ID: 1100510983

View in Genome Browser
Species Human (GRCh38)
Location 12:95273141-95273163
Sequence GCATTGTCTACATATAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100510983 Original CRISPR GCATTGTCTACATATAAACC AGG (reversed) Intronic
907088149 1:51697834-51697856 ATATTGTTTCCATATAAACCAGG + Intronic
907117236 1:51979578-51979600 GCTTTTTCTACATAAAAACAAGG + Intronic
907530974 1:55096697-55096719 GTATTGTCTACAAATAAAGCAGG + Intronic
909581419 1:77239993-77240015 GAATTCTCTACAAACAAACCTGG - Intergenic
910466143 1:87502281-87502303 GCATTGTCAACATTTATACCAGG - Intergenic
911763456 1:101643735-101643757 TCATTGTCTACATCAAAGCCAGG + Intergenic
916215759 1:162391722-162391744 GCATTGTTAACATGTTAACCTGG + Intergenic
918396846 1:184122277-184122299 GCATTGTCTACAGCTGCACCTGG - Intergenic
919553498 1:199023303-199023325 TCAGTGTCTACATACAAACATGG - Intergenic
922649470 1:227324850-227324872 GCATAGTCTAAATATTAATCAGG - Intergenic
1068110742 10:52677819-52677841 GAAATGTATACATATTAACCAGG - Intergenic
1069283505 10:66685044-66685066 GCATTTGCTACATATAAAAATGG + Intronic
1070856323 10:79610596-79610618 TCATTGTCTGAATCTAAACCAGG + Intergenic
1072252432 10:93592154-93592176 TCATTATCTACATAAAAACTGGG - Intronic
1074536307 10:114330609-114330631 GCATTTCTTCCATATAAACCAGG + Intronic
1083195003 11:61080755-61080777 GCATTCTCTGCAGCTAAACCTGG + Intergenic
1084842067 11:71862059-71862081 GCATTGTCTACACAGAACACAGG - Intergenic
1091884359 12:4005086-4005108 GTATTGTCTCCATATGAAACAGG + Intergenic
1093672175 12:21890211-21890233 GCATTTTAAAAATATAAACCTGG - Intronic
1095287858 12:40437477-40437499 CCATTTTCTACAGAGAAACCAGG + Intronic
1096727261 12:53574583-53574605 GCCTTTTCTGCATATAAGCCAGG - Intronic
1100510983 12:95273141-95273163 GCATTGTCTACATATAAACCAGG - Intronic
1105287573 13:19018351-19018373 GCAATGTCTACAAATAAAGCAGG + Intergenic
1106360198 13:29024509-29024531 GCATTGTCTTGATATACAGCAGG - Exonic
1109872033 13:68344814-68344836 GCCTTGTCTGAATATAATCCAGG + Intergenic
1109937202 13:69303083-69303105 GTATTGTCTGCATATACACTTGG + Intergenic
1117392764 14:55278173-55278195 GCATTGCCTATATGTAAAACAGG + Intronic
1123166569 14:106330762-106330784 GCAGTGTCTACAGACACACCCGG + Intergenic
1135496067 16:22952335-22952357 ACATTGACTACATACAAACTTGG + Intergenic
1137391677 16:48086616-48086638 GTGGTGTCTACAAATAAACCTGG + Intronic
1139044617 16:63041600-63041622 GCTTTGTATAAATATAAGCCTGG + Intergenic
1141425072 16:83939578-83939600 GCCTTGTCTACTCAGAAACCAGG + Intronic
1141779334 16:86148912-86148934 GCATTGTCAACAAATGATCCTGG + Intergenic
1143835065 17:9685058-9685080 GCATTGTTTAAATAAAAACTTGG + Intronic
1144617161 17:16787284-16787306 GCTTTGTCTTCCTCTAAACCAGG + Intronic
1144895533 17:18528389-18528411 GCTTTGTCTTCCTCTAAACCAGG - Intergenic
1145136683 17:20415841-20415863 GCTTTGTCTTCCTCTAAACCAGG + Intergenic
1151007289 17:70452299-70452321 CCTGTGTCTACATATCAACCTGG + Intergenic
1151073807 17:71248110-71248132 GCGATGTCTACACATGAACCAGG + Intergenic
1151752134 17:76045340-76045362 GCTTTGTCTTCCTCTAAACCAGG + Exonic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1167475629 19:49699314-49699336 GAATTGTCTACATCTGATCCTGG - Intronic
926055368 2:9771189-9771211 GCCTTGTCTCCAGAGAAACCGGG + Intergenic
927273039 2:21234135-21234157 GTGTTCTCTACATATAAAGCTGG + Intergenic
933770236 2:85739227-85739249 ACATTGTGTAAGTATAAACCAGG - Intergenic
