ID: 1100540000

View in Genome Browser
Species Human (GRCh38)
Location 12:95548734-95548756
Sequence GGGCGCGCGGCCGCGGCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100540000_1100540007 6 Left 1100540000 12:95548734-95548756 CCAATCGCCGCGGCCGCGCGCCC 0: 1
1: 0
2: 2
3: 32
4: 207
Right 1100540007 12:95548763-95548785 ACACTCACCAGCCCGAGCCGGGG 0: 1
1: 0
2: 1
3: 2
4: 89
1100540000_1100540006 5 Left 1100540000 12:95548734-95548756 CCAATCGCCGCGGCCGCGCGCCC 0: 1
1: 0
2: 2
3: 32
4: 207
Right 1100540006 12:95548762-95548784 CACACTCACCAGCCCGAGCCGGG 0: 1
1: 0
2: 1
3: 19
4: 218
1100540000_1100540013 30 Left 1100540000 12:95548734-95548756 CCAATCGCCGCGGCCGCGCGCCC 0: 1
1: 0
2: 2
3: 32
4: 207
Right 1100540013 12:95548787-95548809 GGCCATCTTAGCGCTCACCCCGG 0: 1
1: 0
2: 0
3: 8
4: 70
1100540000_1100540005 4 Left 1100540000 12:95548734-95548756 CCAATCGCCGCGGCCGCGCGCCC 0: 1
1: 0
2: 2
3: 32
4: 207
Right 1100540005 12:95548761-95548783 GCACACTCACCAGCCCGAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 122
1100540000_1100540008 9 Left 1100540000 12:95548734-95548756 CCAATCGCCGCGGCCGCGCGCCC 0: 1
1: 0
2: 2
3: 32
4: 207
Right 1100540008 12:95548766-95548788 CTCACCAGCCCGAGCCGGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100540000 Original CRISPR GGGCGCGCGGCCGCGGCGAT TGG (reversed) Intronic
900971033 1:5992539-5992561 GGGCCCGCCGCCGCACCGATTGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903059764 1:20661632-20661654 GGGCGCTCGGCCTCGTTGATTGG - Intergenic
903250995 1:22052986-22053008 GGGCGCGCGGCCGGGGCTCGGGG + Intronic
904181349 1:28668858-28668880 GGGCGCGCGGGCGCGGGGTGGGG + Intronic
904701698 1:32361914-32361936 GGGCGCGAGGCGGCGGCGCCCGG - Intronic
905775671 1:40665727-40665749 GGGGGCGGGGCCGCGTGGATGGG + Intergenic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
907165205 1:52404442-52404464 GGGGGCGGGGCCACGCCGATTGG - Exonic
907278138 1:53328113-53328135 GGGCGCGCGGCCCCGGCCCTGGG + Intergenic
910182958 1:84505870-84505892 GCGCGCTCAGCGGCGGCGATCGG - Intronic
910182993 1:84505980-84506002 GGGCGGGCGGCCGAGGCGGGAGG - Intronic
910408420 1:86914656-86914678 GGGCGCGCGGCCGCGAGCAAAGG + Exonic
912381291 1:109249583-109249605 GGGCCCGGGGCCGCGGCGACAGG + Intergenic
912411559 1:109483908-109483930 GGCCGCGCGGCGGCGGCGCCAGG + Intronic
919892006 1:201982590-201982612 GGGGGCGGGCCCGCGGCGCTCGG + Intronic
920924487 1:210328894-210328916 GGGCGCGCGGGCACGGCGGCAGG + Exonic
921217728 1:212951448-212951470 GTGCGCGCGGGCGCGGCGAGGGG - Exonic
923056098 1:230426484-230426506 GGGCGCGCGGCCGGGGCTGGCGG + Intergenic
923490486 1:234479214-234479236 GGGCGCGCGGCCGCAGAGAGGGG + Intergenic
923684030 1:236142128-236142150 GAGCGCGCGGCCCCGGGGATGGG + Intergenic
923684080 1:236142245-236142267 GAGCGCGCGGCCCCGGGGATGGG + Intergenic
1063115084 10:3067405-3067427 GGGGGCGCGGGCGCGGCTAGGGG - Intronic
1063298062 10:4826307-4826329 GGGCGGCCGGCGGCGGCCATGGG + Exonic
