ID: 1100580565

View in Genome Browser
Species Human (GRCh38)
Location 12:95935780-95935802
Sequence ATAAATAAGCAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 613}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100580561_1100580565 5 Left 1100580561 12:95935752-95935774 CCAATAAATACTAATTCCTTGTA 0: 1
1: 0
2: 1
3: 22
4: 271
Right 1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG 0: 1
1: 0
2: 6
3: 62
4: 613
1100580560_1100580565 14 Left 1100580560 12:95935743-95935765 CCTTATATACCAATAAATACTAA 0: 1
1: 0
2: 2
3: 70
4: 1489
Right 1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG 0: 1
1: 0
2: 6
3: 62
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100580565 Original CRISPR ATAAATAAGCAGAAGGAGGC TGG Intronic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
901116490 1:6849407-6849429 AGAAATGAACTGAAGGAGGCTGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902159293 1:14516811-14516833 ATAGAAAAGAAGAAGAAGGCTGG - Intergenic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904642935 1:31944390-31944412 ATAACTGGGTAGAAGGAGGCAGG + Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905046577 1:35008191-35008213 ATAAATAAGGAAAAGGAGAGAGG - Intronic
905077531 1:35286577-35286599 AAAAATAGGCAGACAGAGGCAGG - Intronic
905155064 1:35970716-35970738 ATAAATAAACAAAGGGAGGGAGG - Intronic
905454623 1:38079718-38079740 ATAAATAAATAAAAGGGGGCAGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907982533 1:59498222-59498244 ACAAATGAGGAGAAGTAGGCTGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
908472972 1:64462442-64462464 AAAAATAAGCAGAATTAGCCAGG - Intergenic
908756565 1:67474161-67474183 ATAAATAAGTAAAAGAGGGCCGG - Intergenic
909728749 1:78868546-78868568 CTAATTAATCTGAAGGAGGCAGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912247579 1:107976501-107976523 TTAAATAAGCACAAGAATGCTGG - Intergenic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
912735289 1:112144949-112144971 AAAAATAGGCATCAGGAGGCTGG + Intergenic
912880239 1:113405069-113405091 ATAAATAAGCTAAAGAAGGCAGG + Intronic
913537978 1:119792606-119792628 ATAAATTAGGAGAGGGAGGTGGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914393661 1:147243620-147243642 ATAAGTAAGGAAAACGAGGCTGG - Intronic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915430963 1:155866411-155866433 ATAACTAAACAGAAATAGGCCGG - Intronic
915449153 1:155992693-155992715 ATAAAGTAGCAGGGGGAGGCCGG + Intronic
916485852 1:165257831-165257853 ACAAAAAAGCAGAAGGATGGAGG + Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
917145905 1:171891166-171891188 ATAAGGAAGGTGAAGGAGGCAGG + Intronic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
917412939 1:174778888-174778910 ATAAAAATGCAGAAGGTGGCCGG - Intronic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
917770661 1:178274156-178274178 CTAAGAAAGCAGAAGAAGGCAGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918223230 1:182455283-182455305 ATAAAGAAATAGGAGGAGGCGGG + Intronic
919098539 1:193065467-193065489 ACTAATAAGCAGAAGTAGACAGG + Intronic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919467197 1:197936413-197936435 TAAAATATCCAGAAGGAGGCTGG - Intergenic
920838493 1:209534157-209534179 ATAAATTAGCAGTAGGAAGGAGG + Intergenic
921043048 1:211452662-211452684 TTAAAGAACCAGAAGGTGGCAGG + Intergenic
921192974 1:212726007-212726029 ATAAATAAGCCAAAGTAGCCAGG + Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923624910 1:235606131-235606153 ATAAACAAGCAGACCGAGGTGGG + Intronic
923976454 1:239270013-239270035 ATTAAAGAGCAGAAGAAGGCTGG + Intergenic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924926077 1:248682206-248682228 ATAAATCAGCAGAAACAGCCCGG + Exonic
1063025113 10:2170426-2170448 AGAAATAAGCAGAAAGATGGGGG - Intergenic
1063435999 10:6031288-6031310 AAAGATAAGCATAAGGAAGCTGG + Intronic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064188108 10:13181205-13181227 ATAAATAAGGAAATGGAAGCCGG - Intronic
1065562156 10:26974634-26974656 ATAAACATGCAGAGGTAGGCCGG - Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066013954 10:31219302-31219324 AGAAATAAGAAGCAGGAGGGAGG + Intergenic
1066187183 10:33021591-33021613 ATAAAGAAGGAAATGGAGGCTGG + Intergenic
1066332021 10:34434074-34434096 AATAATGAGCTGAAGGAGGCAGG + Intronic
1067137683 10:43625802-43625824 ATAAATAAATAAAAAGAGGCCGG + Intergenic
1068451928 10:57201701-57201723 AAAAAAAAGCAGAAAAAGGCCGG - Intergenic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069470752 10:68687197-68687219 ATAAAAAAGGATAAGTAGGCCGG - Intronic
