ID: 1100576759

View in Genome Browser
Species Human (GRCh38)
Location 12:95899091-95899113
Sequence CTTCCTATTGGAGGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100576759_1100576767 29 Left 1100576759 12:95899091-95899113 CCAGCTTCTCCTCCAATAGGAAG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1100576767 12:95899143-95899165 CATGCCAGTGATGCATTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 145
1100576759_1100576766 28 Left 1100576759 12:95899091-95899113 CCAGCTTCTCCTCCAATAGGAAG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1100576766 12:95899142-95899164 CCATGCCAGTGATGCATTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100576759 Original CRISPR CTTCCTATTGGAGGAGAAGC TGG (reversed) Intronic
903837689 1:26216194-26216216 CTTCCTGTTAGAGAAGAAGGAGG + Intergenic
905888065 1:41502287-41502309 CTTCCTATGGAAAGAGAATCTGG - Intergenic
908246763 1:62233532-62233554 CTTCCTTTTTGCGGAGGAGCGGG + Intergenic
909301636 1:74020154-74020176 CTTCTGATGGCAGGAGAAGCTGG + Intergenic
910126343 1:83846842-83846864 TTCCATATGGGAGGAGAAGCAGG + Intergenic
911447388 1:98014644-98014666 CTGCCTAATGGGGGACAAGCAGG - Intergenic
912657692 1:111502627-111502649 CTTATTATTTTAGGAGAAGCAGG - Intronic
915921382 1:159978230-159978252 CTTCTTCTTGGAGGACAAGGTGG - Intergenic
918296823 1:183165081-183165103 CCTCCTTTTGGAGGAGGGGCAGG + Intergenic
918309376 1:183274883-183274905 CTTCCTATTGTAGGGAAAGTTGG - Intronic
919940842 1:202284956-202284978 CTTCCCTTTGGAGGAGAGCCTGG + Intronic
920116758 1:203627019-203627041 CTTCCCATTGGAGGGGCAGGGGG + Exonic
920272078 1:204773237-204773259 CTTCCCTTTGGGGAAGAAGCAGG + Intergenic
921506001 1:215971280-215971302 TATCATATTGGAGGAGAAACTGG + Intronic
1064553370 10:16523710-16523732 CTTCCTTTTGGAGGACAAAATGG + Intergenic
1064921161 10:20519980-20520002 CATCCTTTTGGAGGAAAAGTGGG - Intergenic
1067022627 10:42814951-42814973 CTTCCTATTGGATGAGGTCCAGG + Intronic
1067261549 10:44697623-44697645 CATCTTAATGGGGGAGAAGCTGG - Intergenic
1069097325 10:64274930-64274952 CTGCATATTAGAGGAGAAGCAGG + Intergenic
1069718544 10:70535707-70535729 GACCCTATTGAAGGAGAAGCAGG - Intronic
1069722144 10:70556641-70556663 CTTCCCATTGTAGGGCAAGCTGG + Intronic
1069777827 10:70937086-70937108 CTTGATCTTGAAGGAGAAGCAGG + Intergenic
1072963929 10:99955304-99955326 CCTCATGCTGGAGGAGAAGCAGG - Exonic
1075177308 10:120177370-120177392 CCTCCTGTTTGATGAGAAGCAGG + Intergenic
1075851744 10:125593960-125593982 CTTCCTAGTGGAGGTGACACAGG + Intronic
1076257594 10:129040566-129040588 CTTCATAGAGGAGGAGAAGCTGG - Intergenic
1077112156 11:866642-866664 CGTCCTTTTGGCAGAGAAGCGGG - Exonic
1079186262 11:18240091-18240113 CTTCATAGGGGAGGAGAAGATGG + Intronic
1079492697 11:21006971-21006993 CTACCTGTTGGAGGGGTAGCTGG + Intronic
1082015452 11:47482916-47482938 CTTCCTTTTGGATGACATGCAGG + Intronic
1082212280 11:49519770-49519792 CTTCCTTTTATAGGAGATGCAGG - Intergenic
