ID: 1100567066

View in Genome Browser
Species Human (GRCh38)
Location 12:95806662-95806684
Sequence ATCTGCTGCTGCCTTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 0, 2: 25, 3: 303, 4: 996}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100567062_1100567066 -6 Left 1100567062 12:95806645-95806667 CCCTCACCAGACATCTAATCTGC 0: 1
1: 54
2: 470
3: 1427
4: 2339
Right 1100567066 12:95806662-95806684 ATCTGCTGCTGCCTTGATGGTGG 0: 1
1: 0
2: 25
3: 303
4: 996
1100567063_1100567066 -7 Left 1100567063 12:95806646-95806668 CCTCACCAGACATCTAATCTGCT 0: 1
1: 28
2: 325
3: 1147
4: 2150
Right 1100567066 12:95806662-95806684 ATCTGCTGCTGCCTTGATGGTGG 0: 1
1: 0
2: 25
3: 303
4: 996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100567066 Original CRISPR ATCTGCTGCTGCCTTGATGG TGG Intronic
900967162 1:5966783-5966805 CTCTGCTGCTGCCTGCCTGGAGG - Intronic
901184528 1:7364332-7364354 ATCTGCTGGTGTCTTGATCTTGG - Intronic
901189767 1:7402550-7402572 ATATGCTGCAGTCGTGATGGGGG + Intronic
901833065 1:11905964-11905986 ATTTGCTGATGCCTTGATGTTGG - Intergenic
902189543 1:14752498-14752520 ATCTGCTGGTGTCTTGATCTTGG - Intronic
902517424 1:16996893-16996915 CTCTGCTGCTGCCCTGCTGTGGG - Intronic
902605159 1:17565075-17565097 ATCTGCTGTTGCCTTGATCATGG - Intronic
902907753 1:19571283-19571305 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
902949907 1:19874166-19874188 TTCTGCTTCTGCTTAGATGGTGG - Intergenic
903441530 1:23391588-23391610 ATCTGCTGCTGCCCTGATGTTGG + Intronic
903553152 1:24172799-24172821 ACCTGCTGATGCCTTGATCTTGG - Intronic
903588399 1:24435915-24435937 ATCTGCTGGGGCCTTGATCTTGG - Intronic
903985255 1:27222815-27222837 ATCTGCTACAGCCTTGATCTTGG - Intergenic
904282648 1:29432113-29432135 ATCTGCTGACACCTTGATTGTGG - Intergenic
904296275 1:29521580-29521602 TTCTGCTGCTGCCTGGCTGGTGG - Intergenic
905496808 1:38395775-38395797 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
905826830 1:41032103-41032125 ATCTGCTGGTGCCTTGATCTTGG + Intronic
905945408 1:41897523-41897545 ATCTGCTGGTGCCTTGACCTTGG + Intronic
905953380 1:41971997-41972019 ATCTGCTGGTGCCTTGATCTTGG + Intronic
906035617 1:42748681-42748703 ATCTCCTGCAGTCCTGATGGAGG - Intronic
906131532 1:43461585-43461607 ATCTGCTGGCACCTTGATGTTGG + Intergenic
906178687 1:43799449-43799471 ATCTGCTGATGTCTTGATCTTGG - Intronic
906697861 1:47836867-47836889 ATATGCTGGTGCCTTGATCTTGG + Intronic
906785911 1:48615853-48615875 AACTGCTGGTGCCTTGATCTTGG - Intronic
907469031 1:54660181-54660203 AAATGCTGCTGCCTTGATCTTGG - Intronic
907534048 1:55132237-55132259 ATCTGCTGGTGCCTTGATCTTGG + Intronic
907628497 1:56055729-56055751 ATCTGCTGGTGTCTTGATCATGG + Intergenic
907680111 1:56555206-56555228 TTCAGCTGCTTCCATGATGGAGG - Intronic
907706137 1:56834354-56834376 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
907756302 1:57313958-57313980 ATCTGCTGGAGCCTTGATCTTGG + Intronic
907757660 1:57326633-57326655 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
907771270 1:57466847-57466869 ACCTGCTGTTGACTTGAAGGTGG - Intronic
907811234 1:57872425-57872447 ATCTGCTGAAGCCTTGATCTTGG + Intronic
908016578 1:59845099-59845121 ATCTGCTGGTACCTTGATTTTGG - Intronic
908032393 1:60015330-60015352 ATCTGCTTCTGTCTTGATCTTGG + Intronic
908113071 1:60916182-60916204 ATCTGCTGGTGCCTTGACCTTGG - Intronic
908326621 1:63029658-63029680 ACCTGCTGGTGCCTTGATTTTGG + Intergenic
908341034 1:63179345-63179367 ATCTGCTGGTACCTTGATCTTGG + Intergenic
908347104 1:63245262-63245284 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
908388519 1:63664778-63664800 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
908719394 1:67108225-67108247 ATCTGCTGATGACTTGATCTTGG - Intronic
908726801 1:67185035-67185057 ATCTGCTGATGCCTTGATCTTGG + Intronic
909166852 1:72237415-72237437 ATCTGTTGGTGCCTTTATGTTGG - Intronic
909490456 1:76220611-76220633 ATCTAATGCTGACTTGGTGGAGG + Intronic
909551991 1:76908252-76908274 ATCTGCCACTGCCTTGATCTTGG - Intronic
909907116 1:81210815-81210837 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
910070895 1:83212566-83212588 ATCTGCTACTGCCTTGGTTTAGG + Intergenic
910385314 1:86676110-86676132 GTCTTCTGATGGCTTGATGGGGG - Intergenic
910623299 1:89279496-89279518 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
910893167 1:92039325-92039347 ATAGGCTGCTGCCTAAATGGAGG + Intronic
911108297 1:94155605-94155627 ATCTGCTGGTGCCTTGATCTTGG + Intronic
911262238 1:95700713-95700735 ATCTGTTGCTGCCTTAATCTTGG - Intergenic
911631203 1:100185532-100185554 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
911691276 1:100837527-100837549 ATCTGCAGGTGCCTTGATATTGG - Intergenic
911743436 1:101412568-101412590 TTCTAGTGCTGCCTTGATAGTGG - Intergenic
911885429 1:103291683-103291705 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912351031 1:109013186-109013208 ATCTGCTGGTACCTTGATCTTGG + Intronic
912364323 1:109120519-109120541 ATCTGCTGGTGCCTTGATCTTGG + Intronic
912547519 1:110461580-110461602 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912748928 1:112269341-112269363 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
912832672 1:112967576-112967598 ATCTGCTGCTGCTTTGGGTGAGG - Intergenic
912941430 1:114048628-114048650 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
913082321 1:115399990-115400012 ATATGCTGCTGCCTTGATCTTGG + Intergenic
914325502 1:146611531-146611553 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
914454609 1:147824229-147824251 CTCTGCTGGTGCCTTGATGTTGG - Intergenic
915766575 1:158368512-158368534 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
916334048 1:163650169-163650191 ATCTGCTGGTGCCTTGATCTGGG - Intergenic
916953752 1:169809986-169810008 ATCTACTGGTGCCTTGATATTGG - Intronic
917835241 1:178936789-178936811 ATCTGCTGGTATCTTGATGTTGG - Intergenic
918041933 1:180918900-180918922 ATCTGCTTGTGCCTTGATCCTGG - Intronic
918327359 1:183422674-183422696 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
918329247 1:183441609-183441631 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
918484063 1:185010794-185010816 TTGTGCTGATGACTTGATGGAGG + Intergenic
918491597 1:185087250-185087272 ATCTGCTGGTGCCATGATCTTGG - Intronic
918533783 1:185551803-185551825 ATCTGCTGATGCCTTGTTCTTGG + Intergenic
918998080 1:191789011-191789033 AACTGCTGCTACCTGGAGGGTGG + Intergenic
919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG + Intergenic
919440745 1:197630296-197630318 ATCTGCTGGTACCTTGATGTTGG - Intronic
919461843 1:197885924-197885946 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
919588428 1:199468858-199468880 ATCTGCCGCCTCCTTGATGTTGG - Intergenic
919780163 1:201216331-201216353 ATCTGCTGATGAGTGGATGGGGG + Intronic
920308837 1:205036167-205036189 GTCTGCTGATGCCTTGATCCTGG + Intergenic
920309468 1:205040270-205040292 ATGTGGTGCTCCCTTGGTGGTGG - Intergenic
920364495 1:205440888-205440910 ACCTGCTGGGGGCTTGATGGAGG + Intronic
921032854 1:211349332-211349354 ATCTGCTGGTGTCTTGATTGTGG - Intronic
921336487 1:214092171-214092193 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
921353039 1:214256972-214256994 TTCTCCTGCTGCTTTGAAGGTGG - Intergenic
921727609 1:218540627-218540649 ATCTGCTGGTGCCTTAATGTTGG + Intergenic
921801453 1:219407812-219407834 ATCTGCTGGGGTCTTAATGGTGG - Intergenic
921990333 1:221359316-221359338 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922070744 1:222190716-222190738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922254269 1:223878967-223878989 ATCTGCTGGTGTCTTGATTTTGG - Intergenic
922514170 1:226194614-226194636 ATCTGCTGGAGCCTTGATCTGGG - Intergenic
922596088 1:226814345-226814367 TCCTGCCACTGCCTTGATGGCGG + Intergenic
922860335 1:228810912-228810934 ATCTGCTGATGCCTTGATCTTGG - Intergenic
922901448 1:229139987-229140009 CTCTGCTGATGCCTTGATTTTGG - Intergenic
922929396 1:229377041-229377063 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922975489 1:229780213-229780235 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
923001312 1:230008541-230008563 ATCTGCCGATGCCTTGATGTGGG - Intergenic
923113545 1:230913317-230913339 CTCAGCTGCTGCCTTGATTGAGG + Intronic
923476893 1:234342391-234342413 ATCTGCTGTTGCCTTGATCTTGG + Intergenic
924009504 1:239649317-239649339 ATATGCTTGTGCCTTGATCGTGG + Intronic
924122913 1:240820731-240820753 ATCTGCTGGTGCCTTGATCTTGG + Intronic
924200068 1:241649340-241649362 ATCTGCTGGAGCCTTGATTTTGG + Intronic
924415602 1:243853081-243853103 ATCTGCTGGTGCCATGATCTTGG - Intergenic
1063266316 10:4454846-4454868 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1063540306 10:6926909-6926931 ATCTGCTTCTGCCTTATTTGGGG + Intergenic
1063561693 10:7134136-7134158 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1063762262 10:9093171-9093193 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1063802937 10:9602266-9602288 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1064340952 10:14484838-14484860 GTCGGCTGCTTCCTGGATGGGGG - Intergenic
1064697830 10:17986421-17986443 ATCTGCTGATGCCTTGATCTTGG - Intronic
1064710184 10:18115098-18115120 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1064874739 10:19980472-19980494 ATCTGCTGCCACCTTGATAATGG - Intronic
1064937719 10:20697186-20697208 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1065338447 10:24679252-24679274 ATCTGCCGGTGCCTTGATCTTGG - Intronic
1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG + Intergenic
1065792301 10:29272005-29272027 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1065966823 10:30777479-30777501 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1066019517 10:31283956-31283978 ATCTGCTGGTCCCTTGATCATGG + Intergenic
1066020093 10:31289795-31289817 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1066252007 10:33643133-33643155 ATGTGCTGCTGCCTGAATTGGGG + Intergenic
1066298537 10:34076715-34076737 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1066475149 10:35739487-35739509 ATCTGCTGGTGCCTTGGTCTTGG - Intergenic
1066479455 10:35781451-35781473 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1066533689 10:36367058-36367080 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1066539397 10:36428948-36428970 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1066578221 10:36849997-36850019 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1066645999 10:37609718-37609740 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1067150083 10:43724815-43724837 ATCTGCTGCTTCCTTGATCTTGG + Intergenic
1067385710 10:45816344-45816366 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1067782019 10:49214687-49214709 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1068068786 10:52169314-52169336 ATCTGCTGATGCCTTGATCTTGG - Intronic
1068391446 10:56402458-56402480 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1068412064 10:56669102-56669124 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1068659894 10:59613113-59613135 ATCTGCTGATGGCTTGATGTTGG - Intergenic
1068723683 10:60276329-60276351 ATGTGCTGCTTCCTAAATGGAGG + Intronic
1069042107 10:63706360-63706382 ATCTGCTGCTCCCTTTAGTGAGG - Intergenic
1069073427 10:64013532-64013554 CTCTGCTGGTGACTTGATCGTGG + Intergenic
1069627653 10:69878147-69878169 CTCTGCTGCGGCTTTCATGGGGG - Intronic
1069732629 10:70628350-70628372 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1069747538 10:70725482-70725504 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1069764260 10:70841417-70841439 ATCTGCTGTTGCCTTGCTCTTGG - Intronic
1069778013 10:70938024-70938046 TTCTGCAGCTTCCTTGAGGGAGG - Intergenic
1069795260 10:71047745-71047767 ATCTTCTGGTGCCTTGATCATGG + Intergenic
1069845660 10:71369177-71369199 ATCTGCTGCAACCTTGATCTTGG + Intergenic
1070020377 10:72579272-72579294 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1070104781 10:73421175-73421197 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1070282962 10:75063153-75063175 AGCTGCTGCCCCCTTAATGGAGG - Intergenic
1070706687 10:78644731-78644753 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1071338046 10:84617777-84617799 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1071921989 10:90360664-90360686 AACTGCTGGTGCCTTGATCTTGG + Intergenic
1072000416 10:91190094-91190116 ATCTGCCCATGCCTTGATGTTGG - Intronic
1072120760 10:92403737-92403759 ATCTGCTGCCACCTTGATCTTGG + Intergenic
1072123347 10:92423484-92423506 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1072272979 10:93795314-93795336 ATCTCCTGGTGCCTTGATCATGG - Intronic
1072288565 10:93940890-93940912 ATCTGCTAGTGCCTTGATCTTGG + Intronic
1072800099 10:98386875-98386897 ATGTGCTGCTGCCTTGAGAAGGG + Intronic