1063298156 10:4826626-4826648 GGGGCTGCGGCCGCGGCGTTGGG + Intronic
1065023198 10:21517329-21517351 GGGCGCGCGGCGGCGGCGCCCGG + Exonic
1065093170 10:22253717-22253739 GAGGGCGCGGCCGCTGCGCTTGG - Intergenic
1067337104 10:45374646-45374668 GGGGTCGCGGCCGCCGCGAGGGG - Intronic
1070301954 10:75210461-75210483 CGGCGCGTGGCCGGGGCGATAGG - Intronic
1072059760 10:91798521-91798543 GCGCGCGTGGGCGCGGCCATGGG + Exonic
1072331931 10:94362789-94362811 GGGCCCTAGGCCGCGGCGACCGG + Intronic
1073036872 10:100570056-100570078 GGGCGGGCGGCTGCGGCGGGAGG + Intergenic
1074377401 10:112951331-112951353 GGGCGCGGGGCCGGGGCGCGCGG - Intronic
1076306163 10:129467077-129467099 GGGCGCGCGGGGGCGGAGCTGGG - Intergenic
1077065625 11:639932-639954 GGGCGCGCGGCCGTGCAGCTTGG - Exonic
1077495796 11:2885978-2886000 GGGCGCGCGGCCGGGGCGCGCGG + Intergenic
1080283818 11:30586140-30586162 GGGCGCGCGGGGGCGGCGAGGGG + Intronic
1080418622 11:32091552-32091574 GCGCGCGCGGCCTCGAGGATGGG + Intronic
1080779755 11:35419341-35419363 GGGCTCGCGGGCGCGGCGAGTGG + Intronic
1081636876 11:44727315-44727337 GGGGGCGCGGCGGCGGCGTGCGG - Intronic
1081705526 11:45180541-45180563 GGGCGCCCGGGCGGGGCGGTGGG - Intronic
1083571563 11:63764383-63764405 GGGCGCGGCCCCGCGGCGACCGG + Exonic
1083672183 11:64305751-64305773 GGGAGCGCTGCCGCGGGGGTGGG + Intronic
1084070129 11:66728345-66728367 GGGCGCGTGGCGGCGGCGCGCGG + Intronic
1084284251 11:68121282-68121304 GGGCAGGGGGCCGCGGCGGTTGG + Intronic
1084621178 11:70271037-70271059 GGGGGCGAGGCCGCGGCGCCGGG + Intronic
1085345971 11:75768493-75768515 GGGCGCTCCCCCGCGGAGATTGG - Intronic
1088223176 11:107591043-107591065 GGGGGCGCGGGCGCGGTGCTGGG - Intergenic
1089687973 11:120169091-120169113 GGGGGCGCAGCCGGGGCGCTGGG + Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092219124 12:6700760-6700782 GGGCGCGGGGCGGCGGCGGTGGG + Intronic
1092906021 12:13101318-13101340 GGGCGCGTTGCCGCGGCGACAGG + Intronic
1096143791 12:49264572-49264594 GGGAGCGCAGCCGCGGGGACCGG + Intronic
1096284145 12:50283548-50283570 GTGCGCGCCCCCGCGGCGGTGGG - Intergenic
1096459474 12:51814346-51814368 GGGCGCGGGGCCGGGGCAAAGGG + Intergenic
1096493026 12:52023358-52023380 GGGCGTGCCGCCGCCGCGAGTGG + Intronic
1096837397 12:54359430-54359452 GGGAGCGCGGCAGCGGGGATTGG + Intergenic
1096983613 12:55743124-55743146 GGGCGGGCGGCCGGGGCGGGCGG - Intergenic
1096983621 12:55743141-55743163 GGGCGCGCGGGCGGGGCGGGCGG - Intergenic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1100679853 12:96907335-96907357 GGGTGCGCGGACGCGGCGGGCGG - Intronic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1102025447 12:109712101-109712123 GGGAGGGCGGCCGGGGCGACTGG - Intergenic
1102197161 12:111033986-111034008 GGCGGCGCGGCGGCGGCGAGGGG + Intergenic
1102973566 12:117190183-117190205 GGGCGCGCAGCCGGGGCGCGGGG + Intronic
1103749743 12:123150754-123150776 GAGCCCGCGGCCGCGCCGAGCGG - Intergenic
1103775579 12:123364538-123364560 GAGCGCGCGGCCGCGAGGAGCGG + Intronic
1104929376 12:132329787-132329809 GGGCGCGCGGGCGCGGGGAGCGG + Intergenic