1085304570 11:75477786-75477808 CTTCCTCCTGCAGGACAAGCTGG - Exonic
1086924551 11:92626054-92626076 CATCCTAATGGAGGATTAGCTGG + Intronic
1087768924 11:102185834-102185856 CTTTTTAGTGGAGAAGAAGCAGG + Intronic
1088316624 11:108513504-108513526 CTTCTCATTGGATGAGAGGCAGG + Exonic
1092081117 12:5717242-5717264 CTACCAGTTGGAGGACAAGCTGG + Intronic
1094870093 12:34593118-34593140 CTTTCTATTGAAGGAGCAGTTGG + Intergenic
1094877009 12:34659720-34659742 CTTCCTTTTGAAGGAGCAGTTGG + Intergenic
1095047989 12:37532089-37532111 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1095482044 12:42646332-42646354 CTTCCTCATGGAGGAAAACCAGG - Intergenic
1095629932 12:44363998-44364020 CCTCTTGCTGGAGGAGAAGCTGG - Intronic
1096562547 12:52447205-52447227 CTTCCTGCTGGAGGAGGAGGTGG + Exonic
1096564718 12:52469077-52469099 CTTCCTGCTGGAGGAGGAGGTGG + Exonic
1096566638 12:52487735-52487757 CTTCCTGCTGGAGGAGGAGGTGG + Exonic
1098541469 12:71663069-71663091 CCTCCTCTGGGAGGAGGAGCAGG - Exonic
1100576759 12:95899091-95899113 CTTCCTATTGGAGGAGAAGCTGG - Intronic
1101648587 12:106654098-106654120 CTTTCTACAGGTGGAGAAGCTGG - Intronic
1102260781 12:111442225-111442247 CTTCTTACTGGAGGAGGAGAGGG - Intronic
1103977971 12:124716078-124716100 GTTCCTAGTGGTGAAGAAGCTGG - Intergenic
1104070138 12:125337507-125337529 CTTCTTCTTGAAAGAGAAGCAGG - Intronic
1106491383 13:30226568-30226590 ATGCCTATTGGAGGATTAGCTGG + Intronic
1107434841 13:40373067-40373089 CTTCCAACTTGAAGAGAAGCAGG - Intergenic
1111726435 13:92015453-92015475 TTTCCTTTTGTAGGAGAAGAGGG - Intronic
1112374819 13:98829496-98829518 CTTCACATCAGAGGAGAAGCTGG + Exonic
1113319235 13:109215684-109215706 CTTCCTTTTAGGGGAGAAGAGGG + Intergenic
1113435776 13:110289922-110289944 CATCCTCATGGAGGACAAGCAGG + Intronic
1117722396 14:58640061-58640083 CTTCCTATTGCTGGAAAAACGGG - Intronic
1119145595 14:72310841-72310863 CTGACTATTGTGGGAGAAGCTGG - Intronic
1119890229 14:78176985-78177007 CTTCCTGGGGGAGGAGAAACTGG + Intergenic
1121095766 14:91217078-91217100 GCCCCTCTTGGAGGAGAAGCTGG + Intronic
1121444581 14:93970413-93970435 CTTCCTGGTAGAGGAGATGCTGG - Intronic
1122384909 14:101337811-101337833 TTTCCTCTTGGAGCAGAGGCTGG - Intergenic
1123007664 14:105332237-105332259 CTCCCCATGGAAGGAGAAGCAGG - Intronic
1123115407 14:105892173-105892195 CTGGCTCTGGGAGGAGAAGCAGG - Intergenic
1123423735 15:20151831-20151853 CTTCCTATTGGATGAGGTCCAGG + Intergenic
1123532957 15:21158352-21158374 CTTCCTATTGGATGAGGTCCAGG + Intergenic
1126346978 15:47705910-47705932 CTTCATTCTGGAGAAGAAGCAGG - Intronic
1126386667 15:48100499-48100521 CTGGCTATTGGAGGAGAAAGAGG - Intergenic
1126897202 15:53271826-53271848 CTTACCACTGGAGGAGAGGCAGG - Intergenic
1128336131 15:66786872-66786894 CTGGCACTTGGAGGAGAAGCGGG - Intergenic
1129077617 15:73010750-73010772 CTACCTTTTGAAGGAGAACCTGG + Intergenic
