ID: 1100510076

View in Genome Browser
Species Human (GRCh38)
Location 12:95261957-95261979
Sequence GATTGTGCACAGAGTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100510076_1100510077 30 Left 1100510076 12:95261957-95261979 CCATGTGCACTCTGTGCACAATC 0: 1
1: 0
2: 2
3: 9
4: 159
Right 1100510077 12:95262010-95262032 CACACTTCCCCAAATTAGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100510076 Original CRISPR GATTGTGCACAGAGTGCACA TGG (reversed) Intronic
900082400 1:867942-867964 GAATGTGCTCATAGTGGACATGG + Intergenic
903336797 1:22629880-22629902 GAGTGTGCACAGACAACACATGG + Intergenic
904935698 1:34128146-34128168 GATTGAGCTCAGAGTCCAGAGGG - Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
907277596 1:53325981-53326003 GTTTCTTCTCAGAGTGCACAGGG - Intronic
909533291 1:76705700-76705722 TATTGTACATACAGTGCACAAGG + Intergenic
911419887 1:97627428-97627450 CATTGTGCACTGAGAGCACGAGG + Intronic
917168109 1:172136442-172136464 GAGTGTGAACAGTGTTCACAGGG - Intronic
918235783 1:182579471-182579493 TGTTCTGCACAGAGTGCACCTGG - Intronic
918350713 1:183653010-183653032 GATTGTGCACAGATTGTGAAGGG - Intronic
920211086 1:204328722-204328744 GACTGTGCAGACACTGCACAGGG - Intronic
920224243 1:204426505-204426527 GACTTTGCAAAGAGTGCTCAGGG - Intronic
920502521 1:206494266-206494288 GCTTGAGCACAGAGTACATATGG - Intronic
920812779 1:209302864-209302886 GGTTCTGCCCAGAGTGCAAAAGG + Intergenic
922660712 1:227428286-227428308 GATTCTGCGCAGACTGCACTTGG - Intergenic
1070313476 10:75290383-75290405 GCTTGTACAGAGAGTTCACATGG - Intergenic
1070459214 10:76648119-76648141 GAATGTGCCCAGAGTCCAAAGGG - Intergenic
1071789685 10:88940926-88940948 GATTGTGCAGAGACTGAAGATGG - Intronic
1072323661 10:94275088-94275110 GACTGTGCACAGAATGGAAAAGG - Intronic
1072677139 10:97476170-97476192 AATTGTGCACAGTGTACAGAAGG - Intronic
1075446228 10:122515351-122515373 GAATGGGCCCAGAATGCACACGG + Intergenic
1077189811 11:1251192-1251214 GATTGTGGACATGGTGGACATGG - Exonic
1079336240 11:19573230-19573252 GATTCTGAACAGGGTGCCCAGGG - Intronic
1081042465 11:38228202-38228224 GATGGGGCACAGAGTGGGCAGGG + Intergenic
1087196007 11:95304910-95304932 GATTGTACACAGAATGCATGAGG + Intergenic
1098861728 12:75718307-75718329 AATTGTGCACAGAGCACACCTGG - Intergenic
1099082865 12:78208179-78208201 GAGTGTGCAGAGAGGTCACATGG + Intronic
1099669820 12:85675430-85675452 GAGTGTGCTCTGAGAGCACAAGG - Intergenic
1100368958 12:93947566-93947588 GATGGTGCACAGAGTCCATCTGG + Intergenic
1100510076 12:95261957-95261979 GATTGTGCACAGAGTGCACATGG - Intronic
1101147408 12:101854249-101854271 AAATGTGCCAAGAGTGCACATGG - Intergenic
1102645854 12:114403398-114403420 GATTCTACACATAGTGCAGAGGG + Intronic
1106466068 13:30015667-30015689 GAGTGTGCACAGTGAGCACCAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108885144 13:55171066-55171088 GAATATGCATTGAGTGCACAGGG + Intergenic
1109476873 13:62890932-62890954 GATGGTGCAAAGAGTGGACTAGG + Intergenic
1114556700 14:23566359-23566381 CATGGTGCTCAAAGTGCACAAGG + Exonic
1114579750 14:23746681-23746703 GAAAGTGCAATGAGTGCACAGGG + Intergenic