1073026618 10:100491975-100491997 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1073080894 10:100860004-100860026 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1073470476 10:103719050-103719072 ATCTGCTGGTGCCTTGGTTTAGG + Intronic
1073807798 10:107118259-107118281 ATCCGTTGCTGCCTTGATCTTGG + Intronic
1073941406 10:108703062-108703084 ATCTGATGGTGCCTTGATCTTGG - Intergenic
1073982252 10:109168031-109168053 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1074146236 10:110719937-110719959 ATTTGCTGGTGCCTTGATCTTGG - Intronic
1074148395 10:110737309-110737331 ATCTGCTGGTGCCTTGATTGTGG + Intronic
1074258528 10:111828481-111828503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074322032 10:112412196-112412218 ACTTGCTCCTGCCTTCATGGGGG + Intronic
1074754515 10:116614572-116614594 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074836480 10:117300856-117300878 ATCTGCTGGTGCCCTGATCTTGG + Intronic
1075019523 10:118941286-118941308 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1075156835 10:119984813-119984835 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1075395941 10:122127100-122127122 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1075535342 10:123266827-123266849 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1075570430 10:123538002-123538024 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1075613551 10:123874193-123874215 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1075625260 10:123959575-123959597 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1076350879 10:129814436-129814458 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1076382522 10:130035179-130035201 ATCTGCTGATACCTTGATCTTGG - Intergenic
1076398082 10:130156170-130156192 ATCTGCTGGTGCTTTGATCTTGG - Intronic
1076539320 10:131204214-131204236 ATCTGCTGATGCCTTGGTCCTGG + Intronic
1076862037 10:133142224-133142246 TTCTGCTGCTGCCCTGGGGGCGG + Intergenic
1077115907 11:884579-884601 AGCTGCTTCTGCCTTCAGGGAGG - Intronic
1077253491 11:1571025-1571047 CTCTGGTGCTGCAGTGATGGGGG - Intronic
1077861329 11:6183480-6183502 ATCTGCTGCTGGCTTCATCTTGG - Intergenic
1077892445 11:6429274-6429296 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1077956607 11:7027329-7027351 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG + Intronic
1078194471 11:9123995-9124017 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1078424130 11:11235521-11235543 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1078734742 11:14009714-14009736 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078843638 11:15102149-15102171 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1078918957 11:15808985-15809007 ATCTGCTGAAGCCTTGATCTTGG + Intergenic
1078931646 11:15916742-15916764 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1078964767 11:16325987-16326009 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1079091602 11:17484418-17484440 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1079403735 11:20127327-20127349 GTCTGCTGGTGACTTGATTGTGG + Intergenic
1079611329 11:22436127-22436149 ATCTGCTGGTGCTTTGATCCTGG - Intergenic
1079916921 11:26380462-26380484 ATGTGCTGATGCCTTGATCTTGG - Intronic
1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1079969150 11:27015379-27015401 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1079994157 11:27277733-27277755 ATCTGCTGCCACCTTGATCACGG - Intergenic
1080351749 11:31393018-31393040 ATCTGCTAGTGCCTTGATTCAGG + Intronic
1080392129 11:31858067-31858089 ATCTACTGGTGCCTTGATCTTGG + Intronic
1080397276 11:31901868-31901890 ATCTGCTGATGCCTTGATATTGG - Intronic
1080593037 11:33740122-33740144 ATTTGCTGATGCCTTGATCTTGG + Intergenic
1080695045 11:34596134-34596156 ATCTGCTGGTGCCTTGCTCTTGG + Intergenic
1080840296 11:35977719-35977741 ATCTGCTGGTGACTTGATCTTGG - Intronic
1080942366 11:36933897-36933919 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1081063808 11:38513972-38513994 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1081064025 11:38517605-38517627 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1081825132 11:46042853-46042875 ATCTGCTGATGCCTTGAACGTGG + Intronic
1081848268 11:46256830-46256852 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1082008879 11:47437361-47437383 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1083055897 11:59819345-59819367 ATCTGCTGTTCCCTTGATGCAGG - Intergenic
1083497348 11:63068610-63068632 ATCTGCTTCTGCCTTGATCTTGG + Intergenic
1083538436 11:63492636-63492658 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1083952172 11:65962776-65962798 CACTGCTGCTGCCTTGGTGCAGG - Intronic
1084100279 11:66943395-66943417 ATCTGCTGCTGCCTTGATCTTGG + Intronic
1084367423 11:68711780-68711802 CTCTCCTGCTGCCTTGTGGGTGG + Intronic
1084448557 11:69218603-69218625 ATCTGCTGACGCCTTGATCTTGG - Intergenic
1084653064 11:70500266-70500288 AGCTGGGGCTGCCTGGATGGGGG - Intronic
1084993913 11:72956561-72956583 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1085654111 11:78296845-78296867 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1085736360 11:79042558-79042580 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1085846467 11:80071468-80071490 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1085877148 11:80422375-80422397 ATCTGCTGGTGCCTTGATTATGG - Intergenic
1086060853 11:82698542-82698564 ACCTGCTGGTGCCTTGATCCTGG + Intergenic
1086532828 11:87806299-87806321 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1086744726 11:90410776-90410798 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1086860487 11:91919596-91919618 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1086884739 11:92192350-92192372 ATGTGGAGCTGACTTGATGGAGG - Intergenic
1086942616 11:92814093-92814115 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1087004024 11:93451038-93451060 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087022118 11:93614262-93614284 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087086999 11:94229998-94230020 ATCTGCCAGTGCCTTGATGTTGG - Intergenic
1087215502 11:95488716-95488738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1087761340 11:102107166-102107188 ACCTGTTGCTGCCTTGATCTTGG - Intergenic
1087814987 11:102648543-102648565 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1087840465 11:102915470-102915492 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1087856930 11:103103582-103103604 ATCTGCTGTTGCTTTGATCTTGG - Intergenic
1088105636 11:106203919-106203941 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1088252902 11:107877127-107877149 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1088361021 11:108990112-108990134 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1088962675 11:114685304-114685326 ATCTGTTGATGCCTTGATCTTGG - Intronic
1089575194 11:119437188-119437210 ATCTGCTGATGCCTTGACCTTGG - Intergenic
1090155798 11:124437506-124437528 ATCTGCTGCTGCCTTAATCTTGG - Intergenic
1090374466 11:126279207-126279229 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1090762687 11:129851088-129851110 AGATGCTGCTGCCTTGATCTTGG - Intronic
1091521575 12:1249779-1249801 ATCTGCTGGTTCCTTGATCTTGG - Intronic
1092123352 12:6059521-6059543 ATCTGCTGATGCCTTCATCTTGG - Intronic
1092395100 12:8118979-8119001 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1093214140 12:16343337-16343359 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1093378057 12:18455612-18455634 ATCTGCTGGTACCTTGATCTTGG - Intronic
1094802940 12:34058706-34058728 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1094803116 12:34061262-34061284 ATCTACTGCTGCCTTGGTCTTGG - Intergenic
1095116528 12:38359770-38359792 ATCTACTGCTGCCTTGGTCTTGG - Intergenic
1095222988 12:39640328-39640350 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1095270647 12:40214718-40214740 ATCTGATGGTGCCTTAATAGTGG + Intronic
1095395140 12:41754246-41754268 ATCTTCTGGTGCCTTGATCTTGG + Intergenic
1095408474 12:41894622-41894644 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1095453853 12:42361272-42361294 ATCTGCTGGTACCTTGATCTTGG + Intronic
1096055424 12:48646668-48646690 ATCTGCTAATGCCTTGATCTTGG + Intergenic
1096111196 12:49030366-49030388 ATCTTCTGCTGCACCGATGGGGG + Exonic
1097141731 12:56908282-56908304 ACCTGCTGCTGCCATGAGGAGGG + Intergenic
1097292443 12:57929456-57929478 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1097306331 12:58073117-58073139 ATCTGCTAGTGCCTTGATTTTGG + Intergenic
1097523468 12:60699911-60699933 ATCTGCTGGTGCATTGATCTTGG - Intergenic
1097575336 12:61386282-61386304 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1097776096 12:63648186-63648208 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1097786756 12:63768899-63768921 ATCTGCTGTTACCTTGATCTTGG - Intergenic
1097811944 12:64028586-64028608 ATCTGCTGCTGCCTTGATCTTGG - Intronic
1098031747 12:66261796-66261818 ATCTGCTGGTGCCTTGGTTGTGG + Intergenic
1098156007 12:67599461-67599483 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1098191737 12:67956312-67956334 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1098327070 12:69313908-69313930 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1098507546 12:71271647-71271669 ATCTGCTGGTGCCATGATCTTGG - Intronic
1098527024 12:71498402-71498424 ATCTGCTGGTACCTTGATCTTGG - Intronic
1099042986 12:77679323-77679345 ATGTGGTGCTGACTGGATGGAGG + Intergenic
1099274937 12:80563216-80563238 ATCTGCTGGTGCCCTGATGTTGG - Intronic
1099339478 12:81410137-81410159 ATCTGCTGATGCCTTGATGTTGG + Intronic
1099794374 12:87379418-87379440 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG + Intergenic
1100222557 12:92521637-92521659 ATCTGCTGGCACCTTGATTGTGG + Intergenic
1100343951 12:93708881-93708903 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1100455996 12:94752258-94752280 ATGTGCTGATGCCTCGAGGGAGG - Intergenic
1100567066 12:95806662-95806684 ATCTGCTGCTGCCTTGATGGTGG + Intronic
1100600093 12:96105442-96105464 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1100747283 12:97660390-97660412 ATCTATTGCTGCCTTGATCTTGG - Intergenic
1100779697 12:98010761-98010783 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
1100984679 12:100192650-100192672 ATCTGCTGCTGTCTTCATCTTGG + Intergenic
1101042740 12:100773098-100773120 ATCTGCTGGTACCTTGATCATGG - Intronic
1101646820 12:106638697-106638719 ATCTGCTATTGCCTTGATCTTGG - Intronic
1101691719 12:107088585-107088607 ATCTGCTGGTGCCTTGATTCTGG + Intronic
1101733104 12:107442907-107442929 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1101734584 12:107453528-107453550 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1101762814 12:107672986-107673008 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1101819504 12:108173065-108173087 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1101904544 12:108814895-108814917 CTCCGCTGCTGCCTGGCTGGAGG - Intronic
1102414336 12:112747385-112747407 ATCTGCTGGTGCTTTGATCTTGG + Intronic
1103171572 12:118824995-118825017 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1103448347 12:121009665-121009687 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1103679440 12:122681588-122681610 ATCTGCTGCCGCCTTGATCTTGG + Intergenic
1104002932 12:124871951-124871973 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1104069099 12:125329234-125329256 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1104310535 12:127650859-127650881 ATCTGCTGGTTCCTTGATCTTGG - Intergenic
1104563437 12:129859192-129859214 ATCTGCAGCTGCCTTGATCCTGG + Intronic
1104695616 12:130861397-130861419 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1106182592 13:27381572-27381594 ACCTGCTGCTGGTTTTATGGTGG - Intergenic
1106354782 13:28970742-28970764 CTGTGCTGCTGCCACGATGGAGG - Intronic
1106886645 13:34192449-34192471 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1107057159 13:36118821-36118843 ATCTGCTGGTGTCTTGATCTTGG - Intronic
1107066410 13:36218036-36218058 ATCTGCTGCTGCCTTGATCTTGG + Intronic
1107414030 13:40184544-40184566 ATCTGCTGGTGCTCTGATGTTGG - Intergenic
1107560343 13:41552180-41552202 AGCTGCTGCTGGCCTGGTGGGGG + Intergenic
1107600190 13:42005015-42005037 ATCTGCTGACACCTTGATGTTGG + Intergenic
1107869906 13:44736785-44736807 ATCTGCTGATGTCTTGATCTTGG - Intergenic
1107990913 13:45818508-45818530 TTCTGCTGATGCCTTGATTTTGG - Intronic
1108033777 13:46265448-46265470 ATCTGCTGGGGCCTTGATATTGG - Intronic
1108040747 13:46337539-46337561 ATCTGCTGTTGTCTTGATCTTGG + Intergenic
1108679519 13:52767460-52767482 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1108737507 13:53299797-53299819 ATCTGCTGCTACTTTAAGGGTGG + Intergenic
1109085523 13:57966407-57966429 ATCTGCTGATACCTTGATTTTGG + Intergenic