1105512129 13:21060613-21060635 GGCGGCGCGGCCGCGGGGAACGG + Intronic
1106516897 13:30464499-30464521 GGCCGCGCGGCCGAGGAGAGAGG + Intronic
1106720103 13:32427838-32427860 GTGCGCTCGGCCGGGGCGTTTGG + Intronic
1108314040 13:49220789-49220811 GAGCGCGCGGACGCGGCGCCGGG - Exonic
1108373469 13:49792717-49792739 CGGCGCGCGGCCGCGGAGGCTGG + Exonic
1110705257 13:78596819-78596841 AGGCGCGCGGCCGCCCCGCTCGG - Intergenic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1117424498 14:55580463-55580485 GGGGGCGCGGCCGCGGGGCCCGG + Intronic
1118137430 14:63045300-63045322 GGGGGCGCGGCGGCGGCGACGGG + Exonic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1122221237 14:100240064-100240086 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1122231112 14:100306639-100306661 GGGCGCGCGGGCGGGGCGCGGGG + Intergenic
1122666757 14:103334959-103334981 GGGCGCGCGACCGGGGCGTCTGG - Intronic
1122904396 14:104795300-104795322 GGGCGCGCGGGCCCGGCCAAGGG - Intronic
1122905751 14:104800760-104800782 GGCAGCGCGGCCGCGGGGAGCGG - Intronic
1123040323 14:105487705-105487727 GGGCGCGCGGGCGCGGGGCAGGG - Intronic
1126736619 15:51737535-51737557 GCGAGCGCGGCGGCGGCGAGGGG + Exonic
1127480423 15:59372398-59372420 GGGCGCGCTGCCGGGGCCAGGGG - Intronic
1128547748 15:68579219-68579241 GGGGGCGCGGGCGCGGCGTGCGG - Exonic
1128982531 15:72197785-72197807 CGGCGCGCGGTCGGGGCGCTGGG - Exonic
1129162235 15:73753197-73753219 CGGCGCGGCGCCGCGGCGCTTGG - Intergenic
1129440605 15:75578685-75578707 GGGCCCGAGGCCGCCGCGTTGGG - Intronic
1130040838 15:80404344-80404366 CGGCGAGCGGCCGCGGCGGCGGG + Exonic
1130115416 15:81001375-81001397 GGGCGTGCCGCCGCGGCGCCGGG + Exonic
1130362827 15:83207234-83207256 GGGCTCGGGGCTGAGGCGATGGG + Intronic
1131263577 15:90902817-90902839 GGGAGCGCGGCAGCGGCGCGCGG + Intronic
1132585968 16:705868-705890 GCGCGCGAGGGCGCGGCGTTTGG - Intronic
1132719653 16:1309491-1309513 GGGCGCGCGGCGGCGGGGCGCGG + Intronic
1133212927 16:4273130-4273152 CGGCGCGAGGCCGGGGCGAGAGG + Intergenic
1133219956 16:4315754-4315776 GGCGGCGCGGCCGCGGGGAGCGG - Intronic
1135382755 16:22008189-22008211 GGGCGCGAGGCAGCGGCGCGGGG + Exonic
1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG + Intronic
1139664507 16:68447083-68447105 GGGGGCGCGGCCGCGGAGGGGGG - Intronic
1140517598 16:75555709-75555731 GGGCGAGCGGCCCCGGCCCTGGG - Intronic
1141418881 16:83899048-83899070 GGGCTCGCGGCCTCGGCCAATGG + Intergenic
1141694209 16:85612216-85612238 GGGGACGCGCCCGCCGCGATGGG + Intronic
1142136195 16:88453082-88453104 GGGGGCGCGGTCGCGGCTCTGGG + Intergenic
1142136211 16:88453138-88453160 GGGGGCGTGGCCGCGGCGCTGGG + Intergenic
1142434526 16:90047888-90047910 GGGGGCGGGGCCGCGGTGAGAGG + Intergenic
1142631368 17:1228750-1228772 GGGCGCGCGGCGGGGTCGAGCGG + Intronic
1143390445 17:6556494-6556516 GGGGGCGCGGGCGCGGCGCTCGG - Exonic
1143390505 17:6556660-6556682 GGGCCCGCGGGGGCGGCGTTGGG - Intergenic
1144656879 17:17042583-17042605 GGGCCCGAGGCCGCGTCCATGGG + Intronic