1116478064 14:45364836-45364858 GTTTGGGCTGAGAGTGCACAGGG + Intergenic
1122622182 14:103065672-103065694 GAATGGGCACAGAGTACCCATGG + Intergenic
1127819654 15:62643846-62643868 TATTCTGCACCAAGTGCACATGG - Intronic
1128801110 15:70497725-70497747 GATTGTCCACAGAGTGCACTTGG - Intergenic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1131786643 15:95920215-95920237 TATTATGCATAGAGTGAACATGG + Intergenic
1133545620 16:6803491-6803513 GATTATACACAGATTGCACTGGG - Intronic
1138338768 16:56273985-56274007 GATGCTTCAGAGAGTGCACAGGG - Intronic
1139406613 16:66724131-66724153 GATGGTGGTGAGAGTGCACAGGG - Intronic
1142819146 17:2450445-2450467 GAGTGTGGACAGACTGCAGAGGG + Intronic
1143408006 17:6690824-6690846 GCTTGTGCACTCAGTGAACACGG + Exonic
1144016345 17:11199987-11200009 GTTTGGGCACGGAGTCCACAAGG + Intergenic
1145276121 17:21431881-21431903 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145313965 17:21717795-21717817 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145328014 17:21848123-21848145 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1145348604 17:22057762-22057784 GATGCTGCACAGAGTGTAAAGGG - Intergenic
1145414982 17:22707593-22707615 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1145694819 17:26779507-26779529 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1146857995 17:36270994-36271016 GGTTGTGCACAGCTTCCACATGG + Intronic
1147076789 17:37995529-37995551 GGTTGTGCACAGCTTCCACATGG + Intronic
1147077014 17:37997530-37997552 GGTTGTGCACAGCTTCCACATGG - Intronic
1147088315 17:38075075-38075097 GGTTGTGCACAGCTTCCACATGG + Intergenic
1147108895 17:38245442-38245464 GGTTGTGCACAGCTTCCACATGG - Intergenic
1148420557 17:47542660-47542682 GGTTGTGCACAGCTTCCACATGG + Intronic
1151025024 17:70668552-70668574 GCTTGTGCACAGTGTCAACAGGG - Intergenic
1203192634 17_KI270729v1_random:204344-204366 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1203202001 17_KI270730v1_random:3779-3801 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1154060627 18:11056284-11056306 GATTTTGCTCAGAGTGGTCAAGG + Intronic
1154350597 18:13580166-13580188 GAGTGTGCACAGTATGCACGAGG - Intronic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1156754516 18:40505408-40505430 GATTGAGATCTGAGTGCACAGGG + Intergenic
1157408608 18:47445059-47445081 GACTGGGCATAGAATGCACAGGG - Intergenic
1157714891 18:49877645-49877667 GATGGTGACCAGAGTGCCCAGGG - Intronic
1158896924 18:61922881-61922903 GCCTGTGCACAGAATGTACATGG + Intergenic
1167412240 19:49351455-49351477 GATTGTGCACAAAATGCACAGGG - Intronic
1168514165 19:56996773-56996795 GTGTGTGCACAGAGTGGACCTGG + Intergenic
925043049 2:748550-748572 CCTTGTGCACAGAGCGCGCATGG - Intergenic
925339647 2:3127235-3127257 GATTCTGGACAGAATGCACTGGG - Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926688049 2:15713773-15713795 GTCTGTGTACAGTGTGCACAGGG - Intronic
927192118 2:20524048-20524070 GATTATGCCCAGTGTGCAGAAGG - Intergenic
927204673 2:20599519-20599541 GATTGTGGACAGAGGTCAAAGGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928651834 2:33411914-33411936 GAAAGTGCACAGAGACCACAGGG - Intergenic