1109271780 13:60263750-60263772 ATCTGCTGGTGCCTTGTTGTAGG + Intergenic
1109306622 13:60648539-60648561 ATCTCCTGCGGCCTTGATCTTGG + Intergenic
1109551192 13:63902589-63902611 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1109979465 13:69888063-69888085 ATCTGATGGTGCCTTGATGTTGG - Intronic
1110315950 13:74107024-74107046 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1110666598 13:78124774-78124796 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1110707532 13:78612198-78612220 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1110744694 13:79038864-79038886 ATCTGCTGGCACCTTGATGTTGG - Intergenic
1111084325 13:83353585-83353607 ATCTACTGGTGCCTTGATCATGG + Intergenic
1111439443 13:88260479-88260501 ATCTGCTGATGCCTTCATCTTGG + Intergenic
1111497444 13:89070692-89070714 ATCTGCTGGGACCTTGATTGTGG + Intergenic
1111816644 13:93162429-93162451 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1111852523 13:93594729-93594751 ATCTGCTAGTGCCTTGATATTGG - Intronic
1111969764 13:94899868-94899890 ATCTGCGGGTGCCTTGATCTTGG - Intergenic
1112560205 13:100506143-100506165 CTCTGCTGCTGCCAGGACGGGGG + Intronic
1112608052 13:100927376-100927398 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1112646766 13:101341999-101342021 ATCTGCTGCTGTCTTGCTCTTGG + Intronic
1112764268 13:102724066-102724088 ATCTGCTGGTGCCTAGATCTTGG + Intergenic
1113035861 13:106047842-106047864 ATCTGCTGTTGTCTTGATCTTGG + Intergenic
1113175519 13:107559040-107559062 ATCAGCTCCTGCCATCATGGAGG - Intronic
1113321286 13:109234934-109234956 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1113428493 13:110229721-110229743 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1113484385 13:110643584-110643606 GGCTGCTGCTGCCTGGACGGGGG - Intronic
1114083268 14:19219568-19219590 CTCTGGTGCTTCGTTGATGGGGG - Intergenic
1114580635 14:23756285-23756307 ACCTGCTGCTGCCTTGATCTTGG + Intergenic
1114731283 14:24995111-24995133 ATCTGCTGATGCCTTGATCTTGG - Intronic
1114888745 14:26888955-26888977 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1115658417 14:35466269-35466291 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1115720037 14:36150419-36150441 ATCTGTTGGTGACTTGATTGTGG + Intergenic
1115977019 14:39008079-39008101 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1116091531 14:40313240-40313262 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1116385008 14:44318911-44318933 ATCTGCTGTCGCCTTGATCTTGG + Intergenic
1116503198 14:45646085-45646107 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1116773591 14:49154274-49154296 ATCTGCTACTGCGTTAATCGAGG + Intergenic
1116837702 14:49787341-49787363 ATCTGCTGGTGCCTTGATGCTGG - Intronic
1116863889 14:50015965-50015987 ATCTGCTAGTGCCTTGATCGTGG + Intergenic
1116902115 14:50371607-50371629 AGCAGCTGCTGCCATGATGCTGG + Intronic
1117677268 14:58167414-58167436 GCCTGCTGCTGGCTTGGTGGGGG - Intronic
1117733857 14:58750653-58750675 AGCGGCTGCTGCCATGATGCTGG + Intergenic
1117993716 14:61459224-61459246 ATCCCCTACTTCCTTGATGGTGG - Intronic
1118068295 14:62216486-62216508 ATACGCTGCTGCCTTGATCTTGG + Intergenic
1118240316 14:64050117-64050139 ATCTTCTGCTGCCTTGATCTTGG - Intronic
1118352329 14:64981987-64982009 ATCTGCAGGTGCCTTGATGTTGG - Intronic
1118383591 14:65237573-65237595 ATCTGCTGATGCTTTGAACGTGG + Intergenic
1118437841 14:65787663-65787685 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1118688624 14:68316391-68316413 ATCTACTGGTGCTTTGATGGTGG + Intronic
1118815551 14:69311160-69311182 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1118996398 14:70840486-70840508 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1119298026 14:73549077-73549099 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1119673965 14:76539888-76539910 ACCTGCTGGTGCCGTGATGTTGG - Intergenic
1119863351 14:77953182-77953204 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1119911459 14:78353363-78353385 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1120055913 14:79923962-79923984 ATCTGCTGATGCCTTGAACTTGG - Intergenic
1120073975 14:80134928-80134950 GTCTCCTGGTGCCTTGATGTTGG - Intergenic
1120241466 14:81954448-81954470 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1120357057 14:83448084-83448106 ATCTACTGCTGCCTTGATCTTGG - Intergenic
1120398241 14:83995481-83995503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120453218 14:84697922-84697944 ATCTGCTGTAGCCTTGATGTTGG + Intergenic
1120465054 14:84845647-84845669 ATCTGCGGATGCCTTGATTATGG + Intergenic
1120720315 14:87883179-87883201 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1120842182 14:89095634-89095656 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120916214 14:89712884-89712906 ATCTGCTGCTGCCTTGATCTTGG - Intergenic
1120916453 14:89714879-89714901 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1120967584 14:90181334-90181356 ACCTGCTGATGCCTTGATCTTGG - Intronic
1121256051 14:92531186-92531208 ATCTGCTGCTGCCTTCATCTTGG - Intronic
1121277892 14:92680083-92680105 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1121297922 14:92844932-92844954 ATCTGCTGATGCCTTCATCTTGG - Intergenic
1121659401 14:95623868-95623890 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
1121677255 14:95763904-95763926 ATCTGCTGGTGCCTTGACCTTGG - Intergenic
1121713063 14:96053477-96053499 ATCTTCTGCTGCCTTCCTGATGG - Intronic
1121881449 14:97503944-97503966 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1121920527 14:97876709-97876731 CATAGCTGCTGCCTTGATGGAGG + Intergenic
1121933970 14:97999532-97999554 ATCTGCTCATGCCTTGATTTTGG + Intergenic
1122039989 14:98980352-98980374 ATCTGCTGGTACCTTGATATTGG + Intergenic
1122045881 14:99023054-99023076 ATCTGCTGCCACCTTGATCTTGG + Intergenic
1123506084 15:20941999-20942021 ATCAGGGGCTGCCTTGCTGGTGG + Intergenic
1123563314 15:21515706-21515728 ATCAGGGGCTGCCTTGCTGGTGG + Intergenic
1123599565 15:21952989-21953011 ATCAGGGGCTGCCTTGCTGGTGG + Intergenic
1124395965 15:29301906-29301928 ATCTGCTTGTGCCTTCATGTTGG + Intronic
1124684805 15:31773360-31773382 ATCTGCAGGTGCCTTGATGTTGG - Intronic
1125217390 15:37290911-37290933 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1125987383 15:44067512-44067534 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1126320562 15:47418416-47418438 ATTTGCTGATGCCTTGATCTTGG - Intronic
1126386481 15:48098899-48098921 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1126461775 15:48922453-48922475 ATCTACTGGTGCCTTGATCTTGG - Intronic
1126910965 15:53416416-53416438 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1127346216 15:58102409-58102431 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1127601014 15:60537111-60537133 TTCTGCAGCTGCCTGAATGGCGG + Intronic
1127733239 15:61819140-61819162 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1127850781 15:62910166-62910188 CTCTGCTGCTCCCTTGCTGTGGG - Intergenic
1128320193 15:66688044-66688066 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1128486260 15:68092796-68092818 ATCTGCAGATGCCTTGATCTTGG + Intronic
1129370394 15:75089974-75089996 ATCTGCTGGTGCCCTGATTTTGG - Intronic
1129380269 15:75160628-75160650 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1129519196 15:76175469-76175491 ACCTGCTGCTGCCTGAATGCTGG + Intronic
1129655221 15:77519649-77519671 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1129751703 15:78069871-78069893 ATCTGCTGGTGCCTTCATCTTGG + Intronic
1129827576 15:78644513-78644535 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1130238002 15:82156269-82156291 AACTGCTGCTGCATTTATGTGGG - Intronic
1130820915 15:87494884-87494906 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1130921135 15:88345615-88345637 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1131085107 15:89569457-89569479 GTCTGCTGGTGCCTTGATCCTGG - Intergenic
1131322195 15:91405240-91405262 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1131345160 15:91640081-91640103 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1131409498 15:92195009-92195031 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1131533212 15:93212336-93212358 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1131720756 15:95166074-95166096 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1131740867 15:95389826-95389848 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1131762179 15:95636292-95636314 ATCTGCTGGTGACTTGATCTTGG - Intergenic
1132013625 15:98297472-98297494 TTCTGGTGCTCCCATGATGGTGG - Intergenic
1132410835 15:101577215-101577237 ATCTGATGCTGCTCTGGTGGAGG - Intergenic
1202971668 15_KI270727v1_random:242840-242862 ATCAGGGGCTGCCTTGCTGGTGG + Intergenic
1132467558 16:84502-84524 AGCAGGTGCTGCCTTGCTGGAGG + Intronic
1133175465 16:4010959-4010981 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1133475561 16:6118391-6118413 ATCTGCTGGTGCTTTGATTTTGG - Intronic
1133707611 16:8370117-8370139 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1134437020 16:14268994-14269016 ATCTGCTGGAACCTTGATGTTGG - Intergenic
1134503962 16:14790583-14790605 ATCTGCAGGTGCCTTGATCTGGG + Intronic
1134576610 16:15338325-15338347 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1134725829 16:16418174-16418196 ATCTGCAGGTGCCTTGATCTGGG + Intergenic
1134941604 16:18293685-18293707 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1135018485 16:18944041-18944063 ATCTACTGGTGCCTTGATTTTGG + Intergenic
1135059879 16:19262384-19262406 ATCTGCTGGTACCTTGATCTGGG + Intronic
1135507977 16:23055513-23055535 ATCTGCTGGCGGCTTGATCGTGG + Intergenic
1137292776 16:47063189-47063211 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137389991 16:48073448-48073470 ATCTGCTGGTGCCTTGCTGTTGG - Intergenic
1137691264 16:50429675-50429697 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1137699374 16:50485438-50485460 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137931797 16:52595489-52595511 ATCTTCTGGTGCCCTGATGTTGG - Intergenic
1138192670 16:55028468-55028490 ATCTGGTGGTGCCTTGATCTTGG + Intergenic
1138244336 16:55455465-55455487 ATCTGCTGGTGCCATGATCTTGG + Intronic
1138304274 16:55960042-55960064 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1138341409 16:56291750-56291772 ATCTGCTGGTATCTTGATGTTGG - Intronic
1138647467 16:58435580-58435602 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1138791507 16:59909118-59909140 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1139078180 16:63480835-63480857 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1139243518 16:65418675-65418697 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
1139824505 16:69746361-69746383 CTCTGCCGCAGCCTTGCTGGTGG - Intronic
1139848475 16:69936560-69936582 ATTTGCATTTGCCTTGATGGTGG + Intronic
1139950864 16:70668816-70668838 ATCTGCTGGTGTCTTGATCCTGG + Intronic
1140008060 16:71099416-71099438 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1140231103 16:73117905-73117927 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1140293780 16:73688581-73688603 ATCTGCTGGTGCCTGGATCTTGG + Intergenic
1140596611 16:76423112-76423134 ATCTGCTGGTGCCTTCATTTTGG + Intronic
1140777658 16:78264828-78264850 ATCTGCTGGTGCCATGATCTTGG + Intronic
1140835995 16:78794255-78794277 ATTTGCTGCTTCCTTGATCTTGG + Intronic
1141030047 16:80579701-80579723 ATCTACTGGTGCCTTGATCTTGG + Intergenic
1141042436 16:80683845-80683867 ATCTGCTGGTGCCTTCATCATGG + Intronic
1141457553 16:84153879-84153901 GCCTACTGCTGCCTTCATGGTGG - Intronic
1142064855 16:88056011-88056033 GCCTCCTGCTGCCTTGCTGGGGG + Intronic
1142247193 16:88975583-88975605 GGCTGGTGCTGCCTTGAAGGTGG + Intronic
1142549607 17:730502-730524 AGCTGCTGCTCCCTTTAAGGAGG + Intergenic
1143213266 17:5205069-5205091 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1143250928 17:5522464-5522486 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1143339580 17:6200289-6200311 ATCTACTGTTGCCTTGATCTTGG - Intergenic
1143570903 17:7757764-7757786 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
1144169507 17:12646309-12646331 ATCTGCTGCCACCTTGATCTTGG - Intergenic
1144938144 17:18916742-18916764 ATCTGCTGGTGCCTTGATCCAGG - Intronic
1146162196 17:30566053-30566075 TTCAGCTTCTGCCTTGATGACGG + Intergenic
1146180034 17:30692084-30692106 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1146309595 17:31757002-31757024 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1146425143 17:32731615-32731637 AGCAGCTGCTGCCATGATGCTGG + Intronic
1146484840 17:33234644-33234666 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1146511657 17:33454733-33454755 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1146567687 17:33927543-33927565 ATCTGCTGCTGCCTTGATCCTGG + Intronic