1147286002 17:39402532-39402554 GGGCGCGCGTCCGTGGGGGTGGG + Intergenic
1147612801 17:41811661-41811683 GGGCGCGGGGCCGCTGCAGTTGG + Exonic
1147896568 17:43755386-43755408 GGGCGCGGGGCCGCGGCTTCCGG + Exonic
1148332886 17:46822486-46822508 GGGGGCGCGCCCGCGCCGCTGGG - Intronic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1151414573 17:73952898-73952920 GGGGGCGCGGCCGCGGCGTCCGG - Intergenic
1152356466 17:79810006-79810028 GGGAGCGCGGCGGCGGCGAGTGG + Intergenic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1157464120 18:47930291-47930313 GCGTCCGCGGCCGGGGCGATGGG - Intronic
1158954697 18:62526613-62526635 GGGTGCGCGGCGGCGGCGGCGGG - Intronic
1159586734 18:70289234-70289256 GGGCGCGGGGCTGCAGCGACGGG + Intronic
1160738810 19:676605-676627 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1161080626 19:2308245-2308267 GGGCGCGCGGGGGCTGCGCTGGG + Intronic
1161203694 19:3029366-3029388 GGGGGCGCGGGCGCGGGGAGGGG - Intronic
1161396639 19:4048004-4048026 GGGCTTGCGGCCGCGGCGCGAGG + Exonic
1162778705 19:12995792-12995814 CGGCGGCCGGCCGCGGCGAGGGG - Exonic
1162914088 19:13865234-13865256 GGGCGGGCGGCGGCGGCCACGGG + Intronic
1163010035 19:14419231-14419253 GGGCGCGGGGCCGCGGTGTGGGG - Intronic
1163466405 19:17470616-17470638 TGGAGCGCGGCAGCGGCGCTCGG + Exonic
1164713367 19:30374993-30375015 GGGCGCGCGGGCGCGGCTCTGGG + Intronic
1164958425 19:32406035-32406057 GGGGGCGCGGCCGCGGCGTCGGG + Intronic
1165850858 19:38849700-38849722 CGGCGGGCGGCGGCGGCGGTGGG - Exonic
1166094449 19:40530440-40530462 GGGCGCGCGGCCGCCGCGCGGGG + Intronic
1166306904 19:41940412-41940434 GGGCGCGCGGCGGCGGGGGAGGG - Intergenic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1167311895 19:48741703-48741725 GGGGGCGTGGCCTTGGCGATGGG - Intronic
1167428413 19:49441422-49441444 GGGCCCGCGGGCGGGGGGATCGG - Exonic
926202644 2:10812756-10812778 GGGCGCGGGGGCGCGGCGTGCGG - Intronic
927809553 2:26173658-26173680 GGGGGCGCGGCCGGGGCGGGGGG - Intronic
931253541 2:60552564-60552586 GGGAGAGGGGCCGCGGCGACGGG - Intronic
931348827 2:61470815-61470837 GGGCGGGCGGCGGCGGGGACGGG + Intergenic
932231499 2:70087558-70087580 GGGCGGGCGGCGGCGGCGGAGGG - Exonic
934079141 2:88452555-88452577 TGCGGCGCGGCCGCGGCGAGGGG + Exonic
934712959 2:96527622-96527644 GGGGGCGCGGCCGCGCCGCTGGG + Intergenic
935112185 2:100104355-100104377 GGGCGGGCGGGAGCGGCGAGGGG - Intronic
936122792 2:109760796-109760818 GGGCGGGCGGGAGCGGCGAGGGG + Intergenic
936221899 2:110610668-110610690 GGGCGGGCGGGAGCGGCGAGGGG - Intergenic
939003960 2:136765291-136765313 GGGTGCGCGGCAGAGGCGGTAGG + Intergenic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948824633 2:240568370-240568392 GGGCGCGGGGCCGGGGCGCCGGG - Intronic
948934022 2:241150644-241150666 GGCCGCGCGGCGGCGGCCAGAGG - Intronic
1169211351 20:3767756-3767778 GGGAGGGCGGCCGCGGCGCGGGG - Intronic
1171123190 20:22582859-22582881 GGGCAGGCGGCCGGGGCCATGGG - Exonic
1172252596 20:33490243-33490265 CGGCGCGCGGCGGCGGCGCTCGG + Intronic
