - Intergenic
1002639559 5:180624268-180624290 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1003133844 6:3417884-3417906 TGAGCTTTTGGAGGCAAGCCTGG + Intronic
1004371535 6:15056592-15056614 TGCACTATTGCACGCCAGCCTGG + Intergenic
1005041379 6:21603197-21603219 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1005079264 6:21940545-21940567 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1005472986 6:26180305-26180327 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1005513208 6:26530588-26530610 TGTGCTATTGCACCCCAGCCTGG + Intergenic
1005744863 6:28827013-28827035 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1006145319 6:31955490-31955512 TGCTCTATTGCACTCCAGCCTGG - Intronic
1006649097 6:35536229-35536251 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1007086713 6:39153005-39153027 TGTTCCACTGCAGTCCAGCCTGG + Intergenic
1007898389 6:45386109-45386131 TGTTCCATTGCACTCCAGCCTGG - Intronic
1008492382 6:52099847-52099869 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1010217887 6:73420969-73420991 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1010297359 6:74215454-74215476 TTTTGCATTTGAGGCCAGCCTGG + Intergenic
1011984883 6:93430929-93430951 TGTGCCATTGCATGCCAGCCTGG + Intergenic
1012058344 6:94444823-94444845 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1012384376 6:98661685-98661707 TGTTCTACTGGAGGGCAGTTTGG - Intergenic
1012454634 6:99390736-99390758 TGTTCCACTGCAGTCCAGCCCGG - Intronic
1013131364 6:107236422-107236444 TGTGCCATTGGACTCCAGCCTGG + Intronic
1013330804 6:109098189-109098211 TGTGCTATTGCACTCCAGCCTGG - Intronic
1014423837 6:121277442-121277464 TGTGCTATTGTACTCCAGCCTGG + Intronic
1015420916 6:133007393-133007415 TGTGCCATTGCAGTCCAGCCTGG - Intergenic
1015501586 6:133939367-133939389 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1015726139 6:136301549-136301571 TGTACTATTGCACTCCAGCCTGG - Intergenic
1016821739 6:148352924-148352946 TGTGCTACTGTACGCCAGCCCGG + Intronic
1017045668 6:150345059-150345081 TGCACTATTGCATGCCAGCCTGG + Intergenic
1017085548 6:150709828-150709850 TGTACCACTGGAGTCCAGCCTGG - Intronic
1017144665 6:151223637-151223659 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1017382806 6:153849746-153849768 TCATCTATTGGAGGACATCCTGG - Intergenic
1018183861 6:161247936-161247958 TGTTCCATTGCACTCCAGCCTGG + Intronic
1018337206 6:162806150-162806172 TGTGCTATTGCACTCCAGCCTGG - Intronic
1019345021 7:525418-525440 TGGCCTATTGGGGGCCAGCATGG + Intergenic
1019642000 7:2108360-2108382 TGTTCTACTGGAGGACAGAGAGG + Intronic
1019687036 7:2387741-2387763 TGTTCCATTGCACTCCAGCCTGG - Intergenic
1019739916 7:2667615-2667637 CGTACTATTGCACGCCAGCCTGG - Intergenic
1020053535 7:5100172-5100194 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1020658266 7:10953055-10953077 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1021216508 7:17922216-17922238 TGTTCTAGTTGCGGCTAGCCAGG + Intronic
1021735007 7:23634409-23634431 TGTGCTATTGCACTCCAGCCTGG + Intronic
1021893821 7:25214611-25214633 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1022737572 7:33090391-33090413 TGTTCCATTGCACTCCAGCCTGG - Intergenic