1129206585 15:74040774-74040796 CTTGTTAATGGAGGAGAGGCTGG - Intronic
1129426080 15:75464056-75464078 CTTCCAATTGGAGGAAAAGCAGG - Exonic
1129467733 15:75733287-75733309 CTTCCTACTGGAGGAGACCCTGG - Intergenic
1129719484 15:77870299-77870321 CTTCCTACTGGAGGAGACCCTGG + Intergenic
1129878221 15:78990826-78990848 GTCCCTCTAGGAGGAGAAGCGGG - Intronic
1130402908 15:83573992-83574014 CTTCTCAGAGGAGGAGAAGCTGG + Intronic
1130889069 15:88117991-88118013 GTTCCTCATGGAGGATAAGCTGG - Intronic
1131956990 15:97747523-97747545 CTTCCTATTGGAAGAGCCACGGG - Intergenic
1132534400 16:470647-470669 TTTCCTACAGGAGGAGAGGCAGG + Intronic
1136861089 16:33703774-33703796 CTTCCTATTGGATGAGGTCCAGG - Intergenic
1139200487 16:64971457-64971479 CTTCCTGTTGAAGAAGAAACCGG - Intronic
1140760722 16:78106313-78106335 ATTCATTTTGAAGGAGAAGCAGG + Intronic
1141734849 16:85845494-85845516 CTTCCTCCCGGTGGAGAAGCTGG - Intergenic
1141809589 16:86366297-86366319 CTTTCTTTTAGAGGAGAGGCAGG + Intergenic
1203122585 16_KI270728v1_random:1551964-1551986 CTTCCTATTGGATGAGGTCCAGG - Intergenic
1203141218 16_KI270728v1_random:1768038-1768060 CCCCCTATTGGAGGAAAAACAGG - Intergenic
1143191689 17:5044615-5044637 GTCCCTATTAGAGGAGAATCTGG - Intronic
1143693457 17:8590811-8590833 ATTCCTAGAGGAGGTGAAGCTGG - Intronic
1145065667 17:19759792-19759814 CTGCCTGCTGGAGGAGAAGCGGG + Intergenic
1145365686 17:22265385-22265407 ATTCCTATAGGATGAAAAGCAGG + Intergenic
1145366062 17:22267863-22267885 ATTCCTATAGGATGAGTAGCAGG + Intergenic
1145411259 17:22668263-22668285 ATTCCTATAGGATGAGAAGCAGG + Intergenic
1146279880 17:31538113-31538135 GTTCCTTTTGGGGCAGAAGCAGG - Exonic
1147186018 17:38713429-38713451 CTCCCCATGGGAGGAGAACCTGG + Intronic
1148238138 17:45983054-45983076 CCTCCTGTTGGAGGAGGCGCTGG - Intronic
1149222777 17:54435531-54435553 CTTTCTAATGTAGGAGAGGCTGG + Intergenic
1150450545 17:65263527-65263549 CTTGTTGTTGGAGGAGAAGGAGG - Intergenic
1150839381 17:68593929-68593951 CTTCCCAAAGGAGGAAAAGCTGG + Intronic
1151502184 17:74497667-74497689 CTTCCTGTTGGAGCAGAAAGGGG + Intergenic
1152540632 17:80972632-80972654 CTTCCAGTTAGGGGAGAAGCTGG - Intergenic
1152565322 17:81097745-81097767 CTTCCTGGCAGAGGAGAAGCTGG + Intronic
1153802765 18:8685629-8685651 CTTTCTTTAGGATGAGAAGCAGG + Intergenic
1154496127 18:14962846-14962868 CTTCCGGGTGGAGGAGCAGCAGG + Intergenic
1157364726 18:47054179-47054201 CTTCCTCTGTGAGGAGATGCTGG + Intronic
1160190862 18:76713116-76713138 CTTCCTGGTGGTGGAGAACCCGG + Intergenic
1162883857 19:13681578-13681600 CTTCCTATTGCATCAGAATCAGG - Intergenic
1163284489 19:16338009-16338031 CTTCCCAGTGGAGGTGATGCCGG - Intergenic
1163777432 19:19226661-19226683 CCTGATTTTGGAGGAGAAGCAGG + Exonic
1164511585 19:28901512-28901534 CTTCCTGTTGGAGCAGAAGTGGG - Intergenic
1164521967 19:28986278-28986300 ATTTCTGTTGGAGGAGATGCTGG - Intergenic
1165317036 19:35062551-35062573 CTTCCTTTTGGATTAAAAGCAGG + Intronic