1175847420 20:62065932-62065954 GGGCGCGCGGCCGGGGGGCGGGG + Intergenic
1176194365 20:63830733-63830755 GGGAGCGCGGCGGCGGCGGGAGG + Intronic
1176550165 21:8217358-8217380 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176577007 21:8444628-8444650 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1177431690 21:20998270-20998292 GGGGGCGGGGGCGCGGCGAGGGG - Intergenic
1179674975 21:42974898-42974920 GGGCGCGCCCCCGCGCCGGTTGG - Intronic
1181160466 22:20957137-20957159 GGGCCCGCGGCCACGGCGTTTGG + Intergenic
1182355364 22:29720312-29720334 GGGCGCGCGGCTGCGGAGGGCGG - Exonic
1182445474 22:30387180-30387202 GGGCCCGGGGCCGCGGCGGACGG - Exonic
1183050685 22:35257998-35258020 GGGCTCGTGGCCGCGGCCACGGG + Intronic
1183546247 22:38455950-38455972 GGGCGCGCGGCCTCCGCAGTGGG - Intergenic
1203255011 22_KI270733v1_random:133590-133612 GGTCGGGCGGCGGCGGCGGTCGG + Intergenic
1203263067 22_KI270733v1_random:178669-178691 GGTCGGGCGGCGGCGGCGGTCGG + Intergenic
949133638 3:536114-536136 GGGCGCGCAGCCTCGGCGGGCGG + Intergenic
950902999 3:16513711-16513733 GGACGCGCGGCGGCGGCGGCGGG - Intronic
952867222 3:37862106-37862128 GGGCGCGGGGGCGCGGCGCGGGG - Intronic
953326120 3:42013738-42013760 GGGCGCGCGGGGGCGGCGGCCGG - Intergenic
954468947 3:50675226-50675248 GGCCCCGCGGGCGCGGCGACCGG - Exonic
954615635 3:51967586-51967608 GGGCGGGCGGCTGCGGCACTGGG - Intronic
956605005 3:71065074-71065096 GGGCGCGCGGGCGCGGGGCGCGG - Intronic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
961665024 3:128489279-128489301 GGGGGCGCGCCCGCGGAGCTGGG - Intronic
963091396 3:141486926-141486948 GGGGGCGGGGCCGCGGCGGGCGG + Intergenic
967168683 3:186806716-186806738 GGTCGCGCGGGCACGGCGCTGGG + Intronic
968471845 4:786159-786181 GTGCGCGCGTTCGCGGCGGTGGG - Exonic
968674602 4:1870979-1871001 GGGCGCGCGGCCGCGGAGGCTGG - Intergenic
975689421 4:76949637-76949659 GCGCGCCCGGCCGCGGTGGTGGG - Intergenic
976257045 4:83109984-83110006 CGGCGCGCCGCCCCGGCGAATGG - Intronic
984889048 4:184474922-184474944 GGGCGCAGGCCCGCGGCGGTAGG + Intergenic
985497463 5:217944-217966 GGGCGCTCGTCCGCGGAGGTGGG - Intronic
985629955 5:1009040-1009062 CGGGGCGTGGCGGCGGCGATGGG + Exonic
986402853 5:7396226-7396248 ACGCGGGCGGCCGCGGCGAGCGG + Exonic
989102301 5:37834665-37834687 GGGCGCGCGGCGGCGGCCGAGGG + Exonic
999768439 5:154757029-154757051 GGCCGCTCGGCCTCGGCGTTCGG + Intronic
1002487704 5:179550822-179550844 CTGCGCGCGGCCGCGGGGCTGGG + Exonic
1002926973 6:1610418-1610440 CGGCGCGGGGCGGCGGCGAGCGG + Exonic
1003325330 6:5086101-5086123 AGACGCTCGGCCGCGGCGCTCGG - Exonic
1004690277 6:17987483-17987505 GGCCGAGCGGGCGCGGCGAGCGG - Exonic
1004864176 6:19837432-19837454 GGGAGCGCGGCGGCCGCGATCGG + Exonic
1006389396 6:33749646-33749668 GTGCGCGCGGCCCCGGGAATGGG + Intergenic
1013225734 6:108118478-108118500 GGGCGCACGGCCTCGGCGGCTGG - Intronic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1014246867 6:119078684-119078706 GGGCGGGCTGCGGCGGGGATAGG + Exonic
