ID: 1100529597

View in Genome Browser
Species Human (GRCh38)
Location 12:95451444-95451466
Sequence GGGTGTCCAAAGTTTAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100529595_1100529597 -7 Left 1100529595 12:95451428-95451450 CCGCAGGTTCTTCAGGGGGTGTC No data
Right 1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG No data
1100529594_1100529597 -6 Left 1100529594 12:95451427-95451449 CCCGCAGGTTCTTCAGGGGGTGT No data
Right 1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG No data
1100529589_1100529597 8 Left 1100529589 12:95451413-95451435 CCTGAGCTGATGATCCCGCAGGT No data
Right 1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100529597 Original CRISPR GGGTGTCCAAAGTTTAACTT GGG Intergenic
No off target data available for this crispr