1023000677 7:35804245-35804267 TTTTCTTTTGGAAGCCACCCTGG - Intronic
1023976538 7:45034560-45034582 TGTGCTATTGCACCCCAGCCTGG - Intronic
1024927043 7:54628081-54628103 TGTGCTGTTGCACGCCAGCCTGG - Intergenic
1024947040 7:54819280-54819302 TGTACCATTGGACTCCAGCCTGG - Intergenic
1024955399 7:54914226-54914248 TGTGCCATTGCATGCCAGCCTGG - Intergenic
1025706440 7:63869311-63869333 TGTGCTACTGCACGCCAGCCTGG + Intergenic
1025974810 7:66361400-66361422 TGTGCTACTGCAGGCCAGCTGGG - Intronic
1026022747 7:66722394-66722416 TGTGCCATTGCACGCCAGCCTGG + Intronic
1026079410 7:67204636-67204658 TGTGCCATTGGATTCCAGCCTGG - Intronic
1026614214 7:71887337-71887359 TGTACCATTGCATGCCAGCCTGG - Intronic
1026851608 7:73727345-73727367 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1026997278 7:74626057-74626079 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1027110935 7:75439423-75439445 TGTGCTATTGCACTCCAGCCTGG - Intronic
1027246147 7:76369008-76369030 TGGTCTGAAGGAGGCCAGCCTGG + Intergenic
1027398598 7:77784542-77784564 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1027657064 7:80943782-80943804 TTTTCTTTTGGAGGCTATCCTGG - Intergenic
1029178743 7:98684202-98684224 TGTGCTGTTGGACTCCAGCCTGG - Intergenic
1029266090 7:99341563-99341585 TGTGCCATTGCACGCCAGCCTGG + Intronic
1029833932 7:103289607-103289629 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1029837743 7:103331000-103331022 TGTGCCATTGCATGCCAGCCTGG - Intronic
1030442876 7:109610715-109610737 TTTTCTTTTTGAGACCAGCCTGG - Intergenic
1031200009 7:118670218-118670240 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1032164640 7:129535811-129535833 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1032776475 7:135119271-135119293 TGTTCCACTGGACTCCAGCCTGG - Intronic
1032797347 7:135288553-135288575 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1033140285 7:138820509-138820531 TGTGCTACTGCAGTCCAGCCTGG - Intronic
1033370394 7:140701890-140701912 TGTTCCATTGCACTCCAGCCTGG + Intronic
1033403405 7:141048969-141048991 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1033786177 7:144733179-144733201 TGTTCCATTGCACTCCAGCCTGG + Intronic
1034715265 7:153235888-153235910 TGTGCCATTGCATGCCAGCCTGG + Intergenic
1034837954 7:154370024-154370046 TGTGCTATTGCACTCCAGCCTGG - Intronic
1035159215 7:156938856-156938878 TGTACTACTGCACGCCAGCCTGG - Intergenic
1035205564 7:157291924-157291946 TGTGCTATGTGACGCCAGCCCGG - Intergenic
1035927214 8:3741168-3741190 CGTGCTATTGCAGTCCAGCCCGG + Intronic
1036255505 8:7203145-7203167 TGCACCACTGGAGGCCAGCCTGG - Intergenic
1036361985 8:8084358-8084380 TGCACCACTGGAGGCCAGCCTGG + Intergenic
1036460036 8:8944158-8944180 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1036556651 8:9865957-9865979 TGCTCTATTGCACTCCAGCCTGG - Intergenic
1036957156 8:13200646-13200668 TGTACTACTGCAGGCCAGCCTGG - Intronic
1037333982 8:17774193-17774215 TTTCAGATTGGAGGCCAGCCTGG - Intronic
1037596232 8:20356555-20356577 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1037687771 8:21158330-21158352 TGTACCATTGGACTCCAGCCTGG - Intergenic