1069740567 10:70684704-70684726 ATAAATAAGGAAACTGAGGCAGG + Intronic
1070336619 10:75461473-75461495 AGAAAACAGCAGAAGCAGGCAGG - Intronic
1071179572 10:82967369-82967391 ATAAATAAGCAACGGGAGGAGGG - Intronic
1071686740 10:87765880-87765902 ATAAATAAACAGAATTAGCCAGG + Intronic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1073943887 10:108729700-108729722 ATAAATAGGTAGAGGGAGGGAGG + Intergenic
1074088264 10:110225226-110225248 ATACATAAGGAAAATGAGGCTGG + Intronic
1074685853 10:115961939-115961961 ATAGATGACCAGATGGAGGCAGG + Intergenic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1075910596 10:126122463-126122485 AAAAATAGGCAAAGGGAGGCAGG + Intronic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077808835 11:5616886-5616908 AAAAATTAGCCGAAGGTGGCAGG - Intronic
1077832882 11:5894458-5894480 TGAAATAAGCAGATTGAGGCAGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079825209 11:25182163-25182185 TTTAATAATCAGAAGGAAGCAGG + Intergenic
1079863678 11:25707547-25707569 ATAAGTGAGTGGAAGGAGGCAGG - Intergenic
1081336651 11:41874927-41874949 ATAAATAAGTAGGAAGAGACTGG + Intergenic
1083188465 11:61032308-61032330 ATAAATAAAGAAAAGTAGGCTGG - Intergenic
1083191493 11:61055624-61055646 ACAAAGAAGCATAAGAAGGCTGG + Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084771036 11:71343208-71343230 ATACTGAAGCAGAAGCAGGCAGG + Intergenic
1085016913 11:73179705-73179727 TTAAAAAATCAGAGGGAGGCTGG - Intergenic
1085118903 11:73954332-73954354 ATAAATAAAAAAAAGTAGGCCGG + Intronic
1085793575 11:79517080-79517102 ATAAAAAAGCAAAAGAGGGCAGG - Intergenic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086028202 11:82320402-82320424 TTAAATGAGCTGAAGAAGGCTGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086945027 11:92836385-92836407 ATTAATCAGCTGAAGGAGGGTGG - Intronic
1087430699 11:98050248-98050270 GGATATAAGCAGAAGTAGGCTGG - Intergenic
1087714236 11:101589460-101589482 ATAAATAACAGGAAGGAGACTGG + Intronic
1087768496 11:102181514-102181536 AGAAATAAGGAGTAGGTGGCAGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088558716 11:111090391-111090413 ATAAGTCAGAAGAAGAAGGCAGG - Intergenic
1088638128 11:111844298-111844320 ATAAAATCTCAGAAGGAGGCCGG - Intronic
1088992834 11:114969626-114969648 AGAAACAAGCAGAAAGAAGCTGG + Intergenic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1090956502 11:131517502-131517524 ACAAGTAAGCAGAAAGAAGCAGG - Intronic
1091531202 12:1357472-1357494 CTAAATAAGCAGAAGCATTCTGG + Intronic
1091880333 12:3972127-3972149 ATAAATAAGACAAAGGAGGCCGG - Intergenic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1093600521 12:21015919-21015941 ATAAATAAGCTGAGGAAGGGAGG + Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1093978437 12:25449626-25449648 ATAAATAAGCAGATAAATGCAGG - Intronic
1094203251 12:27814568-27814590 ATAACTAAGCAGAAGTATCCTGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094612349 12:32006590-32006612 ATAAATCAGCCCAAGGATGCGGG - Intergenic
1095990031 12:48028191-48028213 ATAAAAAGGCTGAATGAGGCCGG + Intergenic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096856394 12:54487398-54487420 ATAAAAAGGCTCAAGGAGGCCGG - Intergenic
1097424653 12:59428288-59428310 AGAAATAAGCAATTGGAGGCTGG - Intergenic
1097946411 12:65373801-65373823 ATAATTATGCTGAAGGAGGGAGG + Intronic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099449776 12:82794929-82794951 AAAAATAAATAAAAGGAGGCCGG + Intronic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099819082 12:87686723-87686745 ATAAATAAGGAGAATGACTCAGG + Intergenic
1099967839 12:89469638-89469660 ACAAATTAGCAGAAGGAGTGAGG + Intronic
1100551472 12:95650125-95650147 ATAAGTAAGTAGACTGAGGCTGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100587194 12:95991114-95991136 ATAAATAAGAAGAAGGAAGGAGG + Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101758187 12:107637956-107637978 ATAGGTGAGCAGAGGGAGGCAGG + Intronic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1102140637 12:110612122-110612144 AAAAATAACCAAAAGTAGGCCGG - Intergenic
1102321128 12:111935391-111935413 AAAAATCAGCAGATGGCGGCCGG - Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1103005435 12:117416816-117416838 AGAATAAAGCAAAAGGAGGCCGG - Intronic
1103075885 12:117982269-117982291 ATAAATAAACAAAAGGAAGTTGG - Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104183594 12:126406426-126406448 TTAAATAAGCTAAAGAAGGCAGG + Intergenic
1104864891 12:131947457-131947479 ATAAATGAGCATTAGAAGGCTGG - Intergenic
