ID: 1100527700

View in Genome Browser
Species Human (GRCh38)
Location 12:95435289-95435311
Sequence AGATGCTTGAAGAAGTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100527700_1100527703 18 Left 1100527700 12:95435289-95435311 CCAACAGACTTCTTCAAGCATCT No data
Right 1100527703 12:95435330-95435352 AAAATGCTTTCACAACCAGCAGG No data
1100527700_1100527701 -6 Left 1100527700 12:95435289-95435311 CCAACAGACTTCTTCAAGCATCT No data
Right 1100527701 12:95435306-95435328 GCATCTCGAGAACTTTTTGCAGG No data
1100527700_1100527702 -5 Left 1100527700 12:95435289-95435311 CCAACAGACTTCTTCAAGCATCT No data
Right 1100527702 12:95435307-95435329 CATCTCGAGAACTTTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100527700 Original CRISPR AGATGCTTGAAGAAGTCTGT TGG (reversed) Intergenic
No off target data available for this crispr