1037727882 8:21498249-21498271 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1038091884 8:24263445-24263467 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1038348173 8:26751023-26751045 TGTGCTATTGCACTCCAGCCTGG + Intronic
1038598107 8:28908720-28908742 TGTGCCATTGGACTCCAGCCTGG + Intronic
1038717712 8:30006721-30006743 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1038949261 8:32396490-32396512 TGTGCTATTGCATTCCAGCCTGG - Intronic
1039684691 8:39785751-39785773 TGTGCTATTGCACTCCAGCCTGG + Intronic
1040014700 8:42691044-42691066 TGCTTTATTGAAGGCCAGACTGG - Intergenic
1040031407 8:42827609-42827631 TGTTCTATTGCACTCCAGCCTGG - Intergenic
1040369094 8:46750513-46750535 TGTTCTAATGCACTCCAGCCTGG - Intergenic
1040500650 8:48002043-48002065 TGCGCTATTGCATGCCAGCCTGG + Intergenic
1040518707 8:48156078-48156100 TGTGCCACTGGAGACCAGCCTGG + Intergenic
1040773504 8:51010300-51010322 TGTGCCATTGCACGCCAGCCTGG - Intergenic
1041056517 8:53991648-53991670 TGTGCCATTGGACTCCAGCCTGG + Intronic
1041071620 8:54130980-54131002 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1041088921 8:54283626-54283648 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1041155448 8:54980896-54980918 TGTTCCACTGCAGTCCAGCCTGG + Intergenic
1041300711 8:56408190-56408212 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1042526242 8:69767844-69767866 TGTGCCATTGCAGTCCAGCCTGG + Intronic
1042918748 8:73900721-73900743 TGTGCTATTGTACTCCAGCCTGG + Intergenic
1043290148 8:78588855-78588877 TGTTCCATTGCACCCCAGCCTGG + Intronic
1043875720 8:85484141-85484163 TGTGCTATTGTAGTCCAGCCTGG - Intergenic
1043932088 8:86103159-86103181 CGTGCCATTGGAGACCAGCCTGG - Intronic
1044158475 8:88881301-88881323 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1044393884 8:91685932-91685954 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1045298979 8:100894564-100894586 TGTACCACTGCAGGCCAGCCTGG - Intergenic
1045864075 8:106844882-106844904 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1046124121 8:109882754-109882776 TGTGCCATTGCAGTCCAGCCTGG + Intergenic
1046188861 8:110762889-110762911 TGCTCTATTGTACTCCAGCCTGG + Intergenic
1046483681 8:114856788-114856810 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1046755849 8:117972104-117972126 TGTGCCATTGCAGTCCAGCCCGG + Intronic
1047511435 8:125518847-125518869 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1047655528 8:126973067-126973089 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1048033292 8:130652965-130652987 TGTGCCATTGGACTCCAGCCTGG + Intergenic
1049688229 8:143947704-143947726 TGTGCTATTGCACTCCAGCCTGG + Intronic
1049723175 8:144130771-144130793 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1050144728 9:2555190-2555212 TGTTCTACTGCACTCCAGCCTGG - Intergenic
1050557653 9:6803524-6803546 TGGGCCATTGGAGTCCAGCCTGG + Intronic
1050891565 9:10830862-10830884 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1051653523 9:19354596-19354618 TGTGCCATTGGACTCCAGCCTGG - Intronic
1051928715 9:22360239-22360261 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1053106091 9:35409758-35409780 TGTGCTATTGCAGTCCAACCTGG + Intergenic
1053656807 9:40224063-40224085 TGTGCCATTGGACACCAGCCTGG - Intronic
1053907176 9:42853346-42853368 TGTGCCATTGGACACCAGCCTGG - Intergenic