1105289631 13:19043375-19043397 ATTAATAAGGAGAAGGCTGCTGG + Intergenic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1107171698 13:37350041-37350063 ATATAAAAGCAGATGTAGGCCGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108950246 13:56083617-56083639 AGAAAATAGCAGAAGGAGGGTGG + Intergenic
1109241263 13:59892072-59892094 ATAAGTAAGCAGAGGGAGAAGGG + Intronic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1112061500 13:95743853-95743875 TTAAATAAGCAGGAGGCAGCCGG - Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1116101686 14:40446140-40446162 ATAACTAATCAGAAAGAGACTGG + Intergenic
1116656050 14:47655113-47655135 ATAAACAAGCAGATAGATGCTGG + Intronic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1118642824 14:67808151-67808173 ATAAATGAGGAGTTGGAGGCTGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119991782 14:79206328-79206350 AAAACTCAGCTGAAGGAGGCTGG + Intronic
1119993444 14:79225917-79225939 ACAAAGAAGCAGAAGAATGCAGG - Intronic
1120560150 14:85981672-85981694 ATGCTTAAGCAGAAGGAAGCAGG - Intergenic
1120620877 14:86763112-86763134 ATAAAGAAGCACATGGGGGCCGG + Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1121135373 14:91493090-91493112 AAAAATAAGAAAAAGTAGGCTGG + Intronic
1121200615 14:92114116-92114138 ATAAAGAATTACAAGGAGGCTGG - Intergenic
1202876452 14_KI270722v1_random:6743-6765 ATAAAAAAAAAGAAGGAGGTTGG - Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1125374649 15:39015516-39015538 ATAAATAAACAGAGTAAGGCCGG - Intergenic
1125623827 15:41089453-41089475 AGAAATAGTCAGAAGGCGGCTGG + Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1126712324 15:51472817-51472839 ATAAATAAGAGTAGGGAGGCTGG - Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128151537 15:65366406-65366428 ATAAAGAAAGAGAAGGAGGGAGG + Intronic
1128280838 15:66392956-66392978 ATAAATAAGTAAAATGTGGCAGG - Intronic
1128527721 15:68423793-68423815 ATCAACAAGAAGGAGGAGGCCGG - Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128801096 15:70497630-70497652 ATAAATAAGCAGCAAGAGCAAGG - Intergenic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1132386731 15:101406037-101406059 ATAAATTAGAAGCAGGCGGCCGG - Intronic
1132839789 16:1973447-1973469 ATAAATAAGTAAAAAGAGGTAGG + Intronic
1133320970 16:4913697-4913719 AGAAAACAACAGAAGGAGGCTGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134189287 16:12108832-12108854 ATTAATAAAGAAAAGGAGGCTGG + Intronic
1134349735 16:13425513-13425535 ATAAATAAGCAAAAGCAGGGAGG + Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134652993 16:15925586-15925608 ATAAATAAGAAGAAAGGGTCAGG + Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134886298 16:17795733-17795755 TTAAATAAGCAGACACAGGCTGG + Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1137354884 16:47751785-47751807 ATAGATAAGCTCAAGGAGTCAGG + Intergenic
1137430028 16:48411200-48411222 ATAAATAATAATAAGAAGGCCGG - Intronic
1137526389 16:49240087-49240109 ATAAAGTTGCAGAAGGAGGCAGG - Intergenic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1137706943 16:50542132-50542154 AAAAATAAGCAGGAAGAAGCAGG - Intergenic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139453293 16:67049496-67049518 AAAAATAAACAGAATGGGGCCGG - Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142879467 17:2873161-2873183 ATAAAGAAGCTGCAGTAGGCTGG + Intronic
1143561140 17:7695903-7695925 TTTAATGAGCAAAAGGAGGCAGG - Intronic
1143975997 17:10830233-10830255 ATCTATAAACAGAAGCAGGCAGG + Intronic
1144404513 17:14939840-14939862 GGCAATAAGCAGAAGGGGGCTGG - Intergenic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145064292 17:19751694-19751716 ATAAAAAAAAGGAAGGAGGCTGG + Intergenic
1145855253 17:28150123-28150145 AGAAATAAGCACACTGAGGCTGG - Intronic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1145978754 17:28999207-28999229 TGAAATAAGCAGAAGGACCCAGG + Intronic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147421731 17:40325287-40325309 ATAAATAAATAAAAAGAGGCTGG + Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147680018 17:42236912-42236934 GTAAATAAGCAGAAGATGGCGGG - Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148140173 17:45322603-45322625 ATAAAAATTCAGAATGAGGCTGG - Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148610069 17:48959148-48959170 AAAAATAAGTAAAATGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1148907515 17:50920646-50920668 GCAAATAAGCAGAAGGGGGCTGG - Intergenic
1149893110 17:60407799-60407821 AAAAAAAAGCAGAAACAGGCCGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1151536710 17:74743087-74743109 AGAAATGGTCAGAAGGAGGCAGG - Intronic