1165391513 19:35541875-35541897 CTTCCTATTGCAGGAGCTGAGGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166882917 19:45940141-45940163 CTTCCTGACGGCGGAGAAGCTGG - Exonic
1167463391 19:49638132-49638154 CTTCCCCTGGGAGGAGACGCTGG - Intronic
928862049 2:35870664-35870686 CTTCCTATTGGAAGAAAGGCTGG - Intergenic
931256094 2:60574220-60574242 CTTCCTAGAGGTGGAGAAGAGGG - Intergenic
932179232 2:69630903-69630925 CTTGGTATTGGAGGGGAAGGGGG - Intronic
933703136 2:85270240-85270262 TCCCCTATGGGAGGAGAAGCTGG - Intronic
935626413 2:105175633-105175655 CTCCTTCTTGGAAGAGAAGCAGG - Intergenic
945576480 2:211536428-211536450 CTTCCCATTGGGGAAGAGGCAGG + Intronic
946557008 2:220869733-220869755 CTTCTTATTGGTGGAGAGGTTGG - Intergenic
946772459 2:223102469-223102491 CTTCCTGTTTGAGGAGAAAATGG + Intronic
947946325 2:234106062-234106084 CATTCTCTTGGGGGAGAAGCTGG - Intergenic
948134724 2:235628082-235628104 CTTCCAGTGGGAGGAGAAGGGGG + Intronic
949036434 2:241817629-241817651 CTTCCTGCTGGAGGAGTAGGAGG + Intergenic
1169004878 20:2198471-2198493 ATTCCCAGTGGAGGAGAGGCAGG + Intergenic
1171360504 20:24583447-24583469 CTTCCTCTTGGAGGAGGCCCTGG - Intronic
1171542535 20:25975557-25975579 ATTTCTATAGGATGAGAAGCAGG + Intergenic
1171798522 20:29584968-29584990 ATTCCTATAGGATGAGAAGCAGG - Intergenic
1171845571 20:30272205-30272227 ATTCCTATAGGATGAGAAGCAGG + Intergenic
1175995916 20:62812317-62812339 CTTCTTCCTGGAGGAGACGCTGG + Exonic
1181356743 22:22301552-22301574 CTTCCTATTGGATGAGGTCCAGG + Intergenic
1181960337 22:26617991-26618013 CTTCCTGCTGGAGGACAGGCAGG + Exonic
1184473163 22:44707261-44707283 CTTCCCACTGGAGGAGGAGGAGG + Intronic
952271095 3:31832256-31832278 CTGCTTATTTGTGGAGAAGCAGG + Intronic
952929983 3:38352296-38352318 TTTCCTAATGGAGGACAACCCGG - Intronic
957816036 3:85298300-85298322 CTTCCTATAGGAGGCAAATCTGG - Intronic
959946184 3:112127844-112127866 CTTCCAATTTGATGAGAAACAGG - Intronic
960409189 3:117301304-117301326 CTTCCTATGGGAGTAGTAGCAGG - Intergenic
961041752 3:123683011-123683033 CTTCCTCATGGAGGGCAAGCAGG + Intronic
961741702 3:129037057-129037079 GTCCCTGCTGGAGGAGAAGCTGG + Exonic
962172267 3:133114109-133114131 CTTCCAATTAGAGGGGCAGCTGG + Intronic
962489045 3:135873039-135873061 TTCCCTATTGTGGGAGAAGCTGG - Intergenic
963851717 3:150216392-150216414 CTGCCTTGTGGAGGGGAAGCAGG + Intergenic
964868797 3:161290675-161290697 CTTGTTGTTGTAGGAGAAGCTGG + Intergenic
967874278 3:194256170-194256192 CTGCCTCTTGGAGCAGAAGGCGG + Intergenic
967892080 3:194370635-194370657 CTCCATCTCGGAGGAGAAGCCGG - Intergenic
969411273 4:7029948-7029970 CTTCCTGGTGGAGGAGGAACAGG + Intronic
970696761 4:18686873-18686895 ATTCTCTTTGGAGGAGAAGCTGG - Intergenic
976124678 4:81820622-81820644 CTTCCTATTGCAGGGCAAGATGG - Intronic
976731443 4:88266364-88266386 CTTCCAAGTGGAGGTGATGCTGG + Intronic
976749604 4:88440747-88440769 CTTTCTATTGGTGGAGCTGCTGG + Intronic
977055477 4:92185018-92185040 TTTCCATTTGGAGGAGAGGCAGG - Intergenic
979848842 4:125551551-125551573 TGGCCTATTGGAGGAGTAGCAGG + Intergenic
982280456 4:153679365-153679387 CTTCCCCTTTGAGAAGAAGCAGG + Intergenic
982619635 4:157688309-157688331 CTTACTATTGGAAATGAAGCAGG - Intergenic
985645943 5:1084822-1084844 TGTCCTTTTGGAGGAGCAGCTGG - Intronic
988394766 5:30682662-30682684 CCTCCTCTTGGCAGAGAAGCAGG + Intergenic
988973722 5:36494694-36494716 CTTGCTATAGGATGAGAACCTGG + Intergenic
991609788 5:68438124-68438146 CTTCCTATTTGATGATAAACTGG - Intergenic
991970346 5:72135056-72135078 CTTCCTATTGCGGGAGGGGCTGG - Intronic
993074376 5:83209934-83209956 CTTCCTGTTGGTTAAGAAGCAGG - Intronic
993118398 5:83744994-83745016 CTTCCTCTTGCATGACAAGCTGG - Intergenic
996137423 5:119861134-119861156 CTTCTTGTTGGATGAGAAGAAGG + Intergenic
998208165 5:140174547-140174569 CTTCCTGTTGGAACAGAAGAAGG + Intergenic
999304063 5:150508474-150508496 ATTCCTGATGGAGGAGAAGGAGG + Intronic
999408408 5:151327365-151327387 ATTGCTATAGGAGTAGAAGCAGG - Intronic
1000185496 5:158854046-158854068 CCTCCTATTTGAAGAGAAGCTGG + Intronic
1000335277 5:160237497-160237519 CTGTCTATTGGTGGAGAAGTGGG - Intronic
1002456912 5:179350512-179350534 CTCCCTTCTGGAGGAGAAGTGGG - Intergenic
1002616734 5:180460891-180460913 CTGCCTATGGGAGGCCAAGCTGG + Intergenic
1004898014 6:20167964-20167986 CTTCCTACTGGAGGATGTGCAGG - Intronic
1005499082 6:26414280-26414302 CTTCCTATGGGGGAAGAAACAGG - Exonic
1005626953 6:27671451-27671473 TTTCCTTTTGGACGAGAAGAGGG - Intergenic
1006166262 6:32067586-32067608 GTCCCTAGTGGAGGAGATGCTGG + Intronic
1010425676 6:75726480-75726502 CATCCTTTTGGAAAAGAAGCTGG - Intergenic
1011165051 6:84437367-84437389 ATCCCTAATGGAGTAGAAGCCGG + Intergenic
1013237857 6:108214558-108214580 CTTCCTTTTAGAGGAGATGATGG - Exonic
1013527260 6:110986007-110986029 CTTCATTTTGAAGGAGAAGTTGG + Intronic
1014199577 6:118593778-118593800 CTTGCTGTTGAAGTAGAAGCTGG - Intronic
1014272217 6:119348597-119348619 CATCCTACTGGAGAAGAAGAAGG - Exonic
1014916268 6:127152564-127152586 CTTTCTATTGGATGAGTAGTGGG - Intronic
1017281684 6:152632590-152632612 CTACCTATTGGAGGAGAGTGTGG + Intronic
1018344778 6:162888861-162888883 CTTCCTATTTGGGCAGCAGCTGG - Intronic
1018877984 6:167842625-167842647 CATCCTAGTGGAGGAGAGGAAGG - Intronic
1019621292 7:1993576-1993598 CTGTTTTTTGGAGGAGAAGCAGG + Intronic
1021967996 7:25940985-25941007 CTTTCTGTTGGTGGAGAGGCTGG - Intergenic
1022981630 7:35610227-35610249 CTGCCTTTGGGAGGAGAAGAAGG + Intergenic
1023078531 7:36506352-36506374 CCTCTTGTTGGAGGAGAAGCAGG + Intergenic
1024213891 7:47230024-47230046 CTTCCTATTGGCTGGGAAGTAGG - Intergenic
1025021670 7:55485254-55485276 GTTCCCTGTGGAGGAGAAGCTGG - Intronic
1025293903 7:57760657-57760679 ATTCCTATAGGATGAGAAGAAGG + Intergenic
1025810165 7:64870466-64870488 CTTCCTGGTGGAGCAGAACCGGG + Intronic
1025812007 7:64881523-64881545 ATTCCTGTAGGATGAGAAGCAGG + Intronic
1032865561 7:135920764-135920786 CTTCCTGCTGGAGGAGGAGAAGG - Intergenic
1035306530 7:157936596-157936618 CTTCCGAGTGGAGGAGACACGGG - Intronic
1035306556 7:157936712-157936734 CTTCCGAGTGGAGGAGACACGGG - Intronic
1038843155 8:31204741-31204763 CTTCCCAGTGGGGGAGAAGTAGG + Intergenic
1045490707 8:102666849-102666871 CTGCCTACTGGAGGTGAGGCCGG - Intergenic
1047271969 8:123369112-123369134 CTTGGTCTTGCAGGAGAAGCTGG + Exonic
1047674140 8:127181750-127181772 CTACCTCTTGGTGGATAAGCTGG + Intergenic
1047681538 8:127258761-127258783 CTTCTAAGTGGAGGAGAAGAGGG - Intergenic
1051506638 9:17834397-17834419 CTTCCTATTTCAGGAAAATCTGG - Intergenic
1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG + Intronic
1052503690 9:29325490-29325512 CTTCCAAATGGAAGAGAAGGGGG + Intergenic
1053158710 9:35798696-35798718 TTTCCTGTTGGAGCAGAAGTTGG + Intronic
1053689962 9:40580721-40580743 CTTCCTATTGGATGAGGTCCAGG - Intergenic
1054162506 9:61683641-61683663 ATTCCTATAGGATGAGAAGCAGG - Intergenic
1054301210 9:63381665-63381687 CTTCCTACTGGATGAGATCCAGG - Intergenic
1056278127 9:85013269-85013291 CTTCCCCTTGGAGAAGAACCTGG - Intronic
1056299270 9:85225199-85225221 ATGCCTCTTGGAGGAGAATCCGG + Intergenic
1056870498 9:90272920-90272942 CATCCTTGTGGGGGAGAAGCTGG + Intergenic
1058226578 9:102371696-102371718 CTTTCAATTTGAGGAGAAGAGGG - Intergenic
1058733036 9:107868596-107868618 CTTCCCATGGGAGGATAAGGAGG + Intergenic
1060942170 9:127549107-127549129 GTTCTTATTGGAACAGAAGCTGG - Intronic
1062425436 9:136504023-136504045 CTTGCAGTTGGAGGAGGAGCTGG - Intronic
1185552826 X:997720-997742 CCCCCTATTGGAGGAAAAGCAGG + Intergenic
1192359000 X:70426663-70426685 CTTCATATTGGAGCAGCCGCTGG + Exonic
1192695556 X:73411807-73411829 GTTCCCATTCCAGGAGAAGCAGG + Intergenic
1196666371 X:118321378-118321400 CTTCTTCTTGGAGGACAATCTGG + Intergenic
1200696373 Y:6364654-6364676 ATTCCTATAGGATGAGAAACAGG - Intergenic
1200696984 Y:6369613-6369635 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200700239 Y:6395966-6395988 ATTCCTTTAGGATGAGAAGCAGG - Intergenic
1200700553 Y:6398593-6398615 ATTCCTGTAGGAGGAGAAGCAGG - Intergenic
1200703280 Y:6420368-6420390 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200706149 Y:6444278-6444300 ATTCCTGTAGGAGGAGAAGCAGG - Intergenic
1200707099 Y:6452381-6452403 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200707739 Y:6457140-6457162 ATACCTGTAGGAGGAGAAGCAGG - Intergenic
1200911280 Y:8533536-8533558 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1200913376 Y:8550418-8550440 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1200915823 Y:8570332-8570354 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1200921778 Y:8619689-8619711 ATTCCTGTAGGAGGAGAAGCAGG + Intergenic
1200924410 Y:8641663-8641685 ATTCCTGTTGGATGAGAAGCAGG + Intergenic
1200929796 Y:8686706-8686728 ATTCCTGTGGGATGAGAAGCAGG - Intergenic
