ID: 1100543630

View in Genome Browser
Species Human (GRCh38)
Location 12:95580957-95580979
Sequence TCATGACCAGAGCTGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100543630_1100543639 18 Left 1100543630 12:95580957-95580979 CCGTGCTCCAGCTCTGGTCATGA No data
Right 1100543639 12:95580998-95581020 CAACTGGCTCACTCTTACAGTGG No data
1100543630_1100543633 -8 Left 1100543630 12:95580957-95580979 CCGTGCTCCAGCTCTGGTCATGA No data
Right 1100543633 12:95580972-95580994 GGTCATGAGGACCCAAACCCTGG No data
1100543630_1100543641 20 Left 1100543630 12:95580957-95580979 CCGTGCTCCAGCTCTGGTCATGA No data
Right 1100543641 12:95581000-95581022 ACTGGCTCACTCTTACAGTGGGG No data
1100543630_1100543640 19 Left 1100543630 12:95580957-95580979 CCGTGCTCCAGCTCTGGTCATGA No data
Right 1100543640 12:95580999-95581021 AACTGGCTCACTCTTACAGTGGG No data
1100543630_1100543634 2 Left 1100543630 12:95580957-95580979 CCGTGCTCCAGCTCTGGTCATGA No data
Right 1100543634 12:95580982-95581004 ACCCAAACCCTGGCAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100543630 Original CRISPR TCATGACCAGAGCTGGAGCA CGG (reversed) Intergenic
No off target data available for this crispr