1146672587 17:34751908-34751930 ATCTGCTGGCGCCTTGATCTTGG - Intergenic
1146839984 17:36144801-36144823 ATCTGCTGCCACCTTGATCTTGG - Intergenic
1146946925 17:36879913-36879935 TTGTGCTGCTGCCTTCATGCCGG + Intergenic
1149182179 17:53952423-53952445 ATTTGCTGTTACTTTGATGGGGG - Intergenic
1149184892 17:53986009-53986031 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1149357377 17:55855448-55855470 ATCTGCTGGTGCCCTGATATTGG - Intergenic
1150188660 17:63214543-63214565 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1150378625 17:64703025-64703047 ATCAGCTGATGCCTTGATTTTGG + Intergenic
1150505482 17:65693959-65693981 ATCTGCTGGTGCTTTGATCTTGG + Intronic
1150650923 17:67009671-67009693 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1151146847 17:72049178-72049200 ATCTGCTAATGCCTTGATCTTGG + Intergenic
1151234622 17:72710570-72710592 ATCTTCTGGTGCCTTGATCTTGG + Intronic
1151268534 17:72975574-72975596 ATCTGCTGCTGCCTTGACCTTGG + Intronic
1152373584 17:79905876-79905898 ATCTGCTGGAGCCTTGATATTGG + Intergenic
1152623178 17:81376063-81376085 ATCTGCTCCTGTGATGATGGAGG - Intergenic
1152768508 17:82153738-82153760 AGCTGCTGCTGCCCTGCTGGGGG - Intronic
1153077688 18:1183917-1183939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1153519839 18:5941242-5941264 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1153668996 18:7392460-7392482 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1153675566 18:7453405-7453427 ATCTGGTGATTCCTTGTTGGAGG + Intergenic
1154392021 18:13945749-13945771 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1154938672 18:21088877-21088899 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1154957535 18:21274101-21274123 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1155026954 18:21949703-21949725 ATCTGCTGCCACCTTGATTTTGG + Intergenic
1155320899 18:24617950-24617972 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
1155337412 18:24778843-24778865 ATCTGCTGCTGGCAAGTTGGAGG + Intergenic
1155637652 18:27974835-27974857 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1155779237 18:29810387-29810409 ATCTGCAGCTGCTTTGATATTGG + Intergenic
1155807517 18:30190938-30190960 ATCTGCTGCTAGTTTAATGGAGG + Intergenic
1156226329 18:35112884-35112906 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1156428268 18:37040041-37040063 TGCTGTTGCTGGCTTGATGGTGG - Intronic
1156499101 18:37545654-37545676 ATCTGCTCAAGCCTGGATGGAGG + Intronic
1156950678 18:42893348-42893370 ATCTACTGATGCCTTGATCTTGG - Intronic
1157274465 18:46301192-46301214 ATCTGCTAGTGCGGTGATGGTGG + Intergenic
1157369140 18:47094232-47094254 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1157510517 18:48268906-48268928 ATCTGCTGGTGGCTTGATCTTGG - Intronic
1157663586 18:49466829-49466851 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1157888782 18:51394584-51394606 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1158400341 18:57116113-57116135 ATCTGCAGGTGCCTTGATGTTGG - Intergenic
1158980463 18:62755643-62755665 ATCTACTGGTGCCTTGATCTTGG + Intronic
1158992790 18:62887486-62887508 ACCTGCTGGTGCCTTGATCCTGG - Intronic
1159501190 18:69272660-69272682 ATATGCTGCTGCCTAGGTGATGG + Intergenic
1159642588 18:70880891-70880913 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1159810577 18:73013845-73013867 ATCTGATGCTGCCTTGACCTTGG - Intergenic
1160104124 18:75953754-75953776 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1160113985 18:76059720-76059742 AGCTGCTGGTGCCTTGATCTGGG + Intergenic
1160729186 19:632989-633011 TTCGGCTTCTGCCTTTATGGAGG - Intronic
1161926921 19:7307745-7307767 ATGTGTTGCTGTCCTGATGGTGG + Intergenic
1162552881 19:11367627-11367649 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1162868216 19:13565182-13565204 ATCTACTGGTGCCTTGATCTTGG + Intronic
1162877951 19:13634841-13634863 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1162978572 19:14223472-14223494 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1163627975 19:18401814-18401836 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1163829201 19:19539805-19539827 CTCTGCTGCGGGCTTGTTGGGGG + Intronic
1164632416 19:29770210-29770232 ACCTGCTGGCGCCTTGATGCTGG + Intergenic
1167317046 19:48770348-48770370 ATATGCTGCTGCCTTGATGTTGG + Intergenic
1167729421 19:51242654-51242676 ATCTGCTGGTCCCTTGATCTTGG - Intronic
1167754662 19:51404657-51404679 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1168632451 19:57968084-57968106 AGCTGCTGATGCCTTGATCTGGG - Intronic
925016869 2:534624-534646 ATCTGCTGGTGTCTTGATCTCGG - Intergenic
925095554 2:1196658-1196680 ATCAACTGATGGCTTGATGGAGG - Intronic
925124814 2:1446313-1446335 ATTTGCTCCTGCCTTGCTGAGGG + Intronic
925249283 2:2417464-2417486 GTCTGCTGCTTCCTTGATCTTGG + Intergenic
925456582 2:4021604-4021626 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
925691521 2:6528980-6529002 ATCTGCTGACGCCTTGATTTTGG - Intergenic
925715299 2:6779528-6779550 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
925836790 2:7953884-7953906 GTCTCCTGCTGTTTTGATGGAGG + Intergenic
926184160 2:10675259-10675281 AGCTGTTGCTGGCTTGAAGGTGG + Intronic
926396454 2:12447452-12447474 ATCTGCTGGTTCCTTGATCTTGG + Intergenic
926428161 2:12758732-12758754 ATCTGCTGATGCCTTGATCTTGG + Intergenic
926450206 2:12994362-12994384 ATCTGCTGGTGTATTGATGTTGG - Intergenic
926840371 2:17073141-17073163 ATCTGCTGGTACCTTGATCTTGG + Intergenic
927789136 2:25996445-25996467 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
928266761 2:29818654-29818676 ATCTGCTACTGCGCTGCTGGAGG - Intronic
928415914 2:31091647-31091669 ATCTGCTGGTGCTTTGATCTAGG - Intronic
929129049 2:38548036-38548058 ATCAGCTGATGCCTTGATCCTGG + Intergenic
929166618 2:38888148-38888170 ATCTGCTAGTGCCTTGATCTTGG + Intronic
930107186 2:47649548-47649570 ATATGCTGGTGCCTTGATCTTGG + Intergenic
930751593 2:54939694-54939716 CTCTGCTGTTGCCTGGAGGGAGG - Intronic
931373228 2:61683507-61683529 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
931483383 2:62666290-62666312 ATCTGGTGGTGCCTTGATCTTGG - Intergenic
931685492 2:64788843-64788865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
931748092 2:65308127-65308149 CCCTGCTGCTGCCCTGATGCTGG - Intergenic
932001127 2:67886149-67886171 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
932291471 2:70583690-70583712 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
932484124 2:72071219-72071241 ATCTGCTGATACCTTGATCTTGG - Intergenic
932525599 2:72463867-72463889 ATCTGCTGATACCTTGATGTTGG - Intronic
932634347 2:73375044-73375066 AACTGCTGGTGCCTTGATCTTGG + Intergenic
932634461 2:73376237-73376259 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
932689173 2:73897738-73897760 ATCTGCTGGTGCCTTGATCTTGG - Intronic
932836075 2:75038809-75038831 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
933178619 2:79204694-79204716 ACCTGCTGATGCCTTGATCTTGG - Intronic
933213647 2:79600761-79600783 ATTTGCTGCTGCCTTCATCTTGG - Intronic
933290844 2:80436658-80436680 ATCTGCTGGTGCCTCGATCTTGG - Intronic
933290904 2:80437131-80437153 ATCTGCTGGTCCCTTGATCTTGG + Intronic
933546228 2:83716149-83716171 ATCTGTAGGTGCCTTGATGTTGG - Intergenic
934637442 2:96003250-96003272 ATCTGCTCTTGCCTTGATCTTGG + Intergenic
934796212 2:97102155-97102177 ATCTGCTCTTGCCTTGATCTTGG - Intergenic
934987180 2:98895982-98896004 ATCTGCTGGCGCCTTGATCTAGG + Intronic
935172836 2:100623985-100624007 ATCTGCTGCCACCTTGATCTTGG - Intergenic
935235308 2:101133523-101133545 ATCTGCTGGTGCCTTGATCTTGG - Intronic
935268684 2:101415380-101415402 ATCTGCTGGTGCCTTGATCTTGG + Intronic
935856847 2:107283659-107283681 GTCTGCTGCTGGCTTGTTGGAGG - Intergenic
936619445 2:114080341-114080363 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
936871432 2:117137707-117137729 ATTTGCTGATGCCTTGATCTTGG + Intergenic
937029734 2:118728464-118728486 ATCTGCTGGTACCTTGATCTTGG + Intergenic
937116114 2:119406213-119406235 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
937134361 2:119540188-119540210 ATGTGCTGGTGCCTTGATCTTGG + Intergenic
937253151 2:120536694-120536716 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
937282796 2:120731823-120731845 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937363805 2:121246618-121246640 GGCTGCTGCTGCCCTGCTGGGGG - Intronic
937496572 2:122426482-122426504 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
937589470 2:123595754-123595776 ATCTGCTGATGCCTTGATCTTGG - Intergenic
937589898 2:123600246-123600268 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937846689 2:126586060-126586082 ACCTGCCGATGCCTTGATTGTGG + Intergenic
938109840 2:128556538-128556560 ATCTGCTGGTGTCTTGATGTTGG + Intergenic
938132628 2:128730877-128730899 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
938684295 2:133721944-133721966 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
939089912 2:137768120-137768142 ATCTACTGGTGCCTTGATCTTGG - Intergenic
939119558 2:138100302-138100324 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
939383763 2:141469455-141469477 ATCTGCTGGTACCTTGATCTTGG - Intronic
939862273 2:147434585-147434607 TTCTGCCACTGCCTTGATCGTGG - Intergenic
939877777 2:147597497-147597519 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
939988205 2:148852998-148853020 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
940042004 2:149370575-149370597 ATCTGCTGGTGCCCTGATCTTGG + Intronic
940069521 2:149669916-149669938 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
940322163 2:152389245-152389267 ATTTGCTGATGCCTTGATCTTGG - Intronic
940327121 2:152436986-152437008 ATCTGCCAGTGCCTTGATGCTGG - Intronic
940399376 2:153229650-153229672 TTCTGCTGATGACTTGATAGTGG + Intergenic
940418423 2:153449690-153449712 ATCTGCTGCCACCTTGATCTTGG - Intergenic
940494984 2:154416263-154416285 ATCTGCTGGTGTCTTGATCTTGG - Intronic
940644576 2:156377199-156377221 ATCTGCTGTGGCCTTGATCTTGG + Intergenic
940663161 2:156572905-156572927 ATCTACTGATGCCTTGATCTTGG - Intronic
940722097 2:157293249-157293271 ATCTGCTAGTGCCTTGATCTTGG - Intronic
941050806 2:160731569-160731591 GCCTGCTGATGCCTTGATGCTGG - Intergenic
941055953 2:160788279-160788301 ATCTGCGGGTGCCTTGATCTTGG + Intergenic
941197214 2:162467826-162467848 ATCTGCTGTTGCCTTGATCTTGG - Intronic
941224556 2:162830847-162830869 ACCTGCTGATGCCTTGATCTTGG + Intronic
941246886 2:163109567-163109589 ATCTGTTGGTGCCTTGATCCTGG - Intergenic
941493518 2:166172051-166172073 CTCCAATGCTGCCTTGATGGAGG + Intergenic
941531729 2:166678797-166678819 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
941621513 2:167784211-167784233 ATCTGCAGATGCAGTGATGGGGG - Intergenic
941709430 2:168696611-168696633 ATCTGCTGGTGCCTTGATCTGGG - Intronic
942225006 2:173807413-173807435 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
942426889 2:175869478-175869500 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
942471617 2:176266767-176266789 ATCTGCTGGTGCCTTGATCATGG + Intergenic
942790811 2:179758294-179758316 ATCTGCTGATACCTTGATCTTGG - Intronic
942850734 2:180482391-180482413 ACCTGCTGGTACCTTGATAGTGG - Intergenic
942955985 2:181773899-181773921 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
943083547 2:183284643-183284665 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943129231 2:183837180-183837202 AGCAGCTGCTGCCATGATGCTGG + Intergenic
943179571 2:184525229-184525251 AGTCGCTGCTGCCATGATGGTGG - Intergenic
943505422 2:188750388-188750410 ATCTGCTGGGGCCTTGATCTTGG + Intronic
943719474 2:191188843-191188865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
943781523 2:191829372-191829394 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943834029 2:192496154-192496176 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG + Intergenic
945048060 2:205799190-205799212 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
946128153 2:217582460-217582482 ATCTTCTGGTGCCTTGATCTTGG + Intronic
946182293 2:217955969-217955991 CTCTGCAGCTGCCTTGAAGTGGG + Intronic
946356758 2:219190977-219190999 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
946443214 2:219714474-219714496 ATCTGCTCATGCCTTGATCTTGG + Intergenic
946480052 2:220046478-220046500 ATCTGCTGCTACCTTGACTTTGG + Intergenic
946638803 2:221760637-221760659 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
946844051 2:223843617-223843639 ACCTGCTGATGCCTTGATCTTGG + Intergenic
946909808 2:224448472-224448494 GTCTGCTGTTGCCTTGATGATGG + Intergenic
947258575 2:228193745-228193767 ATCTGCTAATGCCTTGATCTTGG + Intergenic
947288628 2:228546497-228546519 ATCTGCTGGTGCTTTGATGTTGG - Intergenic
947673589 2:231958583-231958605 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