928687911 2:33768316-33768338 GATTCTCCACTGAGGGCACAAGG + Intergenic
931040618 2:58294955-58294977 TATTGTGCACAGAGTGTGCATGG + Intergenic
931828587 2:66027047-66027069 GATGTTGCACAGACTGCAAATGG + Intergenic
932109148 2:68978909-68978931 CATTGTGCACAAAATGAACAAGG + Exonic
932734627 2:74246065-74246087 GGATGTGCCCAGAGTGCCCAGGG - Intronic
935842798 2:107131548-107131570 GAAAGTGCAAAGAGTGCCCAAGG - Intergenic
937729478 2:125210397-125210419 AATTGTGCTCAGAGTTCACAAGG + Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
941457123 2:165722186-165722208 GGGTTAGCACAGAGTGCACAGGG - Intergenic
948268753 2:236657708-236657730 GATTGGGAACAGAGACCACATGG - Intergenic
948564259 2:238873598-238873620 GAAGGTGCACACCGTGCACAAGG + Intronic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1171407101 20:24918813-24918835 GAGTGTGCACAAAGTGTGCAGGG - Intergenic
1171518284 20:25756945-25756967 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1171558573 20:26099261-26099283 GATGCTGCACAGAGTGTAAAGGG - Intergenic
1176652444 21:9563359-9563381 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1182048922 22:27298603-27298625 GATTGTGGGCAGAGGTCACAGGG - Intergenic
1182101953 22:27663697-27663719 GATTGTCCAATAAGTGCACAAGG + Intergenic
949840546 3:8315412-8315434 GATTTTAGACAGAGTGTACAGGG + Intergenic
950469086 3:13173570-13173592 GATTGTCCACAGAGCCCACAGGG - Intergenic
950472990 3:13197954-13197976 GTGTGTGCACAGCGTGCACCCGG + Intergenic
953208710 3:40855200-40855222 GAATGTGAGCAGAGTGGACAGGG + Intergenic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
957464758 3:80573193-80573215 GATTGTGCAAAGACTGCAGGAGG + Intergenic
961090374 3:124106140-124106162 GATTGAACAAAGAGTGCAGATGG + Intronic
963069122 3:141288102-141288124 GATGGTGAACTGACTGCACATGG - Intronic
963761616 3:149291164-149291186 GATTGTGCTAAGAGAGCAGAAGG - Intergenic
964278789 3:155038674-155038696 GTTTGTGCATAGTGTACACAGGG - Intronic
965322543 3:167267020-167267042 GTTTGTGCACAGAGTTTACCTGG - Intronic
965869939 3:173253094-173253116 GTGGGTGCACAGAGTACACAGGG - Intergenic
966619455 3:181947790-181947812 CATTGTTCACAGTGTGAACAGGG - Intergenic
966722306 3:183076190-183076212 TATTGGGAACAGATTGCACATGG - Intronic
969413790 4:7045931-7045953 GAATGTGCACACAGAGCACCTGG + Intronic
976010075 4:80476312-80476334 GTGTGTGCACAGGGTACACACGG + Intronic
977564820 4:98570011-98570033 GGATGTGCACAGAGTCCAAAGGG + Intronic
977979779 4:103307804-103307826 GACTGTGCCCAGACTCCACATGG + Intergenic
978147684 4:105395320-105395342 GACTGTGCTCAGAGAGCACAGGG + Intronic
980818278 4:137977702-137977724 AATTTAGCACAGAGTGCATAGGG - Intergenic
981057864 4:140384329-140384351 GGTGGTACACAGTGTGCACAGGG + Exonic
981675304 4:147336450-147336472 AATTGTGAACAGATTGCTCATGG - Intergenic
982562994 4:156954079-156954101 TATGGTGCCCAGACTGCACAAGG - Intronic
983024840 4:162722989-162723011 TATTGTGAAGAGAGTGCATAAGG + Intergenic
984986432 4:185334864-185334886 GATTGTCCACAGGCTGCTCACGG + Intronic
986170899 5:5313739-5313761 CATTCTGCACCAAGTGCACACGG + Intronic