1151772424 17:76172988-76173010 ATAAAAAAGAAAAAGAAGGCTGG + Intronic
1151910043 17:77076492-77076514 ACAAATGAGCAGAAGAAGACAGG + Intergenic
1152096444 17:78274716-78274738 AAAAATAGGCAGAAGGGGCCGGG + Intergenic
1152793499 17:82294501-82294523 AAAACTCAGCAAAAGGAGGCTGG - Intergenic
1153112168 18:1604664-1604686 ATAAATAAATACTAGGAGGCAGG - Intergenic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1154114178 18:11596763-11596785 ATAAAAAAATAGAAAGAGGCTGG + Intergenic
1155473428 18:26214148-26214170 ATAATAAAGCTGTAGGAGGCAGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156201377 18:34835919-34835941 ACAAAGAAGCATAAGAAGGCAGG + Intronic
1156327438 18:36086637-36086659 AGAAATAATCAGCAGAAGGCTGG + Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156424446 18:36994686-36994708 TAAAATAAGCAGAATGAGTCAGG - Intronic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1157283226 18:46359722-46359744 AGCAATAAGTAGAAGGAGCCTGG - Intronic
1157334900 18:46730817-46730839 GGAAATAAGCAAAAGTAGGCTGG + Intronic
1157933642 18:51850545-51850567 ATACATAAACACCAGGAGGCAGG - Intergenic
1158154059 18:54405607-54405629 AAAATTAAGCAGGGGGAGGCAGG - Intergenic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1158942842 18:62421641-62421663 ATAGATAAGAAGAAGGAGAGGGG - Intergenic
1159169693 18:64749837-64749859 ATCAATGAGCAGAAGGACTCAGG - Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160664521 19:318758-318780 AAAAATCAGTAAAAGGAGGCTGG + Intronic
1161427126 19:4209909-4209931 ATAAGTAAGCGGCAGGAGGCAGG + Intronic
1161503312 19:4629733-4629755 ATAAGAAGGAAGAAGGAGGCTGG - Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161820467 19:6527784-6527806 ATAAATTTGCAGAAGAAGGCCGG - Intergenic
1162062843 19:8107263-8107285 ATAAATGGACAGAAGGAGGGGGG + Intronic
1162404507 19:10465514-10465536 ACAAATGAGCAGGGGGAGGCTGG - Intronic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164572235 19:29382782-29382804 ATAAACAAGGAGAAGGAGCTTGG - Intergenic
1165656868 19:37541380-37541402 AGAAATAAGCAGTTGAAGGCTGG + Exonic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1166757191 19:45200476-45200498 AAAATTAAGCAGAAAGGGGCTGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167809724 19:51818611-51818633 ATAAATATTCAGAAAGAGCCAGG + Intronic
1167963526 19:53126064-53126086 ATAAATGAGCAGAATGATACAGG + Intronic
1167975316 19:53222058-53222080 ATTAGTAAGGTGAAGGAGGCAGG - Intergenic
1168180560 19:54660148-54660170 ATACAAAAGCAAAATGAGGCCGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925465116 2:4100336-4100358 ATAAATAAGCTCACAGAGGCTGG - Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
926824844 2:16895014-16895036 ATAAATAGGAAGTAGAAGGCAGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927529565 2:23782111-23782133 ATAAAGAAACAGAAGTTGGCTGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927775228 2:25897587-25897609 AAAAATATCCAGAAGCAGGCAGG - Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928092290 2:28382344-28382366 ATAAATAAACAGACGGTGGGTGG + Intergenic
928450079 2:31370843-31370865 ATAAATAAAGTGAAGAAGGCAGG + Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929597491 2:43185540-43185562 ATAAATTAGAAAAAGGTGGCCGG + Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930109488 2:47666425-47666447 AGAAAAAAGCAGAAGGAGAAAGG + Intergenic
930200574 2:48548794-48548816 ATAAAAAAGAAAAATGAGGCCGG - Intronic
931101428 2:59005892-59005914 ATAAATACCCAGAAGGATGGTGG - Intergenic
931386637 2:61803823-61803845 ATAAATAAATAAAAAGAGGCTGG + Intergenic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
932135068 2:69221543-69221565 ATAACAAAGCAGAAGGTGGCTGG + Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932603153 2:73144049-73144071 AAATATAAGCAGAGGGAGTCTGG - Intronic
933301706 2:80547986-80548008 ATAAAAAAGCAGAAATGGGCTGG - Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
937169543 2:119851796-119851818 ATAATTCAGCAGCCGGAGGCAGG - Intronic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937960466 2:127454156-127454178 AGAAACAAGCAGATGGAGTCAGG - Intronic
938897753 2:135768996-135769018 ATAAACAAACAAATGGAGGCTGG - Intronic
939786828 2:146524903-146524925 ACAAATAAATAGAAGTAGGCGGG - Intergenic
939898130 2:147817522-147817544 AAAAATAAACATAAGCAGGCTGG + Intergenic
940454178 2:153874327-153874349 TTAAACAAGCAGAAGCAGCCAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942568331 2:177288562-177288584 ACAAACAAACAGATGGAGGCAGG - Intronic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
943963592 2:194300341-194300363 ATATATAAGCAAAAAGAGGTAGG - Intergenic
944117875 2:196208741-196208763 AGGAATACACAGAAGGAGGCTGG + Intronic
944841449 2:203627844-203627866 ATAAATAAATAAAAGGAGGTGGG - Intergenic
945389579 2:209247659-209247681 ATAGAAAAGCAACAGGAGGCCGG + Intergenic
945703614 2:213201645-213201667 ATAAAGAAGGAGGAGGAGGGGGG - Intergenic
945925394 2:215797689-215797711 GTAAATAATTAAAAGGAGGCTGG + Intergenic
946731562 2:222714753-222714775 ATAACTCAGCTGAATGAGGCTGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947189461 2:227487119-227487141 AGAAATTAACAGAAGGAGGGCGG - Intronic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1169474872 20:5922506-5922528 AGAAATGGGCAGAGGGAGGCGGG + Exonic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1169957867 20:11125640-11125662 ATTAATAAGTAGGAGGAAGCTGG + Intergenic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170701925 20:18711713-18711735 CTAAATAAGCACAATGAAGCAGG - Intronic
1170708264 20:18765798-18765820 ATAAATAAGCAGAAAGAAGGAGG - Intergenic
1170869681 20:20193908-20193930 AGAAATAATTAGAATGAGGCTGG - Intronic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1171330400 20:24332415-24332437 ATAAATGAGGGGAAGGAGACAGG - Intergenic
1171395479 20:24830122-24830144 GCAAATAAGCAGGATGAGGCTGG - Intergenic
1172266280 20:33617409-33617431 ATAAACTAGCTGAAGGAGGAAGG + Intronic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172685833 20:36753708-36753730 ATCAATAAGAAGATGGAGGCTGG + Intronic
1172769481 20:37371288-37371310 AAAAATAAGAAGAAATAGGCTGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174288958 20:49493555-49493577 ATAAATAAGAAGAGTGAGGCCGG - Intergenic
1175026440 20:55907508-55907530 AGAAATAAGAAGAAGGAAGAGGG + Intergenic
1176660400 21:9629736-9629758 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177022050 21:15873787-15873809 ATAAAAAAGCTGATAGAGGCCGG - Intronic
1177307777 21:19342548-19342570 ATTAAAAACCAGACGGAGGCTGG - Intergenic
1177574304 21:22930965-22930987 ATAAATAAGTAGAGGGTGACTGG - Intergenic
1177987362 21:27993579-27993601 TTAAATAAGCAAAAGGGGCCTGG + Intergenic
1178559989 21:33629557-33629579 ATAAAAAATCAGTAGGAGGCTGG - Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1181382568 22:22518488-22518510 ATAAACATGCAAAAGGAAGCGGG + Intronic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181565787 22:23736552-23736574 ATAAAGAAACAGAAGCTGGCCGG + Intergenic
1182236017 22:28877273-28877295 ATAAATAAAAATAAGGTGGCTGG - Intergenic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182842154 22:33399842-33399864 TTAAAAAAGCAGAAGTTGGCCGG - Intronic
1182984269 22:34701709-34701731 ATAAATAAAAAGATGCAGGCCGG + Intergenic
1183948504 22:41339951-41339973 ATGACCAAGCCGAAGGAGGCGGG - Exonic
1185195059 22:49464175-49464197 ATGAATAAACAGTAGAAGGCAGG - Intronic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949823264 3:8138312-8138334 ATAAAGAAACAAAAGGAGGCTGG + Intergenic
950279377 3:11693407-11693429 ATACAAAAGCAGAAGGGAGCAGG + Intronic
952529007 3:34243979-34244001 ATCATTAAGCAAAAGGAGCCAGG - Intergenic
952640352 3:35586937-35586959 ATAAGTAGGCAGAAGCAAGCAGG + Intergenic
952961475 3:38593358-38593380 ATAAATCAGTAGGAGAAGGCTGG - Intronic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954853554 3:53623890-53623912 ATCAATAAGTAGAAGGAGATTGG + Intronic
954888888 3:53904489-53904511 ATAAAAGAGCAGAAGGGGGTTGG + Intergenic
954895713 3:53973168-53973190 ATAAAGAATAAGAAGGAAGCTGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
958196330 3:90246007-90246029 ATAAATAAATAAAAGGAGCCAGG - Intergenic
958419518 3:93914649-93914671 ATAAATAAATAAAAGGAGCCAGG - Intronic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959882483 3:111460665-111460687 GTAAATAAGCAGCAAGAGGGTGG + Intronic
960671228 3:120157032-120157054 ATAAATCAGCATAAGGAGATGGG - Intergenic
960710478 3:120522610-120522632 AAAAATCAGCTGAAGGTGGCTGG + Intergenic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961351022 3:126302757-126302779 ATAAGTAAGAAGTAGGAGGATGG - Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961698182 3:128721150-128721172 ATCACAAAGCAGATGGAGGCAGG - Intergenic
961852395 3:129834189-129834211 ATAAATAAGCAGAAAGATGTGGG + Intronic
962039035 3:131685485-131685507 ATTAAGAAGTAAAAGGAGGCTGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963613196 3:147498851-147498873 ATAAATAACAAGAAGGAGTTGGG - Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964183180 3:153912517-153912539 CTAAATAAACATAGGGAGGCAGG - Intergenic