947943921 2:234083451-234083473 ATCTGCTGGCACCTTGATGCTGG - Intergenic
947988335 2:234467397-234467419 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
948146723 2:235713803-235713825 ATCTGCAGGTGCCTTGATCTTGG - Intronic
948459698 2:238123280-238123302 AACAGCTGCTTCCTTGGTGGGGG - Intronic
948875812 2:240827273-240827295 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1168842551 20:918871-918893 ATCGGCTGGTGCCTTGATCTTGG + Intergenic
1168863943 20:1068190-1068212 ACATGCTGCTGCCTTGATCTTGG - Intergenic
1169346280 20:4830345-4830367 CTCTTCTGCTGCTTTGGTGGTGG - Intergenic
1169499504 20:6145838-6145860 ACCTGCTGATGCCTTGATTTTGG + Intergenic
1169830845 20:9823241-9823263 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1169939129 20:10918069-10918091 ATCTGCTGACGCCTTGATCTTGG + Intergenic
1170040387 20:12034012-12034034 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1170561972 20:17566545-17566567 ATCTGCTGGTGACTTGATCTTGG - Intronic
1170681631 20:18531180-18531202 ATCTCCTACTGCCTTGAAGCAGG - Intronic
1170722772 20:18898387-18898409 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1171054607 20:21894143-21894165 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1171166950 20:22980417-22980439 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1171381778 20:24738831-24738853 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1171436409 20:25128255-25128277 ATCTGCTGGTGCCTGGATCTTGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172602070 20:36190776-36190798 ATGTCCCGCAGCCTTGATGGAGG + Exonic
1172769906 20:37375832-37375854 ATCTGCTGCCACCTTGATATTGG - Intronic
1173010680 20:39178955-39178977 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1173039041 20:39442985-39443007 ATCTGCTAGTGCCTTGATCATGG - Intergenic
1173433013 20:43008353-43008375 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1173536745 20:43820556-43820578 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1173574598 20:44104016-44104038 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1173707494 20:45123477-45123499 ATCTGCTGGTGCCTTGATCTTGG - Exonic
1174144537 20:48442203-48442225 ATCTGATACTGCCTTGATCTTGG - Intergenic
1174183387 20:48688932-48688954 AGCTGCTGCTGGCGTGGTGGTGG - Intronic
1174696525 20:52565196-52565218 ATATGCTGCAGCCTTGATCATGG - Intergenic
1174821656 20:53731614-53731636 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1175176496 20:57115476-57115498 ATCTGCTGGTGCCTTAATCCTGG - Intergenic
1175297669 20:57920372-57920394 ATCTGCTGATGTCTTCATTGTGG - Intergenic
1175608822 20:60333351-60333373 ATCTGCCGGTGCCTTGATCTTGG - Intergenic
1176006886 20:62870192-62870214 ATATGCTGGTGCCTTGATCTGGG - Intergenic
1176271631 20:64238313-64238335 ATTTTTTGCTGCCTTGGTGGAGG - Intronic
1177007147 21:15687433-15687455 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1177201060 21:17956614-17956636 ATATGCTGGTGCCTTGATCTTGG - Intronic
1177203612 21:17985871-17985893 ATCTGCTGGTACCTTGATCTTGG - Intronic
1177220461 21:18185754-18185776 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1177530263 21:22349754-22349776 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1177790012 21:25712955-25712977 GTCTACTGGTGCCTTGATTGTGG - Intronic
1177804617 21:25862239-25862261 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1178237543 21:30859789-30859811 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1178252396 21:31016783-31016805 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1178306503 21:31495296-31495318 ATCTGCCGGTGCCTTGATCTTGG - Intronic
1178374068 21:32051879-32051901 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1178435361 21:32553400-32553422 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1178519943 21:33281012-33281034 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1179149829 21:38800268-38800290 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1179320135 21:40283541-40283563 ATTTGCTGCTGCCTTCAAAGTGG - Intronic
1179344602 21:40545213-40545235 ATCTACTGGTGCTTTGATTGTGG + Intronic
1179350043 21:40600283-40600305 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1179482461 21:41686850-41686872 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1180294706 22:10873699-10873721 CTCTGGTGCTTCGTTGATGGGGG + Intergenic
1180423849 22:12898847-12898869 TACTGCTGCTGCCTTGAAAGCGG - Intergenic
1180497512 22:15903113-15903135 CTCTGGTGCTTCGTTGATGGGGG + Intergenic
1180616153 22:17129149-17129171 ATCTGCTGATGCCTTGATCTTGG + Intronic
1180947888 22:19706816-19706838 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1182693817 22:32182825-32182847 ATCTGCTGGTGCCTTGCTCTTGG - Intergenic
1182908684 22:33960966-33960988 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1183017792 22:35004172-35004194 ATCTGCTGGTGCCTAGATCTTGG - Intergenic
1184313436 22:43664088-43664110 CTCTGCTGCTGTCTCCATGGTGG - Intronic
1184722795 22:46325080-46325102 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1185356954 22:50379059-50379081 ATCTGCTGCTGCCTTGGTTTTGG + Intronic
949196348 3:1313807-1313829 GTCTGCTGTTGCCTTGATCATGG - Intronic
949373024 3:3355423-3355445 ATCTGCTGGTACCTTGATCTTGG + Intergenic
949714712 3:6916532-6916554 ATCTGCTGGCACCTTGATTGTGG - Intronic
950220695 3:11193487-11193509 ATCTGCTGGTGCCTTGATCTTGG - Intronic
950263018 3:11555525-11555547 TTCTGCTGCTGCCTTGAGCTGGG + Exonic
950500824 3:13362446-13362468 ATCTGCTGGTGCCTTGACCTTGG + Intronic
950688462 3:14636245-14636267 ATCTGCTGCTGCCTCGATCTTGG + Intergenic
950704445 3:14771229-14771251 ATCTGCAGGTTCCTTGATGACGG + Intronic
950842420 3:15980184-15980206 ATCTGCTGGTGCCTTGATATTGG - Intergenic
951103919 3:18720934-18720956 ATCTGCTTGTGCCTTGATCTTGG - Intergenic
951681099 3:25295432-25295454 ATCTGCTGGTACCTTGATCTTGG + Intronic
951706605 3:25550389-25550411 ATCTCCTGGTGCCTTGATCTTGG - Intronic
951890458 3:27563471-27563493 ATCTGCGGGAGCCTTGATGTTGG - Intergenic
952509832 3:34041906-34041928 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
952706992 3:36389280-36389302 CTCTGCTGATGCCTTGATCTTGG - Intronic
952766765 3:36961078-36961100 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
953145360 3:40270004-40270026 CTCTGCTGATGCCTTGATCTTGG - Intergenic
953162264 3:40432256-40432278 GTCAGCTGATGCCTTGATGTTGG - Intergenic
953408405 3:42672258-42672280 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
953747917 3:45589149-45589171 ATTTGCTGTTGCCTTGATCTTGG + Intronic
954617610 3:51977597-51977619 TTCAGCTGATGCCATGATGGTGG + Intronic
954898251 3:53995984-53996006 ATCTGCTGGTACCTTGATCTTGG + Intergenic
955123165 3:56082382-56082404 ATCTGCTGATGCCTTGATCTTGG + Intronic
955165117 3:56503406-56503428 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
955327640 3:58021414-58021436 ATGTGCTGCTGCTGGGATGGGGG + Intronic
955466610 3:59243494-59243516 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
955478712 3:59367026-59367048 ACCTGCTGTTGCCTTGATCTTGG + Intergenic
955732222 3:61998936-61998958 ATCTGCTGGTGCCTTAATCTTGG - Intronic
956106973 3:65829527-65829549 ATCTGCTGGTGCCTTGATCTTGG + Intronic
956146137 3:66192442-66192464 ATCTGCTGGTGCATTGATTTTGG + Intronic
956914636 3:73858510-73858532 ATCTGCTGATGCCTTGATCTAGG - Intergenic
956980975 3:74636934-74636956 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
957253894 3:77812040-77812062 ACCTGCTGGTGCCTTGATCATGG - Intergenic
957400757 3:79709934-79709956 ATCTGCTGCTGCATTGACTTTGG + Intronic
957732774 3:84162704-84162726 ATCTGCTGGTGCTTTGATCTGGG + Intergenic
958671515 3:97211483-97211505 ATCTTCTGGTGCCTTGATCTTGG - Intronic
959407261 3:105975606-105975628 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
959623864 3:108427481-108427503 ACCTGCTGCTACCTTGATCTTGG + Intronic
959726953 3:109554448-109554470 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
959910587 3:111759238-111759260 ATCTGCTGGTGTCTTAATTGTGG - Intronic
960004316 3:112766504-112766526 ATCTACTGGTGCCTTGATCTTGG + Intronic
960121587 3:113952735-113952757 ATCTGCTGCTGCCTTGATCTTGG - Intronic
960143429 3:114173201-114173223 ATCTTCTGGTGCCTTGATCTTGG + Intronic
960747350 3:120904732-120904754 ATCTGCCGATGCCTTGATCTTGG + Intergenic
960977866 3:123193984-123194006 ACCTGCTGGTGCCTTGATCTTGG - Intronic
961061521 3:123832764-123832786 ATCTGCTGGTGTCTTGATCTTGG + Intronic
961499211 3:127319354-127319376 ACCTGCTGCTGTCTTGATCTTGG + Intergenic
961683735 3:128616057-128616079 ATCTGCCGGTGCCTTGATCTTGG + Intergenic
961702166 3:128753613-128753635 ATCTGCTGGAGCCTTGATTTTGG - Intronic
961945461 3:130682409-130682431 GTCTGCTGCTACCTTGATTTTGG + Intronic
961990013 3:131179222-131179244 ACCTGCTGTTGCCTTGATCTTGG + Intronic
962071793 3:132041422-132041444 AACTGCTGATGCCTTGATCTTGG - Intronic
962252592 3:133845464-133845486 ATCTGCTGGAGCCTTGATCTTGG + Intronic
962373724 3:134842233-134842255 ATCTGCTGGTGCCTTGATCTTGG + Intronic
962685461 3:137843288-137843310 ATCTGCTGGTACCTTGATCTTGG + Intergenic
962687402 3:137860748-137860770 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963173731 3:142277458-142277480 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963570170 3:146983798-146983820 ATCTGATGCTGGTTGGATGGGGG - Intergenic
963850906 3:150209484-150209506 ATCTGCTGGTACCTTGATCTTGG + Intergenic
964009881 3:151879553-151879575 ATCTGCTGATACCTTGATCTTGG + Intronic
964838458 3:160967409-160967431 ATCTGCTGGTGCCTTGACCTTGG - Intronic
964885131 3:161473304-161473326 ATCTGCTGAGGCCTTGATCTTGG - Intergenic
965523821 3:169696125-169696147 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
965756426 3:172032352-172032374 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
965768690 3:172158079-172158101 ATCTGCTGGTGCCTTGATCTTGG + Intronic
965868426 3:173235535-173235557 ATCTTCTGCTGGGTTGATGAGGG - Intergenic
966054011 3:175659992-175660014 ATCTGCTGATGCCTTAATCTTGG - Intronic
966239716 3:177743041-177743063 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
966254960 3:177907415-177907437 ATCTACTGGTGCTTTGATGTTGG + Intergenic
966493538 3:180555114-180555136 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
966580063 3:181551365-181551387 ACCTGCTGATGCCTTGATCTTGG - Intergenic
966583337 3:181593195-181593217 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
966632948 3:182098671-182098693 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
966640844 3:182187897-182187919 ATCTGCTGATACCTTGATCTTGG - Intergenic
966792815 3:183689442-183689464 ATCTGCTGGTGCCTTGATATTGG - Intergenic
967042399 3:185705685-185705707 ATCTGCTGGTGCCTTGATCTTGG - Intronic
967414466 3:189201096-189201118 ATGTGCTGGTGCCTTGATCTTGG + Intronic
967863576 3:194172135-194172157 ATCTGATGGTGCCTTGATCTTGG - Intergenic
967875892 3:194268258-194268280 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875902 3:194268297-194268319 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875912 3:194268336-194268358 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875922 3:194268375-194268397 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
968079417 3:195835910-195835932 CTCTGCTGCAGCCCTGGTGGAGG - Intergenic
968143100 3:196274369-196274391 ATGGGCTGCTGCCATGATGCCGG - Intronic
1202747091 3_GL000221v1_random:113649-113671 TACTGCTGCTGCCTTGAAAGCGG + Intergenic
968431519 4:561884-561906 AGCCTCTGCTGCCTTCATGGGGG - Intergenic
968794897 4:2696843-2696865 GTCTGCTGCTGCCCTCATGATGG - Intronic
969256728 4:6007477-6007499 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
969391811 4:6896350-6896372 ATCTGCTGCTACTTTGATCTTGG + Intergenic
969593593 4:8135595-8135617 ATCTGCTGGTGCCTTCATCTGGG + Intronic
969965246 4:10987249-10987271 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
969970344 4:11040515-11040537 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
970478102 4:16444857-16444879 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
970583188 4:17491965-17491987 ATCTGCTGGTGCCTTCATCTTGG + Intronic
970599565 4:17630491-17630513 ATCTGCTGGTGCCTTGATCTTGG + Exonic
970694976 4:18666621-18666643 AACTGCTGGTACCTTGATGTTGG - Intergenic
970805254 4:20023572-20023594 ACCTGCTGGTGCCTTGATTTTGG - Intergenic
970836591 4:20416240-20416262 ATCTGCTGGTGCCTTGAACTTGG - Intronic
971190197 4:24420872-24420894 ATCTGCTGGTGCTTTGATCATGG - Intergenic
971361949 4:25946329-25946351 ATCTGCTGGTGCTTTGATTTTGG - Intergenic
971385465 4:26137425-26137447 ATCTGCTGCATCCCTGATGATGG - Intergenic
971459693 4:26881567-26881589 ATCTGCTGGTGCCTTTATCTTGG + Intronic
971763906 4:30804664-30804686 ATCTGCTGGTGCCTTGCTCTTGG + Intronic
971938521 4:33185953-33185975 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