938395669 2:130945993-130946015 CCATTGTCCAGAGATAAACCTGG - Intronic
941461415 2:165776654-165776676 GCAATGGCTACATATATACCAGG - Intronic
945657712 2:212645185-212645207 GCATTTTTTACAAATAATCCTGG + Intergenic
945757498 2:213866706-213866728 GGATTGTCTACATTTTTACCTGG - Intronic
947013633 2:225592889-225592911 GCATTTTATACATCTAAAGCAGG - Intronic
1169930498 20:10827618-10827640 GCATTGTCTACTTTTAAGTCTGG - Intergenic
1171002281 20:21426552-21426574 GAATTTTCTGCATATAAAGCCGG - Intergenic
1171433717 20:25103745-25103767 GCATTGTCTAGTTTTATACCAGG - Intergenic
1175035960 20:56002399-56002421 GTGTTGGCTACATATAAAACTGG + Intronic
1177284715 21:19035006-19035028 GCAGAGTCTACATTTCAACCGGG - Intergenic
1183734075 22:39634117-39634139 GCAGGGTCTAGATTTAAACCAGG - Intronic
950516196 3:13467020-13467042 TCAGTGTTTACTTATAAACCTGG + Intergenic
952357227 3:32595634-32595656 GCATTGTCTAGATATAATGATGG - Intergenic
960256056 3:115512666-115512688 GCAGGGTCTCCATAGAAACCAGG - Intergenic
969783175 4:9428090-9428112 GCATTGTCTACACAGAACACAGG - Intergenic
973309565 4:48694077-48694099 GCATTTTCTACCCAGAAACCAGG - Intronic
974899707 4:67982135-67982157 GAGTTCTGTACATATAAACCTGG + Intergenic
977894264 4:102345798-102345820 GCATTGTCTACATAATTAACAGG + Intronic
979327499 4:119396883-119396905 GCAATGTCTCCGTATAAAACCGG + Intergenic
980791303 4:137622771-137622793 ACATTGTCTACATTTATAACAGG + Intergenic
983107694 4:163709903-163709925 GCACTGTATAAATATAAACTAGG + Intronic
984200497 4:176714535-176714557 GCATTGTCTCCAGTGAAACCAGG + Intronic
985199443 4:187469740-187469762 GAATTGTCTAAATATAACCGTGG - Intergenic
985371975 4:189294951-189294973 GCACTGTATATATATATACCAGG - Intergenic
993897562 5:93555743-93555765 GTATTGTCTAAATATGTACCTGG - Intergenic
998185338 5:139974952-139974974 GCATGGCCTACATACAGACCAGG - Intronic
998288819 5:140892224-140892246 GTTTTGTCTCCACATAAACCTGG + Intronic
1006933756 6:37703368-37703390 GCATTGTGTCTATATAATCCTGG + Intergenic
1008097388 6:47352806-47352828 GCATTGGATACAGACAAACCTGG - Intergenic
1014038272 6:116793275-116793297 ACATTGTCAACATTTAAACTAGG + Intronic
1015228267 6:130883453-130883475 GCATTATTTACTTTTAAACCTGG + Intronic
1019819621 7:3232549-3232571 GAATTGTCTCCATATAATCCAGG - Intergenic
1022110434 7:27226850-27226872 GCATAGTCTAAAAATACACCTGG + Intergenic
1028623856 7:92855011-92855033 GCAGTGTCCACATATAAACTCGG - Intergenic
1030516043 7:110539222-110539244 GCTTTGCCTAAATATAAACATGG + Intergenic
1036641557 8:10587494-10587516 GCATTGTTTACTTAAAATCCAGG + Intergenic
1036835876 8:12065960-12065982 GCATTGTCTACACAGAACACAGG + Intronic
1036857719 8:12312529-12312551 GCATTGTCTACACAGAACACAGG + Intergenic
1037336663 8:17798989-17799011 GCACTGTTCACCTATAAACCTGG + Intronic
1046428612 8:114090592-114090614 GCAATCTCCACATATAAACATGG - Intergenic
1051721397 9:20041067-20041089 GCAATGTCTAAAAATAAAGCAGG + Intergenic
1056020895 9:82437400-82437422 GTAGTGTGTACCTATAAACCTGG + Intergenic
1058048188 9:100379782-100379804 TCTTTGTCTATATGTAAACCTGG + Intergenic
1058334184 9:103805008-103805030 GCATTGTCTGAATATAAAACAGG + Intergenic
1058634321 9:107021655-107021677 GCAGTGTTTACATTTAAACCAGG - Intergenic
1060236301 9:121865431-121865453 GCATTTCCTAGAAATAAACCTGG + Intronic
1188688400 X:33098594-33098616 ACATTGTTTACATATAACACAGG - Intronic
1194297154 X:92141033-92141055 GCATTGTATACAGATACAACTGG - Intronic
1196514072 X:116549000-116549022 GCATCGTGTACATATATAGCTGG - Intergenic