964687081 3:159407715-159407737 ATAAATAACAAGAAGAAGTCTGG + Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
964758540 3:160111199-160111221 ATAAAAAACCAGGAGGTGGCTGG - Intergenic
964858650 3:161175068-161175090 ATAAAAAAACAAAATGAGGCTGG - Intronic
965932568 3:174063892-174063914 ATAAATAAAAACAAGGGGGCTGG + Intronic
966685585 3:182691129-182691151 ATAGATAAGGAAAAGGAGGGGGG + Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
967023928 3:185547360-185547382 ATAAAAAAGCAGTATGAGTCAGG - Intronic
967163961 3:186763914-186763936 ATAAATAAGAAGAAGGGGTGAGG - Intergenic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
967310945 3:188105543-188105565 GTAAAAAAGTAGAAGCAGGCTGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968202174 3:196764096-196764118 ATACAAAAGCAGCAGCAGGCCGG - Intronic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969649466 4:8455658-8455680 TTAAATGAGCAGAAGCAGCCAGG - Intronic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971391268 4:26187723-26187745 ATAAATTAGTAGATGGGGGCTGG + Intronic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971709047 4:30087847-30087869 ATAATTAAGCTTAATGAGGCAGG - Intergenic
972083088 4:35178667-35178689 ATAAAAAAACAGAAGGACGACGG + Intergenic
972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG + Intronic
974476309 4:62386728-62386750 TCAAATAAGCAGAAGGATGGAGG - Intergenic
974752234 4:66155921-66155943 ATAATTAAGGGGAAGGAAGCAGG - Intergenic
975189401 4:71442326-71442348 TTAAATTAGCAAAAGGAGCCAGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
978220642 4:106269972-106269994 ATAAATTTGCAAATGGAGGCAGG - Intronic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
979413998 4:120413835-120413857 ATAATTAAGCAGAAGTAGAAGGG + Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
980494717 4:133575797-133575819 AGAGTTAAGCAGAAAGAGGCAGG - Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
980920688 4:139083421-139083443 TTAAATGAGCAAAGGGAGGCGGG + Intronic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
982689757 4:158534541-158534563 ATTAATAATCAGAATAAGGCCGG - Intronic
982869046 4:160552853-160552875 AAAAATATACAGAAGTAGGCAGG + Intergenic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
983327722 4:166279574-166279596 ATAAGAATGCAGAAGGATGCAGG + Intergenic
983967244 4:173827909-173827931 AAAAACAAACAGAAGGGGGCAGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
985414957 4:189726681-189726703 TTAAAGCAGCAGTAGGAGGCAGG + Intergenic
985917998 5:2941669-2941691 ACAAATAAGCAGAAAAAAGCTGG - Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986910851 5:12554200-12554222 ATAAATAAACAGACGGAAACAGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987330191 5:16850249-16850271 ATAAATAAGCAACTGGAGGTTGG - Intronic
987357597 5:17078427-17078449 AAAAATAAACCTAAGGAGGCCGG + Intronic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987384709 5:17318360-17318382 ATTAAGAACCAGAAGAAGGCTGG + Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989453460 5:41614106-41614128 ATAATCAAGCAGAAGAAGACAGG - Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
991051750 5:62280122-62280144 ATCAATAAGCACAGGGAGACAGG + Intergenic
991577516 5:68120522-68120544 ATAAATAAACAAAAGGAGATGGG - Intergenic
992085483 5:73274732-73274754 AAACATAAACATAAGGAGGCAGG - Intergenic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
993392578 5:87338666-87338688 AAAAATAAGCACAAATAGGCCGG - Intronic
993502204 5:88676688-88676710 TTAAATAAACAGAAGCAGGGAGG - Intergenic
994627107 5:102233553-102233575 AAAAAAAAGCTGAAGGAGCCTGG + Intergenic
994736684 5:103563987-103564009 ATAAAGAAGCATAGGGCGGCCGG - Intergenic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
995077181 5:107999695-107999717 GGATATAAGCAAAAGGAGGCAGG + Intronic
995085943 5:108109234-108109256 AGAAAATAGCAGAAGGAGGAAGG + Intronic
995369770 5:111406170-111406192 ATAAATTAGGAGAAGGAAACAGG - Intronic
995759425 5:115547620-115547642 ATTAATAAGTAGATGGAGGCTGG - Intergenic
996009987 5:118471675-118471697 ATAAAAAAGGTCAAGGAGGCTGG + Intergenic
996545334 5:124671932-124671954 ATAAAGAAGCCCAAGGGGGCTGG - Intronic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997274859 5:132576673-132576695 ATAAAGGAGAAGAAGGAGACAGG - Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999124140 5:149234239-149234261 AGAAATAAGCTAAAGGAGGTGGG + Intronic
999249670 5:150175082-150175104 ACAAAGAAGCTGAAAGAGGCAGG - Intronic
1000762743 5:165246259-165246281 ATAAATAAACAGGAGGAGTGTGG + Intergenic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1001825134 5:174738613-174738635 TTAAATAAGAAGTAGTAGGCCGG + Intergenic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002792277 6:445337-445359 GTAAACAAGCAGAGGGAGGCAGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1004077758 6:12360802-12360824 ATAAATGAACATAAGGAGGAAGG + Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004347789 6:14864426-14864448 AGACATAAGCAGGAGGAAGCTGG - Intergenic
1004357463 6:14942496-14942518 AGAAAATAGCAGAAGGAGGAAGG + Intergenic
1004380978 6:15132175-15132197 AGAAAAAGGCACAAGGAGGCGGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004569880 6:16834919-16834941 ATAAATAAATAAAAGGAGGGGGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005634555 6:27740904-27740926 TTAAAAGAGCATAAGGAGGCCGG + Intergenic
1005845017 6:29770264-29770286 ATTACAAAGCTGAAGGAGGCGGG + Intergenic
1006110125 6:31739492-31739514 ATAAATAAGCGGAAACAAGCAGG - Intronic
1006509557 6:34514778-34514800 AGAAACGAGCAGAAGGAGGTGGG + Intronic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006986225 6:38177399-38177421 ACAGATCAGTAGAAGGAGGCAGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007498435 6:42277839-42277861 ATAAATAAGAAGAAGAAAGAAGG + Intronic
1007977068 6:46112758-46112780 AGAAATAAGAACAAGCAGGCTGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008376945 6:50802555-50802577 ATAAAAAAGCAGCAATAGGCTGG - Intergenic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009685098 6:66946818-66946840 ATAAAAATGCAGAAGAAGACAGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010867588 6:80998393-80998415 ATAAATAAGCACAATAAGGAAGG + Intergenic
1012426837 6:99124135-99124157 ATAAATAAATAAAAGAAGGCAGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013525262 6:110968283-110968305 AAAAATAAGTAAAATGAGGCCGG + Intergenic
1013626960 6:111948109-111948131 AAAAATAGGCAGAGGGAGGTGGG + Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014676807 6:124377899-124377921 ATACATAAGAGAAAGGAGGCTGG - Intronic
1014884846 6:126767137-126767159 ATAGATATGCAGAAGGAAGGAGG - Intergenic
1015750582 6:136554457-136554479 GTAAATAAGAAAATGGAGGCTGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016000473 6:139036239-139036261 TTAAAACAGAAGAAGGAGGCAGG - Intronic
1016299464 6:142614227-142614249 ATAAAGAAGCTGCAGAAGGCAGG - Intergenic
1016491031 6:144602433-144602455 AGAAATATGCTGTAGGAGGCCGG - Intronic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017386504 6:153891033-153891055 TTAAAAAAGCAGAGAGAGGCCGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1018071995 6:160173098-160173120 ATAAATAAGCAGATGTAGCGAGG + Intronic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1019025323 6:168957438-168957460 ATAAATAAGCATAATTATGCTGG + Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020528521 7:9296845-9296867 ATAAATTAGCACAAGAAAGCAGG + Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023286569 7:38627245-38627267 GTAAAAATGCTGAAGGAGGCCGG + Intronic
1024531364 7:50395672-50395694 ATAAATAAGAAGAAAAGGGCAGG - Intronic
1025788286 7:64664232-64664254 ATAAACAGGCAGGGGGAGGCGGG - Intergenic
1025814451 7:64898021-64898043 AGAAATCAGCAAAATGAGGCCGG - Intronic
1025900536 7:65740833-65740855 GGAAAGAAGCAGAAGGAAGCCGG + Intergenic
1026002283 7:66569938-66569960 ATAAATAAGAACAATAAGGCCGG - Intergenic
1026431002 7:70347236-70347258 AGAATTGAGCAGAAGGAGGTGGG - Intronic
1026886156 7:73947648-73947670 AGAAATATTCAGAAAGAGGCTGG - Intergenic
1026891903 7:73987255-73987277 ATAAATAAGTAAAATGGGGCCGG - Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027038814 7:74946138-74946160 ATAAATAACTAAATGGAGGCTGG - Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028726000 7:94088866-94088888 ATAAATACCTAGAGGGAGGCAGG + Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1030665979 7:112279203-112279225 ATAAATAACCAGAAGTGGGGTGG + Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031901846 7:127419350-127419372 ATAAATTAAGAGCAGGAGGCAGG + Intronic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1034073111 7:148206959-148206981 AGAAATAAATAGCAGGAGGCGGG - Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1035090393 7:156305507-156305529 ATAAATGAACACAAGGAGCCAGG + Intergenic
1035094932 7:156346409-156346431 ACACATCAGCAGAAGGAAGCAGG + Intergenic
1035417130 7:158699078-158699100 ATAATAAAGCAGGTGGAGGCTGG - Intronic