972009145 4:34153544-34153566 ATCTGCTGGTGCCTTGAGCTTGG - Intergenic
972181627 4:36474056-36474078 ATCTGCTGGTGCCGTGATCTTGG - Intergenic
972261793 4:37416114-37416136 TTCTCCTGCTGCCTTGTGGGGGG - Intronic
972295765 4:37736234-37736256 ATCTGCCGATGCCTTGATCTTGG + Intergenic
972339960 4:38143581-38143603 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
972379645 4:38507551-38507573 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
972840152 4:42921259-42921281 ATCTGCTGGTACCTTGATCCTGG + Intronic
972973397 4:44604779-44604801 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
973199936 4:47488950-47488972 ATCTGCTGGCGCCTTGATTTTGG + Intronic
973602812 4:52558711-52558733 ATCTGCTGATGCCTTGATCTTGG - Intergenic
973604381 4:52571971-52571993 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
973762670 4:54133952-54133974 ATCTGCTGTTGCCTTAATCTTGG - Intronic
973766111 4:54164568-54164590 ATCTGCTAGTGCCTTGATCGGGG - Intronic
973854752 4:55000115-55000137 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
973909063 4:55560905-55560927 ATCTGCTGGCGCCTTGATCTGGG + Intronic
974015736 4:56647365-56647387 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
974031714 4:56782331-56782353 ATCTGCTGATGCCTTAATCTTGG - Intergenic
974308829 4:60176638-60176660 ATCTGCGGGTGCCTTGATCTGGG + Intergenic
974331453 4:60484066-60484088 ATCTGCTTGTGCCTTGATTTTGG + Intergenic
974589473 4:63925407-63925429 ATCTGCTGGTGCCTTCATCATGG - Intergenic
974623895 4:64397615-64397637 ATCTGCTGGTGCCTTAATTCTGG + Intronic
974750517 4:66134586-66134608 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
974837266 4:67266096-67266118 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
975200548 4:71583112-71583134 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
975260018 4:72287208-72287230 ATCTGCTGATGCCTTGATCATGG + Intronic
975684632 4:76907460-76907482 ATCTGCTGCAACCTTGATCTTGG - Intergenic
975798400 4:78033212-78033234 ATCTGCTGATGCCTTAATCTTGG - Intergenic
976376287 4:84349425-84349447 ATCTGCTGGTACCTTGATCTTGG - Intergenic
976517361 4:85984347-85984369 ATCTGCTGGTGCCTTGATCTTGG - Intronic
976635270 4:87281096-87281118 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
976738903 4:88338855-88338877 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
976757149 4:88510689-88510711 ATCTGCTGATGTCTTGATCTTGG + Intergenic
977228349 4:94421515-94421537 ATCTGCTGCACCCTTGATCTTGG + Intergenic
977570027 4:98619784-98619806 ATCTGCTGGAGCCTTGATTTTGG - Intronic
977605661 4:98982856-98982878 ATCTGCGGGTGCCTTGATTTTGG - Intergenic
977682371 4:99810750-99810772 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
977976315 4:103270838-103270860 ATATGCTGGTGCCTTGATCTTGG - Intergenic
977983730 4:103357984-103358006 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
978531327 4:109717108-109717130 ATCTGCTAGTGCCTTGATCTTGG + Intronic
978938784 4:114412947-114412969 GTCTGCTGCTGCATTGATGAGGG - Intergenic
979348112 4:119612735-119612757 ATCTGCTGGTGCCTTGATCTTGG + Intronic
979543938 4:121918219-121918241 ACCTGCTGGTGCCTTGATCTTGG + Intronic
979748367 4:124244881-124244903 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
979925575 4:126558878-126558900 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
980502691 4:133677066-133677088 ATTTGCTGATGCCTTGATCTTGG - Intergenic
980559570 4:134455311-134455333 ATCTGCTGATGCCTTGATCATGG - Intergenic
980900045 4:138896346-138896368 ACCTGCTGCTACCTTGATCTTGG - Intergenic
981050769 4:140307144-140307166 ATCTGCTGGTGTCTTGATCTTGG + Intronic
981102670 4:140847375-140847397 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
981260430 4:142712161-142712183 ATCTGCTGGTGCCTTGATCTTGG + Intronic
981298870 4:143164563-143164585 ATCTGCTGATGCCTTTATCTTGG + Intergenic
981314675 4:143330529-143330551 ATCTGCTGGTACCTTGATGGAGG + Intergenic
981572772 4:146170515-146170537 ATCTGCTGCAGCTTTGATCTTGG + Intergenic
981661488 4:147172377-147172399 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
982099620 4:151955167-151955189 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
982314735 4:154020727-154020749 GTCTGCTTCTGCCTTCATGTGGG + Intergenic
982554612 4:156843286-156843308 ATCTGCTGGTGCCTTGATCTTGG + Intronic
983270166 4:165551817-165551839 ATCTGCTGATGCCTTGACCTTGG - Intergenic
983317546 4:166151365-166151387 ACCTGCTGATGCCTTGATCTTGG - Intergenic
984399507 4:179243832-179243854 ATCTGCTGATGCCTTGATTTTGG - Intergenic
984462245 4:180052903-180052925 ATCTGCTGCTGTATTGATCTTGG + Intergenic
985010669 4:185579319-185579341 ATCTGCTCGTGCCTTGATCTTGG + Intergenic
985168000 4:187117876-187117898 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
985213560 4:187622698-187622720 ATCTGCTGATGCTTTGATCTTGG + Intergenic
1202754693 4_GL000008v2_random:49769-49791 TACTGCTGCTGCCTTGAAAGCGG - Intergenic
986020800 5:3800378-3800400 ATCTGATGATGCCTTGATCTTGG - Intergenic
986406080 5:7426374-7426396 ATCTGCCGGTGCCTTGATCTTGG - Intronic
986543195 5:8868986-8869008 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
986674540 5:10171469-10171491 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
986861865 5:11936184-11936206 ATCTACCAGTGCCTTGATGGGGG - Intergenic
986862167 5:11939433-11939455 ATCTGCTGCTGCTTTGATGTTGG - Intergenic
987121161 5:14768368-14768390 TTCTGCTGCTGCTTTCTTGGTGG - Intronic
987506139 5:18775620-18775642 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
987613131 5:20234575-20234597 ATCTGCTGCAGCCTTGTTCTCGG + Intronic
987653122 5:20770656-20770678 ATCTGCTAATGCCTTGATCTTGG - Intergenic
987690464 5:21259883-21259905 ATCTGCTGGTGCCTTGATATTGG - Intergenic
988289356 5:29265791-29265813 ATTTGCTGGTGCCTCGATGTTGG - Intergenic
988393498 5:30666480-30666502 ATCTGCTGTTACCTTGATATTGG - Intergenic
988397556 5:30714238-30714260 CTCTGCTGCTGCCTTGACCTTGG + Intergenic
988442963 5:31253058-31253080 ATTTGCTGGTGCCTTGATCTTGG - Intronic
988521656 5:31950946-31950968 ATCTGCCGGTGCCTTGATCTTGG - Intronic
988566345 5:32322525-32322547 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
988739834 5:34059466-34059488 ATCTGATGGTGCCTTGATCTTGG - Intronic
988742451 5:34090828-34090850 ATCTGCTAATGCCTTGATCTTGG + Intronic
989476071 5:41874467-41874489 ATATGCTGGTGCCTTGATCTTGG - Intergenic
989476419 5:41879180-41879202 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
989506868 5:42236377-42236399 AACTGCTGGTGCCTTGATCTTGG - Intergenic
989642153 5:43593287-43593309 GTCTGCTGCTACCTTGATCTTGG + Intergenic
989744938 5:44817786-44817808 ATCTGCTGGTGCCTTGATCTTGG + Intronic
989777788 5:45230180-45230202 ATCTGCTGATGCCTTGATCTTGG + Intergenic
989789520 5:45380141-45380163 ATCTGCTGATGTCTTGATTGTGG - Intronic
989981743 5:50654081-50654103 ACGTGCTGCTGCATTCATGGTGG + Intergenic
990120244 5:52442428-52442450 ATCTACTGTTGCCTTGATCTTGG + Intergenic
990160073 5:52928041-52928063 ATCTGTTGGTGCCTTGATCTTGG + Intronic
990465463 5:56067301-56067323 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
990801664 5:59611166-59611188 ATCTGCTGATGCCTTCATCTTGG - Intronic
990949637 5:61286025-61286047 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
991277149 5:64862820-64862842 ATCTGCTAATGCCTTGATCTTGG - Intronic
992024352 5:72655862-72655884 ATCCACTGCTTCCTTGGTGGTGG - Intergenic
992070546 5:73144680-73144702 ATCTGCCGGTGCCTTGATCTGGG + Intergenic
992154659 5:73943130-73943152 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
992159497 5:73986939-73986961 ATCTGCTGATGCCTTGATCTTGG - Intergenic
992181870 5:74205377-74205399 ATCTGCTGGCACCTTGATTGTGG + Intergenic
992261215 5:74972154-74972176 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
992458101 5:76934745-76934767 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
992849784 5:80795397-80795419 ATCTGCTGGTACCTTGATCTTGG - Intronic
992993496 5:82309462-82309484 TTCTCCTGCTGCCTGGGTGGAGG + Intronic
993107259 5:83613269-83613291 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
993121126 5:83775319-83775341 ACTTGCTGCTGCCTTGATCTTGG - Intergenic
993168718 5:84387985-84388007 ATCTGCTGGTGCATTGATCTTGG + Intergenic
993223163 5:85130043-85130065 ATCTACTGGTGGCTTGATCGTGG - Intergenic
993322920 5:86496376-86496398 ATCTGCTGGTGCCTTAATTGTGG + Intergenic
994163282 5:96581009-96581031 ATCTGCTGGTGCCTTGGTCTTGG + Intronic
994714460 5:103305155-103305177 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
995144554 5:108771995-108772017 ACCTGCTGGTGTCTTGATGTTGG - Intronic
995367401 5:111378249-111378271 ATCTTCTGGTGCCTTGATCTTGG + Intronic
995471313 5:112504462-112504484 ATCTGCTGCAGGTTTGCTGGAGG - Intergenic
995512021 5:112919726-112919748 ATCTGCTGGTGCCTTGGTCCTGG + Intronic
995739357 5:115338770-115338792 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
996049028 5:118910805-118910827 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996073599 5:119162421-119162443 ATCTGCTGGTGTCTTGATCTTGG - Intronic
996251345 5:121337144-121337166 ATTTGCTGATACATTGATGGTGG + Intergenic
996331261 5:122331608-122331630 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996480723 5:123972523-123972545 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
996832930 5:127759503-127759525 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
997023118 5:130025616-130025638 ATCTACTGGTGCCTTGATCTGGG - Intronic
997235405 5:132269487-132269509 TGTTGCTGCTGCATTGATGGGGG + Intronic
997909401 5:137855039-137855061 ATCTGCTGGTGCCTTGGTCTTGG + Intergenic
998485930 5:142502158-142502180 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
998640331 5:144003272-144003294 ATCTGTTGCTGACTTGATCTTGG - Intergenic
998980974 5:147701800-147701822 ATGTGCTGGTGCCTTGATCCTGG + Intronic
999490209 5:152042814-152042836 ATCTGCTGATGCCTTGATTTTGG - Intergenic
999589958 5:153134008-153134030 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
999816147 5:155178319-155178341 ATCTGCTGGTGCTTTGATCTAGG + Intergenic
1000050346 5:157557651-157557673 ATCTGCTGATCCCTTGATCTTGG - Intronic
1000308474 5:160018228-160018250 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1000475920 5:161706639-161706661 AACTGCTGCTGCCGGGATGGAGG + Intergenic
1000738818 5:164939184-164939206 ATCTGCTGGTGCCTTGAACTTGG - Intergenic
1000783484 5:165513742-165513764 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1001003425 5:168029067-168029089 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1001021754 5:168188994-168189016 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1001446862 5:171792072-171792094 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1001553204 5:172619142-172619164 ATCTGCTGGCGCCTTGATCTTGG - Intergenic
1001650650 5:173313591-173313613 ATCTGCAGCTGTCCTGATGAGGG + Intergenic
1001762703 5:174221335-174221357 ATGTCTTGCTGCCGTGATGGGGG + Intronic
1001966462 5:175913368-175913390 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1002250486 5:177925836-177925858 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1002558344 5:180061936-180061958 ATCTGCTGGTGCCTTGAACTTGG - Intronic
1002592151 5:180298256-180298278 ATCTGCCGGTGCCTTGATCTTGG + Intergenic
1002601954 5:180358859-180358881 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1002610013 5:180411197-180411219 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1002883988 6:1277568-1277590 ATCTGCTGGTGCCTGGATCCTGG + Intergenic
1003118599 6:3300547-3300569 ATCTGCTGGTGCCTTAATCCTGG + Intronic
1003193061 6:3890993-3891015 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1003389856 6:5704185-5704207 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1003549157 6:7086413-7086435 AGGTGGTGCTGCCTTGAAGGAGG - Intergenic
1003622129 6:7709743-7709765 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1004289281 6:14351666-14351688 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1004371803 6:15059270-15059292 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1004612348 6:17255465-17255487 ATCTGCTGCTGTCTTGAGCCTGG + Intergenic
1005070901 6:21861430-21861452 ATTTGCTGATGCCTTGATCTTGG - Intergenic
1005442659 6:25887364-25887386 ATCTCCTGGTGCCTTGATCTTGG - Intergenic
1005518264 6:26575007-26575029 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1006781803 6:36637267-36637289 TTCAGCTGCTGCCTGGAGGGAGG - Intergenic
1006810217 6:36815543-36815565 ATTTGCTGGTGCCTTGATATTGG + Intronic
1007036068 6:38674894-38674916 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1007076114 6:39067381-39067403 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1007295931 6:40820466-40820488 ATCTGCCGGAGCCTTGATGTTGG + Intergenic
1007305911 6:40904373-40904395 ATCTGCTGCCACCTTGATCTTGG + Intergenic
1007364086 6:41378284-41378306 ATCTTCTGGTGTCTTGATGCTGG - Intergenic