986992314 5:13568741-13568763 GCATGTGCACAGAGATCACATGG - Intergenic
990522700 5:56595188-56595210 AATTCTGCACAGAGTACAAATGG + Intronic
995004849 5:107179948-107179970 GTTTGTGCTCTGAGTACACAAGG + Intergenic
995444559 5:112228365-112228387 GTTTGTGCACAGTGTGCAAGAGG - Intronic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
998151201 5:139758552-139758574 GTTTGTGCCCACACTGCACAGGG - Intergenic
999871259 5:155753728-155753750 GATTGAGAACTGAGTTCACAAGG - Intergenic
1002923374 6:1589748-1589770 GATGGTGCACAGAATACACAGGG - Intergenic
1003168640 6:3703024-3703046 GAGAGAGCACAGAGTGCACAGGG + Intergenic
1005410080 6:25535398-25535420 GATTGTGCAGAGTGTTCTCAAGG + Intronic
1005484613 6:26287758-26287780 GATTGTACACTAAGTGCACTGGG + Intergenic
1006602126 6:35233164-35233186 CACTGTGCACAGAGAGGACAGGG - Exonic
1008366034 6:50681676-50681698 GAGTGTGCACTGAGTGAACCAGG - Intergenic
1011753109 6:90473032-90473054 GATTCTGAACAGATTGCACAAGG + Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1014791585 6:125678540-125678562 ATTTGTGCAAAGAGTGCCCAAGG - Intergenic
1017273119 6:152532670-152532692 AAGGGTGCACAGAATGCACATGG - Intronic
1018144538 6:160871619-160871641 TATTTTGCAAAGATTGCACAAGG + Intergenic
1021828774 7:24581663-24581685 GATGCTGCAAACAGTGCACAGGG + Intronic
1023024196 7:36036117-36036139 GAGAGTCTACAGAGTGCACACGG - Intergenic
1023878667 7:44306649-44306671 GATTATGCAGATAATGCACAGGG + Intronic
1025279111 7:57614286-57614308 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1025305620 7:57851214-57851236 GATGCTGCACAGAGTGTAAAGGG - Intergenic
1031602961 7:123734915-123734937 AATTGTGCAGAAAGTGCAAAGGG - Intronic
1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG + Intergenic
1039787139 8:40843730-40843752 CATTCTGCAGAGAGTGGACAAGG - Intronic
1040887578 8:52282597-52282619 GATTGTGCTCAGCCTACACAAGG - Intronic
1041435960 8:57841967-57841989 TATTCTGCTCAGAGGGCACATGG - Intergenic
1043171600 8:76972872-76972894 GCTTATTCACAGAGTACACAGGG - Intergenic
1044294599 8:90512651-90512673 GATTGTGCACAGGATACAGAGGG + Intergenic
1044535241 8:93350266-93350288 GCTTATTCACAGAGTGGACAAGG + Intergenic
1046694285 8:117321272-117321294 TATTGTGCTCAGAGTGTACTGGG - Intergenic
1057171358 9:92965130-92965152 GATTGTGCCCACTGTGCAGAGGG + Intronic
1203630173 Un_KI270750v1:66900-66922 GATGCTGCACAGAGTGTAAAGGG + Intergenic
1189404550 X:40708580-40708602 GACTGTGCACTGTGGGCACAAGG + Intronic
1190110089 X:47583681-47583703 GCTTGGGCACAGAGTACTCAAGG - Intronic
1192765523 X:74136170-74136192 GACTGTGTAGACAGTGCACAAGG - Intergenic
1194769521 X:97884328-97884350 GATTGAACAAAGAGTGCATAAGG + Intergenic
1195130214 X:101843724-101843746 GATTGTTCACAGAATGCATTTGG - Intronic
1195176056 X:102316549-102316571 GATTGTTCACAGAATGCATTTGG + Intronic
1195182808 X:102370544-102370566 GATTGTTCACAGAATGCATTTGG - Intronic
1198224425 X:134632278-134632300 AATTGTCCACAAAGTGCAAATGG + Intronic
1198632558 X:138657058-138657080 AATTGAGCTCAGAGTGCACAGGG - Intronic
1200122479 X:153797683-153797705 GAGTGTGGGCAGAGTGGACACGG - Intronic
1200671570 Y:6098704-6098726 GCATGTGCACAGAGTCCTCAAGG + Intergenic