ID: 1100548796

View in Genome Browser
Species Human (GRCh38)
Location 12:95627735-95627757
Sequence GGTCTAAGGGGCCCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100548796_1100548804 16 Left 1100548796 12:95627735-95627757 CCTGCCTTTGGGCCCCTTAGACC No data
Right 1100548804 12:95627774-95627796 TTACTCCTCCAGTGCTACGTGGG No data
1100548796_1100548805 17 Left 1100548796 12:95627735-95627757 CCTGCCTTTGGGCCCCTTAGACC No data
Right 1100548805 12:95627775-95627797 TACTCCTCCAGTGCTACGTGGGG No data
1100548796_1100548803 15 Left 1100548796 12:95627735-95627757 CCTGCCTTTGGGCCCCTTAGACC No data
Right 1100548803 12:95627773-95627795 TTTACTCCTCCAGTGCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100548796 Original CRISPR GGTCTAAGGGGCCCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr