ID: 1100577186

View in Genome Browser
Species Human (GRCh38)
Location 12:95903892-95903914
Sequence GCTTCACAGCATGAGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 559}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100577186 Original CRISPR GCTTCACAGCATGAGTTGTG AGG Intronic
901197429 1:7447959-7447981 GCTTCAGAGCATGGGCTCTGAGG - Intronic
902221426 1:14968382-14968404 GCTGCACAGCAGGAGGTGAGGGG - Intronic
902942349 1:19809535-19809557 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
905027068 1:34858005-34858027 GCTGCACAGCAGGAGGTGAGCGG - Intronic
905312951 1:37063281-37063303 GCTTCACACTCTGGGTTGTGAGG + Intergenic
906805158 1:48773640-48773662 GCTACACAGCATGATTTGGAAGG - Intronic
907614189 1:55907122-55907144 GCTACACAGCAGGAGGTGAGTGG + Intergenic
907828022 1:58037419-58037441 GCTGCACAGCAGGAGATGAGTGG + Intronic
907977322 1:59444592-59444614 GCTGCACAGCATGAGGTGGGCGG + Intronic
908667405 1:66508772-66508794 CCTGGAGAGCATGAGTTGTGTGG + Intergenic
908792642 1:67798167-67798189 GCTGCACAGCATGAGGTGAGCGG + Intronic
909329359 1:74393950-74393972 GCTGCACAGCAGGAGATGAGTGG - Intronic
909346227 1:74590680-74590702 GCTGCACAGCAGGAGGTGAGTGG - Intronic
910228785 1:84964909-84964931 GCTGCACAGCAGGAGGTGAGTGG - Intronic
910415372 1:86991978-86992000 GCTGCACAGCAGGAGGTGAGTGG + Intronic
910537221 1:88312135-88312157 GCAGTACAGCATGAGTTGTTAGG + Intergenic
910590244 1:88922449-88922471 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
911625972 1:100124963-100124985 GCTGCACAGCAGGAGGTGAGTGG - Intronic
912062568 1:105690856-105690878 GCTACACAGCATGAGGTGAGTGG + Intergenic
912140665 1:106721997-106722019 GTTTCACAGCAGCAGTAGTGTGG + Intergenic
913183237 1:116343034-116343056 GTTTCACAGCATGAAGTTTGTGG + Intergenic
913363346 1:118006851-118006873 GCTCAACATCATTAGTTGTGAGG - Intronic
914319865 1:146548729-146548751 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
914724479 1:150316178-150316200 GCTCCACAGCATTAGTTATTAGG - Intergenic
914994437 1:152529732-152529754 GCCTCATAGAATGAGTTGGGAGG + Intronic
915708297 1:157868595-157868617 GCTGCACAGCAGGAGTTGAATGG - Intronic
915962046 1:160275074-160275096 GCCTCACAGCAGGAGGTGAGTGG + Intergenic
916619248 1:166477960-166477982 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
916653351 1:166850605-166850627 GCTGCACAGCAGGAGGTGAGCGG + Exonic
916705655 1:167346711-167346733 GCTGCACAGCAGGAGGTGAGTGG - Intronic
917031902 1:170702210-170702232 GCCACACAGCAGGAGGTGTGAGG - Intronic
917347925 1:174048053-174048075 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
917489640 1:175487326-175487348 GCTGCACAGCAGGAGGTGAGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917562666 1:176175604-176175626 GCTGCACAGCAGGAGGTGAGGGG - Intronic
917689462 1:177452728-177452750 GCTCCACAGAATGAGTTGATTGG + Intergenic
917850599 1:179060421-179060443 GTTGCACAGCATGAGGTGAGGGG + Intronic
918626239 1:186658947-186658969 AGTTCAGAGCATGAGCTGTGAGG - Intergenic
919615253 1:199799283-199799305 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
920159910 1:203988730-203988752 GCTTCGACGTATGAGTTGTGGGG - Intergenic
921078159 1:211716380-211716402 GGTTCCCAGCATGAGTGCTGTGG - Intergenic
922010187 1:221575542-221575564 GCTGCACAGCAGGAGGTGAGGGG + Intergenic
922501638 1:226101198-226101220 GCGGCACAGCAGGAGTTGAGCGG + Intergenic
922745596 1:228041662-228041684 GCTTGACAACATGAGCTCTGAGG - Intronic
922971471 1:229744499-229744521 GCTTCATAGAATAAGTTATGGGG + Intergenic
923619466 1:235566268-235566290 GCTGCACAGCAGGAGGTGAGCGG + Intronic
924568552 1:245218152-245218174 GATTCCCAGCCTGAGTTCTGGGG - Intronic
924918680 1:248602803-248602825 GCTTATCAGCTTGAGTTCTGGGG - Intergenic
1063356032 10:5399268-5399290 GATTCAACGCATGAATTGTGGGG - Intronic
1063506161 10:6601632-6601654 GCTTCACAGCAGAAGGTGAGTGG - Intergenic
1064020292 10:11803788-11803810 GCCTCACAGCATGGGGTGAGTGG - Intergenic
1064871921 10:19946925-19946947 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1065715365 10:28561707-28561729 GCTTCACAGCAGGAGGTGAGCGG + Intronic
1068814639 10:61295899-61295921 GCTTCAGAGCACCAGTGGTGGGG - Intergenic
1068959200 10:62849671-62849693 GCTACACAGCAGGAGGTGAGTGG + Intronic
1071199489 10:83203023-83203045 GCTTCACAGAATGAGTTAGGGGG + Intergenic
1073232323 10:101982559-101982581 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1073610376 10:104937223-104937245 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1073699205 10:105906636-105906658 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1073746871 10:106479180-106479202 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1073921594 10:108466089-108466111 CCCGCACAGCAGGAGTTGTGAGG - Intergenic
1074069829 10:110055457-110055479 GTTTCACAGCATAAGTTATTTGG + Intronic
1074279208 10:112035131-112035153 GCTTCACAGCAGGAGGTGAGTGG - Intergenic
1074410587 10:113224876-113224898 GCTTCAGAGACTGAGTTGGGAGG - Intergenic
1074744042 10:116513683-116513705 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1074916929 10:117966134-117966156 TCTTCACAGCAGGACTTGTCAGG + Intergenic
1075291422 10:121234376-121234398 GCTGCACAGCCTGAGGTGAGTGG - Intergenic
1076703419 10:132286413-132286435 GCCTCACAAAATGAGTTGAGCGG - Intronic
1077426475 11:2481552-2481574 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1077659460 11:4054452-4054474 GCTGCACAGCAGGAGATGAGTGG + Intronic
1077901565 11:6494093-6494115 GCTACACAGCAGGAGGTGAGTGG + Intronic
1077963153 11:7096883-7096905 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1078380496 11:10835678-10835700 GCTGCACAGCAGGAGGTGAGGGG + Intronic
1078826344 11:14934366-14934388 GCCTCACAGCAGGAGGTGAGTGG - Intronic
1079357978 11:19745835-19745857 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1080832005 11:35903589-35903611 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1081049482 11:38319824-38319846 GCTTTACAGAATGAGTTTGGAGG - Intergenic
1081273278 11:41114309-41114331 GCTTCATAGCATCAGCTGTCTGG - Intronic
1081559962 11:44204592-44204614 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1084331570 11:68433509-68433531 GCTTCAAAGCAGAAGTTGAGAGG - Intronic
1084401900 11:68949024-68949046 GCCTCACAGCAGGAGGTGAGTGG + Intergenic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1084698968 11:70773724-70773746 GCTTCACATCATTAGTTATTAGG + Intronic
1084956870 11:72696317-72696339 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1086508553 11:87530510-87530532 GCTATACAGCCTGAGTTTTGTGG + Intergenic
1086801883 11:91185877-91185899 GCTGTACAGCAGGAGGTGTGCGG - Intergenic
1087060557 11:93972976-93972998 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1088266512 11:107992723-107992745 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1088471401 11:110191074-110191096 GCTTCATAGAATGAGTTAGGGGG - Intronic
1088974543 11:114803988-114804010 GCTTCAAAATATGAGTTATGGGG + Intergenic
1089095143 11:115913819-115913841 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1089181349 11:116585001-116585023 GCTACACAGCAGGAGGTGAGGGG + Intergenic
1089941799 11:122426233-122426255 GCTTCACTGCATGAGTCAAGTGG - Intergenic
1090194848 11:124805952-124805974 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1090892066 11:130932515-130932537 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1091634259 12:2185412-2185434 GCTTCAACACATGAGTTTTGGGG - Intronic
1091643774 12:2257588-2257610 GCTGCACAGCAGGAGATGAGCGG - Intronic
1092275316 12:7056442-7056464 GCTTCAAAGACTGAGTTCTGAGG - Intronic
1092496959 12:9005932-9005954 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1092766091 12:11854328-11854350 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1092776189 12:11946824-11946846 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1092781114 12:11988327-11988349 GCCGCACAGCAGGAGGTGTGAGG - Intergenic
1092833880 12:12470022-12470044 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1093065890 12:14657552-14657574 GCTGCACAGCAGGAGGTGAGAGG + Intronic
1093208179 12:16276187-16276209 ACTTCACAGCTTTAGTTCTGTGG - Intronic
1093810799 12:23490176-23490198 GCTTCACAGCAGGAGATGAGTGG + Intergenic
1093832270 12:23776826-23776848 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1094242771 12:28247995-28248017 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1094488090 12:30940796-30940818 GCCTCACAGCAAGAGGTGAGTGG + Intronic
1094786717 12:33857535-33857557 GCTTCATAGAATGAGTTTGGAGG + Intergenic
1095457265 12:42401482-42401504 GCGTCACAGCAGGAGGTGAGTGG + Intronic
1095695820 12:45142984-45143006 GCCGCACAGCAGGAGGTGTGTGG - Intergenic
1095697718 12:45159423-45159445 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1095757345 12:45783719-45783741 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1095811342 12:46375372-46375394 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1095846164 12:46747239-46747261 GCCTCATAGAATGAGTTGTGGGG - Intergenic
1098557162 12:71832409-71832431 GCTTCATAGAATGAGTTTTGAGG + Intergenic
1098972907 12:76874683-76874705 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1098982375 12:76971058-76971080 GCTTCATAGAATGAATTGTGGGG + Intergenic
1099467948 12:83010049-83010071 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1099972373 12:89513722-89513744 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1099979244 12:89579788-89579810 GCTGCACAACGTTAGTTGTGTGG - Intergenic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1100735567 12:97525793-97525815 GCTGCACAGCAGGAAGTGTGTGG + Intergenic
1100874169 12:98944782-98944804 TCTCCACAGTATCAGTTGTGTGG + Intronic
1100905206 12:99290400-99290422 GCTTCATAGAATGAGTTTAGAGG - Intronic
1101262436 12:103046573-103046595 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1101861088 12:108483052-108483074 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1101899760 12:108782924-108782946 GCTCCACACCATGAGTTGTTTGG - Exonic
1102074062 12:110045992-110046014 GCTTAAAACCATGAGTTGTTAGG + Intronic
1102114990 12:110396138-110396160 GCTGCACAGCAGGAGGTGGGTGG - Intronic
1102988561 12:117298391-117298413 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1103461940 12:121111765-121111787 GCTTAAGAGCAAGAGTTGTGGGG + Intergenic
1103626306 12:122222864-122222886 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1103860014 12:124004640-124004662 GCCACACAGCATGAGGTGAGTGG + Intronic
1104256054 12:127139813-127139835 GCTTCATAAAATGAGTTGGGAGG + Intergenic
1104418512 12:128615697-128615719 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1104617869 12:130285473-130285495 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1105500873 13:20970711-20970733 GCTGCACAGCAAGAGGTGAGTGG - Intergenic
1105726881 13:23171830-23171852 GCTGCACAGCAGGAGATGAGTGG - Intergenic
1105863480 13:24438374-24438396 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1106658319 13:31771287-31771309 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1106726421 13:32490853-32490875 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1106939836 13:34765979-34766001 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1107749563 13:43550163-43550185 GCTGCACAGCAGGAGGTGAGAGG - Intronic
1110433005 13:75447651-75447673 GCGTCACAGCAGGAGGTGAGCGG + Intronic
1110745114 13:79043435-79043457 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1110778826 13:79441148-79441170 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1111320986 13:86628524-86628546 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1112022490 13:95383779-95383801 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1112865522 13:103891826-103891848 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1114598090 14:23931369-23931391 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1114656885 14:24321708-24321730 GCTACACAGCAGGAGGTGAGCGG - Intronic
1115308573 14:31957058-31957080 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1115321302 14:32082118-32082140 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1116280216 14:42897180-42897202 GCTTCATAGAATGAGTTAAGAGG + Intergenic
1116493120 14:45528994-45529016 GCTTCATAGAATGAGTTATGAGG - Intergenic
1116966065 14:51016282-51016304 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1117157830 14:52958251-52958273 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1117322193 14:54634624-54634646 GCCACACAGCATGAGGTGAGCGG - Intronic
1119337790 14:73849043-73849065 GCTTGACAGACTGAGGTGTGAGG - Intergenic
1120165453 14:81194107-81194129 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1120558224 14:85956719-85956741 GCTGCACAGCAGGTGGTGTGTGG + Intergenic
1120602598 14:86530516-86530538 GCCTCACAGCAGGAGGTGAGCGG + Intergenic
1120868649 14:89317775-89317797 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1121108403 14:91295768-91295790 GCTTCACTGTATGAATTCTGGGG - Intronic
1121909777 14:97778254-97778276 GCCTCACAGCAAGAGATCTGGGG + Intergenic
1122660028 14:103288935-103288957 GCTGCACAGCAAGAGGTGGGTGG + Intergenic
1123569279 15:21586435-21586457 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1123571316 15:21612838-21612860 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1123605389 15:22021756-22021778 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1123607430 15:22048190-22048212 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1123670270 15:22649695-22649717 GCTCCACAGCAGGAGGTGAGTGG - Intergenic
1123679159 15:22745247-22745269 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124331378 15:28819697-28819719 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124526244 15:30456113-30456135 GCTCCACAGCAGGAGGTGAGTGG - Intergenic
1124772409 15:32551571-32551593 GCTCCACAGCAGGAGGTGAGTGG + Intergenic
1124842539 15:33257102-33257124 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1125249046 15:37678318-37678340 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1126159882 15:45600811-45600833 GCCTCATAGAATGAGTTGGGAGG + Intronic
1126821667 15:52510514-52510536 GCCTCACAGCAGGAGGTGAGTGG + Intronic
1127448537 15:59091972-59091994 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1128662737 15:69514011-69514033 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1129279236 15:74470902-74470924 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1129874338 15:78963109-78963131 GCTTCAGAGCAGGAGTGGGGTGG - Intronic
1132033351 15:98457510-98457532 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1132076201 15:98823061-98823083 TCTTCACAGCATGAGGTGGGGGG - Intronic
1132076494 15:98825445-98825467 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1132306389 15:100817207-100817229 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1202977633 15_KI270727v1_random:313528-313550 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1202979669 15_KI270727v1_random:339964-339986 GCTTCATAGAATGAGTTAGGGGG + Intergenic
1133278770 16:4653277-4653299 GGTTCACAGGGTGAGGTGTGGGG + Intronic
1133650341 16:7806784-7806806 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1134206723 16:12244168-12244190 GCCACACAGCAGGAGTTGAGTGG - Intronic
1134459836 16:14421481-14421503 GCCGCACAGCAGGAGGTGTGCGG + Intergenic
1134787267 16:16955920-16955942 GCTGCACAGCAGGAGATGAGTGG + Intergenic
1136044472 16:27604340-27604362 ACTTCACAGGCTGAGTTGGGAGG - Intronic
1138620605 16:58208044-58208066 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1139392550 16:66614175-66614197 GCTGCACAGCAGGAGGTGGGTGG - Intergenic
1140013661 16:71161348-71161370 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1140418655 16:74797523-74797545 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1140534563 16:75697751-75697773 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1140596085 16:76414533-76414555 GCTTCCCAGCTTGTTTTGTGAGG - Intronic
1143051993 17:4133644-4133666 AATACACAGCAGGAGTTGTGTGG - Intronic
1143209584 17:5175204-5175226 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1143958296 17:10692881-10692903 GCTCCCCAGTATGAGTTGTGAGG + Exonic
1144665669 17:17100520-17100542 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1146393308 17:32442709-32442731 GCCTCACAGCAGGAGGTGAGCGG + Intergenic
1149290670 17:55215106-55215128 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1149418652 17:56487085-56487107 CCTTCACAGGATTACTTGTGGGG + Intronic
1149794791 17:59509165-59509187 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1149870559 17:60177000-60177022 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1149940710 17:60862317-60862339 GCTTCATAGAATGAGTTAGGGGG + Intronic
1150031973 17:61748102-61748124 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1150517103 17:65825400-65825422 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1150970888 17:70026464-70026486 GCTTTATAGAATGAGTTGGGGGG + Intergenic
1151200290 17:72462949-72462971 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1151331627 17:73413074-73413096 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1152166007 17:78706802-78706824 GCTTAACATCATTAGTTGTAGGG - Intronic
1152990337 18:357908-357930 GCTGCACAGCAGGAGTTGAGTGG + Intronic
1153471054 18:5445724-5445746 GCTGCACAGCAAGAGGTGGGTGG + Intronic
1153507287 18:5814242-5814264 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1153953834 18:10079177-10079199 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1153956371 18:10099825-10099847 GCTACACAGCAGGAGGTGAGGGG - Intergenic
1154150419 18:11902176-11902198 GCTGCACATCCTGAGTTGTCTGG - Intronic
1154368840 18:13738966-13738988 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1155641163 18:28017123-28017145 GCTTCACAGAATGATTTAGGAGG + Intronic
1155706849 18:28826254-28826276 TCATCACACCATCAGTTGTGTGG + Intergenic
1155723150 18:29044904-29044926 GCCACACAGAATGAGTTGGGAGG + Intergenic
1156009644 18:32481665-32481687 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1157583220 18:48785433-48785455 GCTCCCCAGCCTGAGATGTGAGG - Intronic
1157769032 18:50328189-50328211 GCTGCACAGCAGGACTTGAGTGG - Intergenic
1158389390 18:57032490-57032512 GCTGCACAGCAGGAGGTGAGTGG + Exonic
1158865125 18:61631218-61631240 GCCACACAGCAGGAGTTGAGTGG - Intergenic
1160245812 18:77158623-77158645 GCCACACAGCAAGAGTTGAGTGG - Intergenic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1161988855 19:7672675-7672697 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1163151946 19:15420722-15420744 ACTTCACTGCATGATTGGTGGGG + Exonic
1163193811 19:15699715-15699737 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1164755266 19:30684759-30684781 GCTTCACAGCATGACTTTATAGG + Intronic
1165402578 19:35611307-35611329 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1166030405 19:40121245-40121267 TCTTCACAGTATGAGATGAGTGG + Intergenic
925221889 2:2148447-2148469 GCCTCACAGCAGGAGGTGAGTGG - Intronic
927244235 2:20943988-20944010 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
928361350 2:30664592-30664614 TCATCACAGCTTGTGTTGTGAGG + Intergenic
928520478 2:32083563-32083585 GCTCCACATCATTAGTTGTTAGG - Intronic
928680306 2:33694423-33694445 GCCTCACAGAATGAGTTGGGGGG + Intergenic
928721154 2:34123163-34123185 GCTTCACCACATGAATTCTGGGG + Intergenic
928749177 2:34451801-34451823 GCTTCATAGAATGAGTTTGGAGG + Intergenic
928796178 2:35022347-35022369 GCTTTATAGAGTGAGTTGTGAGG - Intergenic
928930493 2:36619092-36619114 GCTGCACAGCAGGAGGTGAGCGG + Intronic
928995653 2:37288158-37288180 GCGTAACAGCATCATTTGTGGGG + Intronic
929788184 2:45006715-45006737 GATTGACAGCATGAGAGGTGGGG - Intronic
930317689 2:49817361-49817383 GCTGCACAGCAGGAGATGAGTGG + Intergenic
930803677 2:55468848-55468870 GCCTCATAGAATGAGTTGTTAGG - Intergenic
931367624 2:61632701-61632723 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
931495698 2:62804746-62804768 GCTGCACAGCAGGAGGTGAGTGG + Intronic
932523043 2:72433781-72433803 GCTTAACAGCTTGAGTTTTTGGG + Intronic
932959956 2:76402041-76402063 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
933072099 2:77871691-77871713 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
933815340 2:86063495-86063517 GCCTCACAGAATGAGGTGTTAGG - Intronic
934569895 2:95362743-95362765 GCTGCACAGCAGGAGGTGGGCGG - Intronic
934625798 2:95849892-95849914 GCTGCACAGCAGGAGGTGAGTGG - Intronic
934807774 2:97251426-97251448 GCTGCACAGCAGGAGGTGAGTGG + Intronic
934829736 2:97505761-97505783 GCTGCACAGCAGGAGGTGAGTGG - Exonic
935433100 2:102999181-102999203 GCTGCACAGCAAGAGGTGAGTGG + Intergenic
935725678 2:106021845-106021867 GCTGCACAGCAAGAGGTGAGTGG + Intergenic
936070151 2:109364106-109364128 ACTTCAAAGCAAGAATTGTGGGG - Intronic
937591168 2:123614849-123614871 GCTTCACTGCCTGAGTTTGGGGG - Intergenic
937735194 2:125279408-125279430 TCTTGCCAGCATGAGTTGGGAGG + Intergenic
937863208 2:126729603-126729625 GCTGAACAGGATGAGGTGTGAGG + Intergenic
938904835 2:135827759-135827781 GCTGCACAGCAGGAGGTGAGTGG - Intronic
939771186 2:146321363-146321385 ACCTCACAGCATGAGATGAGCGG - Intergenic
940623902 2:156148889-156148911 GCTACACAGCAGGAGGTGAGCGG + Intergenic
940784691 2:157968487-157968509 GCTTCATAGAATGATTTGAGGGG + Intronic
941230318 2:162903885-162903907 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
941841650 2:170091613-170091635 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
942052747 2:172155853-172155875 GCTGCACAGCAGGAGTTGAGTGG + Intergenic
942254712 2:174085294-174085316 GCTGCACAGCAGGAGGTGAGTGG + Intronic
942840038 2:180349180-180349202 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
944068730 2:195646685-195646707 GCTGCACAGCAGGAGGTGAGCGG + Intronic
945568611 2:211435539-211435561 GCTGCACAGCAGGAGGTGAGTGG + Intronic
946407658 2:219500355-219500377 GCTGCACAGCATAACTTGAGGGG - Intronic
946473662 2:219986901-219986923 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
946616205 2:221513415-221513437 ACTTTACAGCCTGAGTTGTCAGG + Intronic
946894331 2:224307933-224307955 GCTGCATAGCAGGAGGTGTGCGG + Intergenic
947000857 2:225454571-225454593 GCTGCACAGCAGGAGGTGAGTGG + Intronic
947208345 2:227682934-227682956 GCCTCACAGCAGGAGGTGAGCGG - Intergenic
947287204 2:228530067-228530089 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
947328298 2:229001673-229001695 GCTTCAATATATGAGTTGTGGGG - Intronic
947545410 2:231007015-231007037 GCATTACAGCCTGAGGTGTGTGG + Intronic
947905906 2:233762106-233762128 GCTTCACATCATGAGCCATGTGG + Intronic
948235029 2:236381022-236381044 GCTTCAACTCATGAGTTTTGGGG - Intronic
948401811 2:237691026-237691048 GCTTCAGGGCAGGAGTTGTCAGG - Intronic
948539826 2:238682711-238682733 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
948757639 2:240168710-240168732 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
948926373 2:241101424-241101446 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1168987751 20:2064780-2064802 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1169925534 20:10780375-10780397 TACTAACAGCATGAGTTGTGGGG + Intergenic
1170160509 20:13305449-13305471 GCTTCCCAGGAAGTGTTGTGGGG + Intergenic
1170423092 20:16211759-16211781 GCTCAACTGCATGAGCTGTGTGG - Intergenic
1174142867 20:48428847-48428869 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1174144402 20:48440997-48441019 GCTACACAGCAGGAGGTGAGTGG + Intergenic
1174164827 20:48577153-48577175 GCAGCACAGCATGATCTGTGGGG + Intergenic
1174973354 20:55303653-55303675 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1175287820 20:57849587-57849609 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1175495171 20:59409298-59409320 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1175604030 20:60297882-60297904 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1177127433 21:17212959-17212981 GCTGCACAGCAAGAGGTGAGTGG - Intergenic
1177209118 21:18047864-18047886 GCTTCACAGTGTGGGTGGTGAGG + Intronic
1178065064 21:28895530-28895552 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1179003309 21:37484015-37484037 GCTACACAGCAGGAGGTGAGTGG + Intronic
1179256435 21:39720347-39720369 TCTTCACAGCAGGAGGTGAGTGG - Intergenic
1180938475 22:19641516-19641538 GCCTCAGAGCAGGAGGTGTGCGG + Intergenic
1181771410 22:25128380-25128402 GCTTCACACCAGGTGTTGGGTGG + Intronic
1182569349 22:31224911-31224933 GCTGCACAGCAGGAGGTGAGCGG + Intronic
949434442 3:4013266-4013288 GCCGCACAGCATGAGGTGAGTGG - Intronic
949712130 3:6883713-6883735 GCTTCACAGCAAGAAGTGAGTGG + Intronic
949962299 3:9322492-9322514 GCTGCACAGCAGGAGGTGAGTGG + Intronic
950051311 3:9992016-9992038 GCTGCACAGCAGGAGGTGAGGGG - Intronic
950300121 3:11869594-11869616 GCTGCACAGCAGGAGGTGAGGGG - Intergenic
950526808 3:13529090-13529112 GCTGCACAGCAGGAGCTGCGTGG - Intergenic
950826118 3:15823305-15823327 GCTGCACAGCAGGAGGTGAGCGG - Intronic
950969234 3:17170038-17170060 GCTGCACAGCAGGAGGTGAGGGG - Intronic
951226594 3:20127954-20127976 GCTGCACAGCACGAGGTGAGTGG - Intronic
951610937 3:24492580-24492602 TGTTTAAAGCATGAGTTGTGTGG - Intronic
951628155 3:24689498-24689520 GCTTCACAGCAGGAGGTGATTGG + Intergenic
952064054 3:29546390-29546412 GCTACATAGCAAGTGTTGTGAGG - Intronic
952709999 3:36420452-36420474 GCTACACAGCAGGAGGTGAGTGG + Intronic
953309904 3:41866588-41866610 GCTGCACAGCAGGAGGTGAGTGG - Intronic
953706974 3:45238495-45238517 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
954308894 3:49749144-49749166 GCCTCACAGCAGGAGGTGAGTGG - Intronic
954941643 3:54378410-54378432 GCTGCACAGCAGGAGGTGAGTGG - Intronic
955022242 3:55132626-55132648 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
955047835 3:55376600-55376622 GCTGCACAGCAGGAGATGGGTGG + Intergenic
955989554 3:64611748-64611770 GCTGCACAGCAACAGTTGAGTGG - Intronic
956462171 3:69483613-69483635 GTTTCCCAGCATGAATTGTAGGG - Intronic
957592735 3:82221783-82221805 GCTTCATAGAATGAGTTAGGAGG + Intergenic
957795291 3:84997025-84997047 GGGTCACAGCATGATTTGTATGG + Intronic
958411519 3:93822459-93822481 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
958437824 3:94119539-94119561 GCTGCACAGCAGGAGTTGAGTGG - Intronic
960086117 3:113593288-113593310 GCTGCACAGCAGGAGATGAGTGG + Intronic
960537562 3:118830184-118830206 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
960778523 3:121290540-121290562 GCTTCACAGAATGATTTGGGGGG - Intronic
961020149 3:123498446-123498468 GCTGCACAGCAGGAGGTGAGTGG + Intronic
961535826 3:127569962-127569984 GCTTCAGTGCATGAGTGTTGGGG - Intergenic
962285450 3:134082234-134082256 GCTGCACAGCAGGAGGTGAGTGG + Intronic
962574644 3:136745643-136745665 GCTGCACAGCAGGAGGTGAGAGG - Intronic
962682046 3:137810487-137810509 GCTTCAATACATGAGTTTTGGGG - Intergenic
962989860 3:140567993-140568015 ACTTCACAGGATTTGTTGTGAGG - Exonic
963308060 3:143676196-143676218 GCTGCACAGCAGGAGGTGAGTGG - Intronic
964051204 3:152395928-152395950 GCTGCACAGCAGGAGGTGAGTGG + Intronic
964281459 3:155071130-155071152 GTTTCACAGCACAACTTGTGTGG - Intronic
964325260 3:155538884-155538906 GCTTCATAGCATGATTTAGGGGG - Intronic
965304853 3:167051581-167051603 GCTTCACAGCAGGAGGTGAGCGG + Intergenic
966334931 3:178857396-178857418 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
966556801 3:181271508-181271530 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
966966750 3:185002350-185002372 TCTTCACTGCAAGAGGTGTGGGG - Intronic
967127621 3:186438348-186438370 GCTTCCCTACGTGAGTTGTGCGG - Intergenic
967208686 3:187147775-187147797 GCTGCACAGCAGGAGGTGAGCGG - Intronic
968789513 4:2649824-2649846 GCTGCACAGCAGGAGGTGAGTGG + Intronic
970848433 4:20572137-20572159 GATTGACAGCATGAATTGTAAGG + Intronic
971015778 4:22487486-22487508 GCTGTACAGCAGGAGTTGAGTGG - Intronic
971443921 4:26721677-26721699 GCTTCTCAGCATGACATATGAGG + Intronic
971483732 4:27138693-27138715 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
972063879 4:34914864-34914886 GCTTCACAGAATGAGTTAAGAGG - Intergenic
972250312 4:37292911-37292933 GCTGCACAGCAGGAGGTGAGCGG - Intronic
972660483 4:41111218-41111240 GCTGCACAGCAGGAGGTGAGTGG - Intronic
974003819 4:56536101-56536123 GCTACACAGCAGGAGGTGAGTGG - Intronic
974488511 4:62534208-62534230 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
975040695 4:69742376-69742398 TCCTCATAGAATGAGTTGTGAGG + Intronic
975789212 4:77930303-77930325 GCCTCACAGCAGGAGGTGAGTGG + Intronic
976623454 4:87152864-87152886 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
976932515 4:90586087-90586109 GCTGCACAGCAGGAGGTGAGTGG + Intronic
977235150 4:94499704-94499726 GCTGCACAGCAGGAGGTGAGTGG + Intronic
979790986 4:124780907-124780929 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
980021134 4:127711573-127711595 GCTGCACAGCAGGAGGTGAGTGG + Intronic
980193102 4:129551076-129551098 GCTACACAGCAGGAGGTGAGCGG + Intergenic
980230372 4:130039424-130039446 GCTTCACAGCAGGAGGTGAGTGG + Intergenic
981088648 4:140709914-140709936 GCTGCACAGCAGGAGGTGAGTGG - Intronic
981228013 4:142319507-142319529 GCTTCACAGTATGAATTTTCTGG + Intronic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
982950301 4:161686261-161686283 GCTTCACAGAATGATTTAGGAGG + Intronic
983040841 4:162923845-162923867 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
983289771 4:165787008-165787030 GCTTCAAAACATGGGTTTTGGGG + Intergenic
983295050 4:165856757-165856779 GCTGCACAGCAGGAGGTGAGGGG - Intergenic
984091670 4:175382441-175382463 GCTTCACAGCATGTGTTACTTGG - Intergenic
984474793 4:180222408-180222430 GCTTCATAGAATGATTTGTGGGG + Intergenic
985143826 4:186872245-186872267 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
985636872 5:1040022-1040044 GCCTCACAGCATGGGGTGGGCGG + Intergenic
986027639 5:3865606-3865628 GCTTCACTGCATGAAGAGTGAGG - Intergenic
986456092 5:7920594-7920616 ACCTCACAGAATGAGTTCTGGGG + Intergenic
986772774 5:10988763-10988785 TCTACACAGGATGATTTGTGGGG + Intronic
986841411 5:11701960-11701982 GCTTCCCATGATGAGTTATGTGG - Intronic
986935717 5:12883555-12883577 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
987489132 5:18554468-18554490 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
988392934 5:30659066-30659088 GCTCCACAGCAGGAGGTGAGTGG - Intergenic
988553321 5:32216243-32216265 GCTGCACAGCAGGAGGTGAGGGG + Intergenic
988805529 5:34736925-34736947 GCTGCACAGCAGGAGGTGAGTGG + Intronic
989456716 5:41652551-41652573 GCTTCCCAGCATGAGTGGAGAGG + Intergenic
990323547 5:54652353-54652375 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
990520773 5:56578277-56578299 GCTTGACAGAATGTGTGGTGGGG + Intronic
991155359 5:63428061-63428083 GCTTCACAGAATGACTTGGGAGG + Intergenic
991672305 5:69060586-69060608 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
992096391 5:73366783-73366805 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
992518389 5:77521363-77521385 GCTGCACAGCAGGAGGTGAGTGG - Intronic
992613526 5:78528294-78528316 GCTGCACAGCAGGAGGTGAGTGG + Intronic
992670186 5:79052313-79052335 GCCTCATAGAATGAGTTGAGAGG + Intronic
992790802 5:80211939-80211961 GCTTCAGTGCTTGAGTTTTGGGG + Intronic
992988027 5:82253631-82253653 GCCTCACAGCAGGAGGTGAGCGG + Intronic
993037304 5:82771810-82771832 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
993438801 5:87929551-87929573 GCTTCACAGAATGAGTTGCCGGG - Intergenic
994329477 5:98488825-98488847 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
995230239 5:109753202-109753224 GCTTCGCAGCCTGAGATGTCAGG - Intronic
995339710 5:111044378-111044400 GCTGCACAGCAGGAGGTGTGTGG - Intergenic
995390420 5:111634537-111634559 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
995881059 5:116845257-116845279 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
995952492 5:117732926-117732948 GCTTCACATCAGGAGGTGAGCGG - Intergenic
996363578 5:122676928-122676950 GCTTCTCAGGAAGAATTGTGGGG - Intergenic
996613794 5:125415336-125415358 GCTGCACAGCAAGAGGTGAGCGG - Intergenic
996827079 5:127696453-127696475 GCTTCACTGATTGAGATGTGTGG + Intergenic
996878766 5:128269496-128269518 GCTTATCAGCTTGAGTTTTGGGG - Intronic
997358420 5:133279204-133279226 GCTGCACAGCAGGAGGTGAGCGG + Intronic
997715591 5:136040341-136040363 GCCACACAGCAGGAGTTGAGTGG + Intronic
997839927 5:137229930-137229952 GCTGCACAGCAGGAGGTGAGCGG - Intronic
997900612 5:137760550-137760572 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
998008137 5:138671199-138671221 GCTGCACAGCAGGAGGTGAGTGG - Intronic
998639150 5:143989821-143989843 GCTTTAAATCATGAGTTCTGTGG + Intergenic
999502878 5:152164419-152164441 GCTGCACAGCAGGAGTTGAGTGG + Intergenic
999520805 5:152348984-152349006 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
999941259 5:156545683-156545705 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1000008109 5:157206394-157206416 GCCTCATAGAATAAGTTGTGGGG + Intronic
1000375111 5:160573510-160573532 GCTGCACAGCAGGAGATGAGTGG + Intronic
1002323689 5:178391020-178391042 GCCTCACAGCAGGAGGTGAGTGG + Intronic
1002765095 6:232623-232645 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1004034900 6:11914424-11914446 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1004157941 6:13187152-13187174 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1004476620 6:15979306-15979328 GCCTCACAGCAGGAGGTGAGTGG + Intergenic
1005103946 6:22203184-22203206 GCTCCACAGCAGGAGGTGAGTGG + Intergenic
1005660533 6:27994285-27994307 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1006412620 6:33883734-33883756 GCTGCACAGCAAGAGGTGAGTGG + Intergenic
1006910377 6:37559538-37559560 GCTCCACAGCATTAGCTCTGTGG - Intergenic
1007141993 6:39585397-39585419 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1008130241 6:47712965-47712987 GCTACACAGCAGGAGGTGAGCGG + Intronic
1008391495 6:50957297-50957319 GGTTCACAGCATGGGCTCTGGGG + Intergenic
1008518629 6:52342259-52342281 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1008691250 6:53981659-53981681 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1008694161 6:54014628-54014650 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1009443056 6:63705383-63705405 GCCTCACAGCAGGAGGTGAGCGG + Intronic
1009517785 6:64641718-64641740 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1009922741 6:70082996-70083018 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1010680688 6:78795344-78795366 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1010717478 6:79246132-79246154 GCTGCACAGCAGGAGCTGAGTGG + Intergenic
1011027617 6:82886441-82886463 GCTACACAGCAGGAGGTGAGTGG - Intergenic
1011394068 6:86887606-86887628 GCTTCTTAGCATGATCTGTGAGG - Intergenic
1011804922 6:91060937-91060959 GCTGCACAGCAAGAGGTGAGTGG + Intergenic
1011940595 6:92837370-92837392 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1012249053 6:96959650-96959672 GCTTCAAGACATGAATTGTGGGG + Intronic
1012281751 6:97336030-97336052 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1012965923 6:105673026-105673048 GCTTCATAGAATGATTTGTGGGG - Intergenic
1013130047 6:107223906-107223928 GCTGCACAGCAAGAGGTGAGCGG + Intronic
1013974869 6:116065416-116065438 GGTTCACAGCAAGAGTTTGGAGG - Intergenic
1014203599 6:118630776-118630798 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1014292338 6:119573081-119573103 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1015348140 6:132183729-132183751 GCTTAATAGCATGATTTGGGTGG - Intergenic
1015384118 6:132602581-132602603 GCTACACAGCAGGAGATGAGGGG - Intergenic
1015637719 6:135295171-135295193 GCTTAACATCATTAGTTGTTGGG + Intronic
1016312830 6:142753202-142753224 GTTTTACAGCAAGAGTTGTGTGG - Exonic
1016634270 6:146269580-146269602 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1017464570 6:154682463-154682485 GCTTCACAGGAGGAGGTGAGTGG + Intergenic
1017978935 6:159381687-159381709 GCTTCACAGAATGAGTTCTGTGG + Intergenic
1017985568 6:159440546-159440568 GCTTCAGAGCAAGAGTTCTCTGG - Intergenic
1018050072 6:160001124-160001146 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1018149668 6:160926296-160926318 TCTTCACAGCATGAAGGGTGCGG + Intergenic
1018662308 6:166099492-166099514 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1018796304 6:167187924-167187946 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1018820011 6:167367135-167367157 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1018894349 6:168003056-168003078 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1020441814 7:8224973-8224995 GCTTGACATCATGAGTGATGAGG - Intronic
1021284217 7:18759274-18759296 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1022746615 7:33179349-33179371 GTTTCACAGCAGGAGGTGAGCGG + Intronic
1022983449 7:35626339-35626361 GCTGCACAGCAAGAGATGGGTGG + Intergenic
1023124115 7:36937927-36937949 GTTTCTCAGCCTGAGTTCTGTGG - Intronic
1023337217 7:39183041-39183063 GCTGCACAGCAGGAGGTGAGAGG + Intronic
1023579849 7:41670168-41670190 CCTTCACTGCATGAGATGTAAGG - Intergenic
1023640425 7:42251439-42251461 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1024613977 7:51092017-51092039 GCTGCACAGCAAGAGGTGAGTGG + Intronic
1026250046 7:68661999-68662021 GCTGCACAGCATGAGGTGAGTGG - Intergenic
1026533260 7:71218603-71218625 GCCTCACAGCAGGAGGTGAGTGG + Intronic
1026553770 7:71388952-71388974 GCTCCACAGCAGGAGGTGAGTGG + Intronic
1026558397 7:71427711-71427733 GCCTCACAGCAGGAGGTGAGTGG + Intronic
1026565060 7:71483010-71483032 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1026575046 7:71564891-71564913 GCTTCGCAGCATGACTTGCCCGG - Intronic
1026620452 7:71945506-71945528 GCTACACAGCAGGAGGTGAGTGG + Intronic
1026624403 7:71979602-71979624 GCTGCACAGCAAGAGGTGAGAGG - Intronic
1027154661 7:75758161-75758183 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1027495472 7:78882496-78882518 GCTTCATAGAATGAGTTAGGGGG - Intronic
1027613576 7:80393012-80393034 GCTGCACAGCAGGAGATGAGTGG - Intronic
1027684450 7:81264870-81264892 AATTCAGAGCATGAGTGGTGTGG + Intergenic
1028190525 7:87845337-87845359 GCTACACAGCAGGAGGTGAGCGG + Intronic
1030900618 7:115118992-115119014 GCTTCACAGCAGGAGGTGAATGG + Intergenic
1033941047 7:146654191-146654213 TCCTCACAGCATGAGATGTCTGG + Intronic
1034091503 7:148368434-148368456 GGTTAAGAGCATGAGTTTTGGGG + Intronic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1034635110 7:152561006-152561028 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1034685340 7:152966280-152966302 GCCTCACAGCAGGAGATGAGTGG - Intergenic
1036511880 8:9407968-9407990 GCCTCTCAGCATGAGAGGTGGGG - Intergenic
1036621968 8:10430206-10430228 GCCTCACAGCAGGAGGTGAGTGG - Intergenic
1036692549 8:10952843-10952865 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1036742246 8:11374006-11374028 GCCTCATAGAATGAGTTGGGAGG - Intergenic
1036806778 8:11840284-11840306 GCATCACAGCAGGAGGTGAGCGG + Intergenic
1036966288 8:13301714-13301736 GCTGCACAGCAGGAGATGGGCGG + Intronic
1037603607 8:20419512-20419534 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1037639519 8:20730107-20730129 GCCTCTCAGCATGAGGTGGGAGG + Intergenic
1037736381 8:21570221-21570243 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1038285243 8:26200544-26200566 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1038345849 8:26731786-26731808 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1038866963 8:31449528-31449550 GCTTCACAGCAGGAGGTGAGTGG - Intergenic
1039070443 8:33644687-33644709 GCTACACAGCAGGAGGTGAGCGG + Intergenic
1039070723 8:33647227-33647249 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1039268274 8:35852532-35852554 GCTTCATAGAATGAGTTTGGGGG + Intergenic
1039375514 8:37028763-37028785 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1040010687 8:42658864-42658886 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1041040972 8:53845298-53845320 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1041450734 8:58004213-58004235 GCTGCACAGCAAGAGGTGAGTGG - Intronic
1041860060 8:62503016-62503038 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1042406188 8:68408016-68408038 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1042981418 8:74533171-74533193 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1043347060 8:79310724-79310746 GCTGCACAGCAAGAGGTGAGTGG - Intergenic
1043533677 8:81176712-81176734 GCTTCAGAGCCTGTGATGTGAGG + Intergenic
1043697759 8:83242359-83242381 GCTCCACAGCAGGAGGTGAGCGG - Intergenic
1043794583 8:84520601-84520623 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1044588206 8:93887879-93887901 GCTCCACATCATGAGTTGTTAGG + Intronic
1044677958 8:94748579-94748601 GCCTCACAGCAGGAGGTGAGTGG + Intronic
1044945795 8:97388081-97388103 GCCACACAGCATGAGGTGAGCGG + Intergenic
1045010387 8:97953672-97953694 GCTACTCAGCATGAGTACTGAGG + Intronic
1045249168 8:100468790-100468812 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1045334013 8:101182143-101182165 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1046600580 8:116312698-116312720 GCCACACAGCAGGAGTTGAGTGG + Intergenic
1046858590 8:119065200-119065222 GCTGTACAGCAGGAGGTGTGCGG + Intronic
1047177259 8:122553663-122553685 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1047325188 8:123829243-123829265 ACTTAAAAGCATGAGTGGTGTGG - Intergenic
1047514030 8:125538009-125538031 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1047769146 8:128016664-128016686 CCCTCACAGCACCAGTTGTGTGG - Intergenic
1047941716 8:129832904-129832926 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1048527081 8:135213051-135213073 GCTGCCCAGCATGGGCTGTGAGG + Intergenic
1048924544 8:139259817-139259839 GCTTCAGCGCATGAATTTTGGGG - Intergenic
1050025790 9:1333392-1333414 GCTTCAACACATGAGTTTTGGGG + Intergenic
1050057027 9:1666393-1666415 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1050931161 9:11328464-11328486 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1051007581 9:12365893-12365915 AATTAACAGCATGAGTTTTGAGG - Intergenic
1051261746 9:15271628-15271650 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1051378633 9:16431931-16431953 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1052565522 9:30145133-30145155 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1055409956 9:76018383-76018405 GCTGCACAGCAGGACTTGAGTGG + Intronic
1055657293 9:78463990-78464012 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1055767858 9:79684351-79684373 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1055817000 9:80218471-80218493 GCTACACAGCAGGAGGTGAGTGG + Intergenic
1056115066 9:83433888-83433910 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1056189181 9:84167854-84167876 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1056238575 9:84620563-84620585 GCTTCTAAGCAGGAGTTGTTCGG - Intergenic
1056306768 9:85298448-85298470 GCTGCACAGCAGGAGATGAGTGG - Intergenic
1056700614 9:88903258-88903280 GCTACACAGCAGGAGGTGAGCGG - Intergenic
1056772529 9:89490100-89490122 GCTTAACATCATTAGTTGTTAGG - Intronic
1057115801 9:92520370-92520392 GCTTAACATCATTAGTTGTTAGG + Intronic
1060354616 9:122893532-122893554 ACTTAACAGCAGGAGCTGTGTGG + Intronic
1060904912 9:127296203-127296225 GCTACACAGCAGGAGGTGAGTGG - Intronic
1061514940 9:131083709-131083731 GTTTCTCAGCATGTATTGTGTGG - Intronic
1062034932 9:134378772-134378794 GCTTCACAGCCTGGGGTCTGCGG - Intronic
1185834865 X:3335977-3335999 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1186154084 X:6707724-6707746 GCTGCACAGCAGGAGATGAGTGG - Intergenic
1186920136 X:14269709-14269731 GCTTCAAAGCAAGGGTTTTGGGG + Intergenic
1187650996 X:21406074-21406096 GCGGCACAGCAGGAGGTGTGTGG + Intronic
1188904270 X:35773527-35773549 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1188964447 X:36534167-36534189 GCTTCACATAATGAGTTAAGAGG + Intergenic
1189478308 X:41374305-41374327 GCTTCAACACATGAGTTTTGGGG - Intergenic
1189940328 X:46114390-46114412 GCCTCATAGAATGAGTTGGGAGG + Intergenic
1189962388 X:46336497-46336519 GCTTCACAGAATGAATTAAGAGG - Intergenic
1190820640 X:53968547-53968569 GCCTCATAGAATGAGTTTTGTGG - Intronic
1191129132 X:56989564-56989586 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1192394237 X:70762441-70762463 GCTGCACAGCAGGAGATGAGTGG + Intronic
1193863715 X:86702901-86702923 GCTTCATAGAATGAGTTGGAGGG - Intronic
1194869249 X:99107611-99107633 ACTTGACAGGCTGAGTTGTGAGG + Intergenic
1196872324 X:120124860-120124882 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1198318302 X:135492312-135492334 GCCTCAAAGAATGAGTTGAGAGG - Intergenic
1198733337 X:139758450-139758472 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1200825336 Y:7632617-7632639 GCTGCACAGCAAGAGGTGAGTGG - Intergenic
1201576132 Y:15463386-15463408 GCTTTCCAGGATGAGGTGTGAGG + Intergenic
1202202564 Y:22368740-22368762 GCTGCACAGCAAGAGGTGAGTGG + Intronic
1202234721 Y:22698469-22698491 GCTGCACAGCAAGAGGTGAGTGG + Intergenic
1202308438 Y:23497699-23497721 GCTGCACAGCAAGAGGTGAGTGG - Intergenic
1202562363 Y:26172887-26172909 GCTGCACAGCAAGAGGTGAGTGG + Intergenic