1054368926 9:64370344-64370366 TGTGCCATTGGACACCAGCCTGG - Intronic
1054527790 9:66152164-66152186 TGTGCCATTGGACACCAGCCTGG + Intronic
1054676557 9:67860099-67860121 TGTGCCATTGGACACCAGCCTGG - Intronic
1055104109 9:72494780-72494802 TGTGCTATTGTACTCCAGCCTGG - Intergenic
1056339478 9:85611722-85611744 TGTGCTATTGCACTCCAGCCTGG - Intronic
1056689390 9:88793729-88793751 TGTGCCATTGCATGCCAGCCTGG + Intergenic
1056920220 9:90780904-90780926 TGTACCATTGCAGTCCAGCCTGG + Intergenic
1057393035 9:94655028-94655050 TGCACTATTGCACGCCAGCCTGG - Intergenic
1057452737 9:95179388-95179410 TGTGCCATTGCACGCCAGCCTGG - Intronic
1057731458 9:97612597-97612619 TGTGCTATTGCACTCCAGCCTGG - Intronic
1058141771 9:101363963-101363985 TGTGCTATTGTACCCCAGCCTGG + Intronic
1060406951 9:123377567-123377589 TGTTCTCCAGGAGGCCAGGCCGG + Exonic
1060556303 9:124508925-124508947 TGTGCTACTGCAGTCCAGCCTGG + Intergenic
1060632478 9:125172259-125172281 TGTGCTACTGGACTCCAGCCTGG - Intronic
1061214830 9:129215676-129215698 TGCACTATTGCACGCCAGCCTGG + Intergenic
1203748785 Un_GL000218v1:59317-59339 TGTGCCATTGGACACCAGCCTGG - Intergenic
1187970752 X:24655738-24655760 TGTGCTATTGCACTCCAGCCTGG + Intronic
1189203375 X:39216910-39216932 GGTGCTACTGGAGTCCAGCCTGG + Intergenic
1189398370 X:40643550-40643572 TGTGCTATTGCACTCCAGCCTGG - Intronic
1189538799 X:41964874-41964896 TGTACCATTGCAGTCCAGCCTGG - Intergenic
1189922634 X:45917590-45917612 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1190705696 X:53024809-53024831 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1190770779 X:53512434-53512456 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1190837902 X:54118177-54118199 TGTGCCATTGGACTCCAGCCTGG + Intronic
1193114439 X:77763186-77763208 TGTGCCATTGCAGTCCAGCCTGG - Intronic
1193572804 X:83164187-83164209 TGCTCTATTGCACTCCAGCCTGG + Intergenic
1193827458 X:86243066-86243088 TACTCTGTTGGAGACCAGCCTGG - Intronic
1194053026 X:89095875-89095897 TGTTCCATTGCACTCCAGCCTGG - Intergenic
1194162857 X:90476364-90476386 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1196537625 X:116866491-116866513 TGTGCCATTGGACTCCAGCCTGG - Intergenic
1196558282 X:117117363-117117385 TGTGCTATTGCACTCCAGCCTGG - Intergenic
1197809977 X:130432715-130432737 TGCTCCATTGCACGCCAGCCTGG - Intergenic
1198423263 X:136489466-136489488 TATTCTATTTGAGGGCAGACTGG + Intronic
1198679408 X:139165594-139165616 TGAACTTTTGGAGGCCACCCAGG - Intronic
1200130149 X:153837814-153837836 TGTGCCATTGCACGCCAGCCTGG + Intergenic
1200423812 Y:3000880-3000902 TGTGCTATTGCACGCCAGCCTGG - Intergenic
1200509133 Y:4054095-4054117 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1200877363 Y:8172017-8172039 TGCCCTATTGGACTCCAGCCTGG - Intergenic
1201162142 Y:11174350-11174372 TGTGCCATTGGACACCAGCCTGG - Intergenic
1201336953 Y:12891814-12891836 TGTGCTGTTGGACTCCAGCCTGG + Intergenic
1201364795 Y:13191871-13191893 TGTGCTATTGCACTCCAGCCTGG + Intergenic
1201523486 Y:14903680-14903702 TGTTCCATTGCACTCCAGCCTGG + Intergenic
1201934100 Y:19387345-19387367 TGTTCCATTGTACTCCAGCCTGG - Intergenic
1201949626 Y:19549802-19549824 TGTTCCATTGCATGCCATCCAGG + Intergenic