1007364316 6:41380394-41380416 ATCTGCTGCTGCCTTCATGCTGG - Intergenic
1007840718 6:44713928-44713950 ATCTGCTGCTGACTTGATCTTGG - Intergenic
1008141836 6:47840647-47840669 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1008224139 6:48891695-48891717 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1008252555 6:49258297-49258319 ATCTGCTGTTGCCTTTATTTTGG - Intergenic
1008494265 6:52116859-52116881 ATCTGCTGCCCCTGTGATGGGGG - Intergenic
1008523935 6:52388657-52388679 ATCTGCTGGTGCCTTCATCTTGG + Intronic
1008654513 6:53597938-53597960 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1009336916 6:62502404-62502426 ATCTGCTGGAGCCTTGATTTTGG + Intergenic
1009532050 6:64830215-64830237 ATCTGCTGCCACCTTGATCTTGG + Intronic
1009556035 6:65168421-65168443 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1009623136 6:66101264-66101286 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1009747573 6:67838435-67838457 ATCTGCTAGTGCCTTGATCATGG - Intergenic
1010225415 6:73484340-73484362 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1010470169 6:76217800-76217822 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1010819186 6:80393526-80393548 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1011255839 6:85420005-85420027 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1011289926 6:85766309-85766331 ATCTGCTGGCACCTTGATGTTGG - Intergenic
1011384606 6:86781756-86781778 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1011805469 6:91067936-91067958 ATCTGCTGGCGCCTTGATAGTGG + Intergenic
1012282515 6:97345531-97345553 ATCTGCTGGTGCCTTGACTTTGG - Intergenic
1012560341 6:100572337-100572359 ATCTGCTGATTCCTTGATTTGGG + Intronic
1012807474 6:103912915-103912937 CTCTGCTGATGCCTTGATCTGGG - Intergenic
1013497275 6:110710579-110710601 ATCTCCTGGTGCCTTGATCTTGG - Intronic
1013594126 6:111645650-111645672 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1013624038 6:111919528-111919550 ATCTGCTGAAGCCTTGATCTTGG + Intergenic
1013805227 6:113989343-113989365 ATCTGCTGGTGCCTTCATTTTGG - Intronic
1013991323 6:116257586-116257608 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1014220548 6:118794786-118794808 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1014411568 6:121129056-121129078 ATCTGCTCTTGCCTTGATCTTGG + Intronic
1014568828 6:122984504-122984526 ATCTGCTGGTGGCTTGATCTTGG - Intergenic
1014577411 6:123090696-123090718 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1014666973 6:124250197-124250219 ATCTGCTGGTGCCTTGATCAGGG + Intronic
1015079187 6:129202527-129202549 ATCTGCTGATGCCTGGATCTTGG + Intronic
1015358094 6:132304293-132304315 AACTGCTGGTGCCTTGATTTTGG + Intronic
1015470290 6:133597636-133597658 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1015494805 6:133869293-133869315 ATCTGCTGATGCTTTGATCTGGG + Intergenic
1015500525 6:133927976-133927998 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1015758010 6:136627721-136627743 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1016019440 6:139220226-139220248 ATCTGCTGGTACCTTGATACTGG + Intergenic
1016029299 6:139321413-139321435 ATCTGCTGATGTCTTGATCTTGG + Intergenic
1016265389 6:142227321-142227343 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016294665 6:142562208-142562230 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1016382018 6:143494005-143494027 ATCTGCTGATACCTTGATCTTGG - Intergenic
1016409533 6:143767619-143767641 AAATGCTGCTGCCTTGATCTTGG - Intronic
1016536348 6:145111006-145111028 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016536604 6:145113430-145113452 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1016562168 6:145408779-145408801 ATATGCTGGTGCCTTGATCTTGG - Intergenic
1016926602 6:149356481-149356503 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1017192362 6:151668146-151668168 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1017368352 6:153672331-153672353 ATCTGTTGCTGCCTTGATCTGGG - Intergenic
1017429610 6:154358207-154358229 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1017606738 6:156142737-156142759 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1017770185 6:157638713-157638735 ATCTGCTGCTGCCCAGATCTGGG + Intronic
1017792892 6:157817093-157817115 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1017807653 6:157960006-157960028 ATCTGCTGCTACCTTGATCTTGG + Intergenic
1018484083 6:164222616-164222638 ATCTGTTGGTGCCTTGATTTTGG + Intergenic
1018491004 6:164293378-164293400 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1018537366 6:164835785-164835807 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
1018689894 6:166336544-166336566 ATCTGCTGGCGCCTTGATCATGG - Intronic
1018753234 6:166825612-166825634 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1019445917 7:1071214-1071236 ATCTGCTGCTGACGTGCGGGAGG - Intronic
1019551321 7:1604011-1604033 ACCTGCTGCAGCCGTGACGGGGG - Intergenic
1020356539 7:7281999-7282021 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1020412727 7:7911287-7911309 ATCTGCTGGTGCCTTGATGTTGG - Intronic
1020565743 7:9793467-9793489 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1020792755 7:12646288-12646310 ATCTGCTGTTGCCTTAATCTTGG - Intronic
1020896265 7:13944306-13944328 ATCTGCTGGTGACTTGATGCTGG - Intronic
1021022650 7:15622987-15623009 ATCTGCTGATGCCTTGATCTTGG + Intronic
1021845785 7:24761355-24761377 ATCTGCTGATGCCTTCATCTTGG - Intergenic
1021866280 7:24961630-24961652 ATCTGCTGGTGCCTTGATATTGG + Intronic
1021990609 7:26137921-26137943 TTTTGCTGCAGCCTTGTTGGGGG + Intergenic
1022386819 7:29907715-29907737 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1022501181 7:30883271-30883293 GGCTGCTGCTGCCTTGAGGGAGG - Intronic
1022841127 7:34164746-34164768 AACTGCTGATGCCTTGATCTTGG + Intergenic
1022934999 7:35165784-35165806 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1023122212 7:36921123-36921145 ATTTGCTGGTGCCTTGATTTTGG + Intronic
1023368847 7:39491789-39491811 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1023416090 7:39934182-39934204 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1023539579 7:41251153-41251175 ATCTGCTTGTGCCTTGATCTTGG - Intergenic
1023895980 7:44433144-44433166 ATCTTCTGGTGCCTTGATCTTGG + Intronic
1024267581 7:47618688-47618710 ATCTGCTGGTGGCTTGATCTTGG + Intergenic
1025199209 7:56951291-56951313 CTCTGCTGCTGTCTAGGTGGAGG + Intergenic
1025672737 7:63625642-63625664 CTCTGCTGCTGTCTAGGTGGAGG - Intergenic
1026103564 7:67402638-67402660 ATCTGCTGCCGCCTGGATCTTGG - Intergenic
1026104603 7:67410847-67410869 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1026244448 7:68606293-68606315 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1026253812 7:68693536-68693558 AACTGCTGGTGCCTTGATCTTGG - Intergenic
1026501717 7:70948340-70948362 ACCAACTGCTGCCTTGATGTTGG + Intergenic
1026614475 7:71889207-71889229 ATCTGCTGATGCCTTGATCTTGG - Intronic
1027288617 7:76677431-76677453 ATCTGCTACTGCCTTGGTTTAGG + Intergenic
1027367019 7:77469037-77469059 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027371706 7:77512948-77512970 ATCTGCTTGTGCCTTGATCTTGG + Intergenic
1027377970 7:77573328-77573350 ATCTGCTGGTGCCTTCATCTTGG - Intronic
1027592297 7:80132803-80132825 TTCTGCTGCTGCCTTGCAGATGG - Intergenic
1027703334 7:81496874-81496896 ATCTGCTCCTACCTTGACGTTGG + Intergenic
1027834824 7:83227480-83227502 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027844927 7:83360916-83360938 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1028629077 7:92913917-92913939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1028711024 7:93908383-93908405 ATCTGCTGATGTCTTGATCTTGG - Intronic
1028721279 7:94034819-94034841 ATCAGCTGGTGCCTTGATCTTGG + Intergenic
1028916544 7:96265829-96265851 ACCTGCTGCTGCCTTGATCTTGG - Intronic
1029339591 7:99932206-99932228 ATCTGCTGGTGCCTGGATCGTGG + Intergenic
1029374327 7:100168695-100168717 AGCTGCTGCAGCTTTGATCGCGG + Exonic
1029665651 7:101993429-101993451 AGCTGCAGCTGCTCTGATGGGGG + Intronic
1029830949 7:103258549-103258571 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1030099894 7:105936501-105936523 ATCTGCTGGTGCCTTAATCTTGG + Intronic
1030190937 7:106809419-106809441 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1030203438 7:106928990-106929012 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1030225825 7:107149419-107149441 ATCTTCTGGTGCCTTGATCTTGG - Intronic
1030693501 7:112559237-112559259 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1030791234 7:113731636-113731658 ATCTGTTGATGCCTTGATCCTGG - Intergenic
1030866192 7:114704330-114704352 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1031016158 7:116578864-116578886 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1031308427 7:120163473-120163495 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1031718328 7:125135955-125135977 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1032146937 7:129392342-129392364 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1032892424 7:136212835-136212857 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1033372781 7:140726471-140726493 AGCAGATGCTGCCATGATGGTGG + Intronic
1033486981 7:141800188-141800210 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1033997056 7:147363293-147363315 ATCTGCCACTGCCTTGATCTTGG + Intronic
1034156855 7:148962879-148962901 ATCTGCTGCTGCCTTGATTCAGG + Intergenic
1034370973 7:150596220-150596242 ATCTGCTGATGCCTTGAGCTTGG + Intergenic
1034371779 7:150604739-150604761 ATCTGCTGATGCCTTGAGCTTGG + Intergenic
1034686796 7:152979003-152979025 GTCTGCTGGTGCCTTGATCATGG - Intergenic
1035491502 7:159283380-159283402 ATCTGTTGGTGCCTTGATGTTGG + Intergenic
1035654207 8:1293293-1293315 GCCTGCTGCTGCCTGGCTGGGGG - Intergenic
1035700265 8:1633026-1633048 ACCTGCTGTTGACCTGATGGTGG - Exonic
1035901638 8:3463056-3463078 ATCTGCCACTGCCTTGATCGTGG + Intronic
1036058762 8:5290826-5290848 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1036079209 8:5535130-5535152 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1036161781 8:6395776-6395798 ATCTGCTGGTGCTTTGCTGTTGG - Intergenic
1036443536 8:8802530-8802552 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1036591241 8:10170441-10170463 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1036622873 8:10437530-10437552 ATCTGCTGCCACCTTGATCCTGG + Intergenic
1037002043 8:13731817-13731839 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1038159712 8:25025031-25025053 ATCTGTTGATGCCTTGATCTTGG - Intergenic
1038286852 8:26212882-26212904 ATCTGCTGGAGCCTTGATTTGGG + Intergenic
1038298242 8:26316675-26316697 ATCTGCAGTTGCCTTGATCTAGG - Intronic
1038431413 8:27503194-27503216 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1038684553 8:29704454-29704476 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1038714458 8:29979410-29979432 AGCTGATGCAGCCTTGATGGAGG + Intergenic
1038738747 8:30197826-30197848 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1038854573 8:31317357-31317379 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1038888126 8:31688408-31688430 ATCTGCTGGTACCTTGATCTTGG + Intronic
1039029673 8:33295801-33295823 ATCTGCTGGTGCCTGGATCTTGG - Intergenic
1039211553 8:35220780-35220802 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1039623043 8:39018179-39018201 TTCTGTTGCTGCCTTGAAAGAGG + Intronic
1039745904 8:40426411-40426433 ATCAGCTGGTGCCTTGATATTGG + Intergenic
1040071823 8:43194891-43194913 ATCTACTGGTGCCTTGATCTTGG + Intronic
1040462576 8:47662920-47662942 ACCTGCTGGTGCCTTGATCTGGG + Intronic
1040767375 8:50929134-50929156 ATCTGCTGCCACCTTGATCATGG + Intergenic
1040862081 8:52009011-52009033 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
1040909656 8:52505057-52505079 ATCTGCTGCTTCCTTCGTGTTGG + Intergenic
1040984568 8:53279709-53279731 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1041117379 8:54553337-54553359 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1041212331 8:55564822-55564844 ATCTGCTATTGCCTTGATCTTGG + Intergenic
1041300219 8:56403820-56403842 ATCTGCTGGTGCCTTGTTCTTGG + Intergenic
1041448781 8:57984843-57984865 ATCTGCCGATGCCTTGATCTTGG + Intergenic
1041461753 8:58119292-58119314 ATCTGCTGGTGCCTTGAACTTGG - Intronic
1041589258 8:59557892-59557914 TGCAGCTGCTGCCTTGATGCTGG + Intergenic
1041640883 8:60200204-60200226 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1041644700 8:60239336-60239358 AACTGCTGCTGCCTTGAGAAAGG + Intronic
1041751114 8:61261747-61261769 ATCTGCTGATGTCTTGATCTTGG + Intronic
1041948649 8:63475411-63475433 ATCTGCTGCATCCTTGATCTTGG + Intergenic