1200931028 Y:8697234-8697256 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200931312 Y:8699559-8699581 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200931918 Y:8704580-8704602 ATTTCTTTTGGATGAGAAGCAGG - Intergenic
1200933750 Y:8720493-8720515 ATTCCTTTAGGATGAGAAGCAGG - Intergenic
1200934660 Y:8727791-8727813 ATTCCTGTTGGATGAGTAGCAGG - Intergenic
1200938540 Y:8759434-8759456 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200938960 Y:8762833-8762855 TTTCCTGTGGGATGAGAAGCAGG - Intergenic
1200939592 Y:8767824-8767846 GTTCCTATAGGATGAGAAGCAGG - Intergenic
1200960696 Y:8993335-8993357 ATTCCTGTAGGAGGAGAAGCAGG + Intergenic
1200961828 Y:9002944-9002966 ATTCCTGTAGGATGAGAAGCTGG + Intergenic
1200962773 Y:9010354-9010376 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1200981141 Y:9264240-9264262 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200984767 Y:9293199-9293221 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1200985117 Y:9295672-9295694 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1201026373 Y:9707568-9707590 ATACCTGTAGGAGGAGAAGCAGG + Intergenic
1201027013 Y:9712327-9712349 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1201027962 Y:9720430-9720452 ATTCCTGTAGGAGGAGAAGCAGG + Intergenic
1201030830 Y:9744339-9744361 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1201033559 Y:9766105-9766127 ATTCCTGTAGGAGGAGAAGCAGG + Intergenic
1201033872 Y:9768732-9768754 ATTCCTTTAGGATGAGAAGCAGG + Intergenic
1201037129 Y:9795086-9795108 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1201037741 Y:9800046-9800068 ATTCCTATAGGATGAGAAACAGG + Intergenic
1201038217 Y:9804112-9804134 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1201424797 Y:13836265-13836287 CTAGCTATTGGAAGTGAAGCAGG + Intergenic
1202125674 Y:21566988-21567010 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1202128964 Y:21593099-21593121 ATTCCTGTAGGAGGAGAAGAAGG + Intergenic
1202150636 Y:21840835-21840857 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1202153334 Y:21862404-21862426 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1202176981 Y:22106986-22107008 GTTCCTCTAGGATGAGAAGCAGG - Intergenic
1202177984 Y:22115160-22115182 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1202179408 Y:22126747-22126769 ATTCCTGTAGGATGAGAAGCAGG - Intergenic
1202180559 Y:22136227-22136249 ATTCCTGTAGGATGAGAAGCTGG - Intergenic
1202181494 Y:22143605-22143627 ATTCCTGTAGGAAGAGAAGCAGG - Intergenic
1202209866 Y:22442795-22442817 ATTCCTGTAGGAAGAGAAGCAGG + Intergenic
1202210801 Y:22450172-22450194 ATTCCTGTAGGATGAGAAGCTGG + Intergenic
1202211953 Y:22459647-22459669 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1202213377 Y:22471235-22471257 ATTCCTGTAGGATGAGAAGCAGG + Intergenic
1202214380 Y:22479398-22479420 GTTCCTCTAGGATGAGAAGCAGG + Intergenic