1014947326 6:127514779-127514801 TGGCGCGCGGCAGGGGCGGTGGG - Intronic
1015366365 6:132401527-132401549 GGGCGCGCGGCCGGCCCGAGGGG - Exonic
1015999516 6:139028999-139029021 GGGCGCGCGGAAGCTGCGACCGG + Intronic
1016340893 6:143060762-143060784 GGGCGCGCGCCCCCGGGGACTGG - Intronic
1016990168 6:149922991-149923013 GGGCTGGCGGCCGCTGCCATTGG + Exonic
1017002335 6:150005138-150005160 GGGCAAGCGGCCGCTGCCATTGG + Intergenic
1020034947 7:4959109-4959131 GGGCGCGCGGCGGGGGCCAAGGG + Exonic
1020274306 7:6615525-6615547 GGGCGCGGGGGCGCGGCGGGCGG + Intergenic
1020899854 7:13990756-13990778 GGACGGGAGGCCGCGGGGATAGG + Intronic
1021231008 7:18086597-18086619 GGGCGCGCGGCCGACGCGCTGGG - Intergenic
1021827880 7:24573153-24573175 GGGCGCCCAGCCGCGGCGGGAGG + Intergenic
1022722984 7:32957425-32957447 GGGCGGGCGGCCGGGGAGACGGG + Exonic
1023955710 7:44885304-44885326 GCGAGCGCGGCGGCGGCGGTGGG - Exonic
1024930682 7:54664456-54664478 GGGCGCGCGGCCGCGAGGGTCGG + Intergenic
1025078665 7:55964463-55964485 GGGCGCGCGGCCGCGGGGGTCGG - Intronic
1029570169 7:101363530-101363552 GGGCGCGGGGCGGCGGGGGTTGG + Intronic
1029896657 7:103990232-103990254 GGCCGGGCGGCCGCGGCGGGAGG - Intergenic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033300079 7:140177301-140177323 GGGCGCGCGGCCGCAGCCGGAGG + Intergenic
1034977585 7:155457462-155457484 GCGCGCGGCGCCGCGGCCATTGG + Intergenic
1035260633 7:157659374-157659396 GGGGGGACGGCCGCGGGGATGGG + Intronic
1035404294 7:158587913-158587935 GGGGGCGTGGCCGGGGCGAGCGG - Intergenic
1036482642 8:9151676-9151698 GGGCGCGCAGCCACGGCGCTGGG + Intergenic
1041068145 8:54101862-54101884 GGGCGCCCGGCCGCGGCCCAAGG + Exonic
1041355240 8:56993413-56993435 GGGCCCGCGGCCGCGGCCGATGG - Exonic
1041919873 8:63169087-63169109 GGGCGCGGTGCCGCGGCGGGTGG + Intronic
1049212182 8:141391917-141391939 GGGCGCGCGGCCGCGGCGTGGGG + Intergenic
1049396344 8:142402938-142402960 GGGGGCGGGGCCGCGCCGGTGGG - Intronic
1049645500 8:143733963-143733985 GGGCGCGCGGCCGCAGGGCACGG - Intergenic
1051665615 9:19464888-19464910 GGGCGCGGGGCTGCGGGGCTCGG + Intergenic
1053198252 9:36136396-36136418 GGGCGCGCGGTCGCGGCACGAGG - Intergenic
1055945715 9:81689506-81689528 GCGCGGGCGGCGGCGGCGGTGGG - Intergenic
1056475254 9:86946665-86946687 GGGCTCGGCGCCGCGGGGATCGG - Exonic
1056992391 9:91423901-91423923 GCGGGTGCGGGCGCGGCGATTGG - Intergenic
1056992571 9:91424466-91424488 GGGCGCGCTGCGGCGGGGAAGGG + Intergenic
1057881584 9:98796487-98796509 CCGCGCGTGGCGGCGGCGATGGG - Exonic
1058885738 9:109320358-109320380 GGGCGCGGGGCCGCCGGGCTGGG - Exonic
1060713026 9:125889744-125889766 GGGCGCGCCGCGGCGGGGAGCGG + Intronic
1061472145 9:130835279-130835301 GGAGACGCGGCCGCGGCCATGGG + Intronic
1061559712 9:131394434-131394456 GGGCGCGGGGCTGCGGGGCTGGG + Intronic
1061976006 9:134068230-134068252 GGGCGCGCGGGGGCGGGGCTCGG + Intronic
1196791617 X:119469228-119469250 GGGCTGGCGGCGGCGGCGCTCGG + Intronic
1196819568 X:119692458-119692480 GGGCGGGCGGCGGCGGCGCCGGG - Intronic