1042045947 8:64651774-64651796 ATCTGGTGCTGCCTTGATCTTGG + Intronic
1042103495 8:65298651-65298673 ATCTGTTGGTGCCTTGATCCTGG + Intergenic
1042114285 8:65414440-65414462 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1042166908 8:65954654-65954676 ATCTGCTGGCACCTTGATTGTGG + Intergenic
1042350195 8:67769215-67769237 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1042357208 8:67841345-67841367 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1042454302 8:68982671-68982693 ATCTGCTGATACCTTGATCTTGG + Intergenic
1042474675 8:69233714-69233736 ATCTGCTGGGGCCTTGATCTAGG - Intergenic
1042819406 8:72914066-72914088 ATCTGCTGGTGTCTTGATCTTGG - Intronic
1042843242 8:73145959-73145981 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1042935234 8:74051783-74051805 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1042990271 8:74631746-74631768 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1043257880 8:78158379-78158401 ATCTTTTGATTCCTTGATGGTGG - Intergenic
1043379790 8:79690294-79690316 AGCTGCTGGTGCCTTGATCTTGG - Intergenic
1043585627 8:81766051-81766073 ATCTGCTGGTGCCATGATCTTGG + Intergenic
1043867844 8:85395900-85395922 ATCTGCTGGTACCTTGATCTTGG - Intronic
1044343059 8:91070250-91070272 ATCCGGTGCCGCCTTGAAGGCGG + Exonic
1044443759 8:92249898-92249920 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1044544907 8:93448840-93448862 ATCTGCCGATGCCTTGATCTTGG + Intergenic
1044639617 8:94365061-94365083 CTCTGCTGGTGCCTTGTTCGTGG + Intergenic
1044775932 8:95687898-95687920 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
1045260133 8:100565594-100565616 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1045356965 8:101397768-101397790 ATCTGGTGGTCCCTTGATGCTGG + Intergenic
1045415948 8:101967716-101967738 ACCCTCTGCTGCCTTGCTGGTGG - Intronic
1045554293 8:103200676-103200698 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1045782727 8:105886686-105886708 AGCAGCTGCTGCCATGATGCTGG + Intergenic
1045971407 8:108083166-108083188 AGCTGCGGCTGCCTTGGTGTGGG + Intronic
1046381892 8:113461474-113461496 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1046382277 8:113466992-113467014 ATCTGCTGGTGCCCTGATTGTGG + Intergenic
1046407421 8:113791516-113791538 AGCTGCTGCTGCCGTGATGCTGG - Intergenic
1046738562 8:117804337-117804359 ATCTGCTGGTGCCTTGATCTGGG + Intronic
1046831657 8:118752756-118752778 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1046902370 8:119536959-119536981 ATCTGCTGGTGCCTTGGTCTCGG + Intergenic
1047183438 8:122611052-122611074 ATCTGCTGATGTCTTGATCATGG + Intergenic
1047373341 8:124274179-124274201 ATCTACTGGTGCCTTGATCTTGG + Intergenic
1047820692 8:128516864-128516886 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1047879977 8:129182396-129182418 ATCTCCTGGTGCCTTGATTTTGG - Intergenic
1047897203 8:129379943-129379965 ATCCGCTGGTGCCTTTCTGGGGG + Intergenic
1048366100 8:133740055-133740077 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1048382641 8:133880929-133880951 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1048602758 8:135935698-135935720 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1048642769 8:136382877-136382899 ATCTGCTTGTGCCTTGATCTTGG + Intergenic
1049111111 8:140644062-140644084 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1049744010 8:144255458-144255480 ATCTCCTGCGGCCTGGAGGGAGG + Intronic
1049978159 9:879742-879764 ATCTGCTGGTGCGTTCAAGGTGG + Intronic
1050103928 9:2146116-2146138 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1050149496 9:2605185-2605207 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1050320371 9:4446367-4446389 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1050511116 9:6396832-6396854 ACCTGCTGATGCCTTGATCTTGG + Intergenic
1050615524 9:7398133-7398155 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
1050755401 9:8996605-8996627 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1050971632 9:11883947-11883969 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
1051446622 9:17146619-17146641 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1051512104 9:17889490-17889512 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1051519966 9:17975361-17975383 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1051829621 9:21260960-21260982 ATCTGCAGGGGCCTTGATGTTGG + Intergenic
1051832127 9:21291308-21291330 ATCTGCAGGGGCCTTGATGTTGG + Intergenic
1051884265 9:21873575-21873597 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1052074421 9:24122754-24122776 ATCTGCGGGTGCCTTGATCCTGG + Intergenic
1052427793 9:28327176-28327198 TTCTGCTGCTGCCTTAATTTTGG + Intronic
1053359508 9:37474302-37474324 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1053442510 9:38127833-38127855 GTCTGGTGCTGCCTGGCTGGGGG + Intergenic
1054919512 9:70527925-70527947 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1055370570 9:75593849-75593871 ATCTACTGTTGCCTTGATCTTGG + Intergenic
1055990372 9:82099651-82099673 ATCTGGTGCTTCAATGATGGGGG + Intergenic
1056100291 9:83294265-83294287 ATCTGCTGGTGTCTTGATCTTGG + Intronic
1056255769 9:84798094-84798116 ATCTGCTGGTGCCTTGATATCGG - Intronic
1056335335 9:85563047-85563069 ATCTGCTGATGCCTTGATCTTGG + Intronic
1056693366 9:88826553-88826575 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1056782140 9:89558688-89558710 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1057056296 9:91963772-91963794 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1058032224 9:100212966-100212988 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1058404860 9:104661366-104661388 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1058528752 9:105885582-105885604 TTCGGCCGCAGCCTTGATGGAGG - Intergenic
1058735538 9:107890684-107890706 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1058849968 9:109002173-109002195 ATCTGTTGGTGCCTTGATCCTGG - Intronic
1059474483 9:114533532-114533554 ATCTGCTGATGCCCTGATCTTGG - Intergenic
1059507705 9:114814689-114814711 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1059541898 9:115138581-115138603 ATCTACTGCTGCCTTAATCTTGG + Intergenic
1059552886 9:115247737-115247759 TTCTGTGGCTGACTTGATGGAGG + Intronic
1059898818 9:118899278-118899300 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1060043315 9:120320345-120320367 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1060087905 9:120717993-120718015 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1060316739 9:122518378-122518400 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1060379074 9:123148349-123148371 ATCTGCTGAAGCCTTGATTTTGG + Intronic
1060500366 9:124149187-124149209 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1061035792 9:128113775-128113797 CTCCGCTGCTGGCTTGAAGGTGG + Intergenic
1061223762 9:129267967-129267989 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
1061266666 9:129509761-129509783 ATCTACTGCTGCCTTGATCTTGG - Intergenic
1061712107 9:132495357-132495379 ACCTGCACCTGCCTTGAGGGAGG + Intronic
1062264780 9:135681952-135681974 CTCTGCTGCAGCCTGCATGGGGG + Intergenic
1062689361 9:137833521-137833543 AGCTGCTGGGGCCTGGATGGAGG - Intronic
1062729548 9:138101467-138101489 GTCGGCTGCTTCCTTGATGCAGG - Intronic
1203715727 Un_KI270742v1:143736-143758 TACTGCTGCTGCCTTGAAAGCGG + Intergenic
1203535487 Un_KI270743v1:34490-34512 TACTGCTGCTGCCTTGAAAGCGG - Intergenic
1185542022 X:910127-910149 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
1185830649 X:3299671-3299693 ATTTCCTGCTGCCCTCATGGTGG + Intergenic
1186083707 X:5962858-5962880 ATCTTCTGCTGCCTTGATCTTGG + Intronic
1186170536 X:6871936-6871958 ATCTGCTGGTGCCTTAATTTTGG - Intergenic
1186194583 X:7098268-7098290 ACCTGCTGATGCCTTGATCTTGG - Intronic
1186364427 X:8876087-8876109 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1186683708 X:11902323-11902345 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1186696177 X:12034480-12034502 ATCTGCTGCTTCCTTCATCTGGG + Intergenic
1186987064 X:15028557-15028579 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1187081620 X:15995576-15995598 ATCTGCAGATGCCTTGATCTTGG + Intergenic
1187268441 X:17758834-17758856 ATCTGATGCTGCTTTCCTGGAGG + Intergenic
1187365410 X:18662131-18662153 ATCTGCTGGCACCTTGATCGTGG + Intronic
1187948354 X:24448156-24448178 ATCTGCTGGTGCCTTGACCTTGG - Intergenic
1188134079 X:26472494-26472516 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1188228411 X:27630788-27630810 ATCTGCTGGTGCCTTGAGCTTGG - Intronic
1188287152 X:28341568-28341590 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1188395970 X:29684232-29684254 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1188584549 X:31757536-31757558 ATCTGCTGATGTCTTGATCTTGG - Intronic
1189106121 X:38237398-38237420 ATCTGCTGGTGCCTTGATCCTGG + Intronic
1189255156 X:39632310-39632332 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1189287674 X:39863424-39863446 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1189351169 X:40276893-40276915 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1189515420 X:41709180-41709202 ATCAGCTGTTTCCTTGGTGGTGG - Intronic
1189526448 X:41827373-41827395 ATCTGCTGGTACCTTGATCTTGG - Intronic
1189815572 X:44821543-44821565 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1189963622 X:46349760-46349782 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1190073155 X:47295322-47295344 ATCTGCTGATGCCTTGGTCTTGG + Intergenic
1190153534 X:47968172-47968194 ATCAGCTGGTGCCTTGATCTTGG + Intronic
1190369827 X:49730016-49730038 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1190806162 X:53839198-53839220 ATCTGCTGTTGTTCTGATGGGGG + Intergenic
1191873883 X:65774125-65774147 ATCTGCTGGTGACTTGATGTTGG + Intergenic
1192705075 X:73520712-73520734 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1193052724 X:77118092-77118114 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1194205711 X:91008895-91008917 ATCTGCTGATGCCTTCATCTTGG - Intergenic
1194334712 X:92630865-92630887 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1194846198 X:98812224-98812246 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1195461668 X:105133679-105133701 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1195462773 X:105146073-105146095 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1195498302 X:105564022-105564044 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1195513496 X:105745080-105745102 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1196080811 X:111628427-111628449 ATCTGCTGTTGCCTTGATTTTGG + Intergenic
1196323206 X:114368739-114368761 ATCTGCTGGTGCATTGATATTGG - Intergenic
1196327170 X:114420141-114420163 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1196404079 X:115346303-115346325 GTCTGCTGATGCCTTGATCTGGG + Intergenic
1196541332 X:116911928-116911950 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1196580621 X:117374897-117374919 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1196731569 X:118946157-118946179 ATCTGCTATTGCCTTGGTCGTGG + Intergenic
1196813688 X:119648094-119648116 AACTGCTGCTGCCTAGCTTGGGG + Intronic
1196931279 X:120684269-120684291 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
1197969706 X:132102107-132102129 GTGTGGTGCTGCCTTGAGGGAGG - Intronic
1198180629 X:134204973-134204995 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1198195255 X:134353905-134353927 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1198301292 X:135336259-135336281 ATCTGCTGGTGCCTTGATTTTGG + Intronic
1198317181 X:135479776-135479798 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1198394222 X:136206645-136206667 AGCTGCTGCTGCCATGGTTGTGG - Intronic
1198787369 X:140303606-140303628 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1198792833 X:140364364-140364386 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1199049511 X:143220587-143220609 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1199211432 X:145215881-145215903 ACCTACTGGTGCCTTGATGTTGG + Intergenic
1199279844 X:145988473-145988495 ATCTGCTGTTGTCTTGATCTTGG + Intergenic
1199742411 X:150747990-150748012 ATCTGCTGGGGCCTTGATGTTGG - Intronic
1199766571 X:150945793-150945815 AGCTGGTGATGTCTTGATGGGGG + Intergenic
1199845039 X:151686669-151686691 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1200041070 X:153369927-153369949 CTCTGCTGATGCCTTGATCTTGG - Intergenic
1200052186 X:153439817-153439839 ACCTGCTGGTGCCTTGATCGTGG + Intergenic
1200551470 Y:4583706-4583728 ATCTGCTGATGCCTTCATCTTGG - Intergenic
1200643190 Y:5747918-5747940 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1201687775 Y:16726263-16726285 ATCTGTTGCTACCTTCAGGGTGG + Intergenic