1036082237 8:5569425-5569447 ATAAATATATAGAAGGAGGTAGG + Intergenic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1040674609 8:49733707-49733729 ATAAACAATTATAAGGAGGCTGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1044403958 8:91805396-91805418 ATCAGTAAGCATAAGAAGGCTGG + Intergenic
1044554238 8:93544704-93544726 ATAAATAAAAAGAAGGAGTAAGG + Intergenic
1044861677 8:96529938-96529960 GTAAATAAGCAGAATAAAGCTGG - Intronic
1044941323 8:97347206-97347228 ATAAATAAATAAAAGGAGCCTGG - Intergenic
1044972083 8:97629750-97629772 ATAAATAAACAGAACCTGGCTGG + Intergenic
1045740187 8:105349054-105349076 ATAAATGAGCCCAAGGAGCCTGG + Intronic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1045974706 8:108119072-108119094 ATACATAAGCAGAACAGGGCTGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046614922 8:116465585-116465607 ATAAATAAACTGAAGCAGGAGGG + Intergenic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1046899533 8:119509156-119509178 ATAGCTAAGCAAGAGGAGGCAGG + Intergenic
1047034509 8:120922382-120922404 ATAAAGAAGCCCAAGGAGACAGG + Intergenic
1047107494 8:121749296-121749318 ACAAATAAGCAGGAGGGGGAAGG + Intergenic
1047422507 8:124718680-124718702 AGATATTTGCAGAAGGAGGCTGG - Intronic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048128356 8:131663029-131663051 ATAATTCAGCAGCAGGAGCCAGG + Intergenic
1048798390 8:138172698-138172720 ATAATTATGCAGAGGGAGGGAGG + Intronic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051446114 9:17141009-17141031 ATAAATAAGCAGCAACAGACTGG + Intronic
1051864446 9:21663699-21663721 ATAAATAATAGGTAGGAGGCAGG - Intergenic
1052136044 9:24911539-24911561 AAAACTAAGCACAAGGATGCAGG + Intergenic
1053246530 9:36538912-36538934 ATAAATAAGCACATAGAGGCCGG - Intergenic
1053443482 9:38134702-38134724 ATAAATAAACACAAAGTGGCTGG + Intergenic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1054759950 9:68995507-68995529 ATGAAAAAGCAAATGGAGGCCGG + Intronic
1054944765 9:70784104-70784126 ATAAATACTCAGAAGAAGGCGGG - Exonic
1055087218 9:72326480-72326502 ATAAAGAACCAGATAGAGGCTGG + Intergenic
1055679023 9:78695497-78695519 ATAAATAACCAGAGTGAGGGAGG + Intergenic
1056031815 9:82561112-82561134 TGAAAAAAGCAAAAGGAGGCCGG + Intergenic
1056336546 9:85574628-85574650 ATATATAACCAGAAGGATACTGG + Intronic
1056477236 9:86964498-86964520 AAAACTAAGCAGAACAAGGCAGG - Intergenic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056810760 9:89762188-89762210 ATATATTAGAAGAAGCAGGCTGG + Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1059346640 9:113633445-113633467 ATAAAGAATCAGAAGCTGGCCGG + Intergenic
1059482134 9:114599819-114599841 TAAATTAAGCTGAAGGAGGCCGG - Intergenic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1060193469 9:121607794-121607816 ATAAATAAGCAGATGAATGAGGG + Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061137486 9:128743410-128743432 ATAAATAAATAAAAGAAGGCTGG - Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1203637970 Un_KI270750v1:131579-131601 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1203652040 Un_KI270751v1:134584-134606 ATAAAAAAAAAGAAGGAGGTTGG + Intergenic
1185445873 X:257865-257887 AAAAATAAGCGGAAAGTGGCCGG + Intergenic
1187500911 X:19837735-19837757 ATAAAAAAGGAAAAGGTGGCTGG - Intronic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188173764 X:26962149-26962171 GTAAATAAGCAGGATTAGGCAGG - Intergenic
1188484340 X:30666827-30666849 ATAAATACACAGAAGGAGACTGG + Intronic
1189443769 X:41061590-41061612 ATCAAAAAGCATAATGAGGCCGG + Intergenic
1189501169 X:41560558-41560580 ATTAATAAGCAAAAAGTGGCTGG - Intronic
1189880368 X:45485251-45485273 TTAAAAAAGAAGAAAGAGGCTGG - Intergenic
1189985423 X:46549375-46549397 ATAAATAAGCCTAAGAAGGTTGG + Intergenic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190443755 X:50502340-50502362 ATCAATAAGGAGAAAGTGGCTGG + Intergenic
1190679615 X:52813704-52813726 ATAAATAAGAAAACTGAGGCCGG + Intronic
1190883288 X:54508888-54508910 AAAAAAAAATAGAAGGAGGCTGG - Intergenic
1190965053 X:55291707-55291729 ATAAAAAAGAATAAAGAGGCCGG - Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192318685 X:70071085-70071107 TTAAAAATGCAGAAGAAGGCCGG - Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192816334 X:74596541-74596563 AAAAATATGCAGCACGAGGCTGG - Intronic
1193022501 X:76805395-76805417 AGAAATAAGGAGAAAAAGGCAGG - Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1195943838 X:110188661-110188683 ATAAATAGTCAGCAGTAGGCTGG - Intergenic
1196350122 X:114719762-114719784 GTAAAAAAGCATAAGGAAGCTGG + Intronic
1196921157 X:120586542-120586564 AAAAATAGGAAGGAGGAGGCGGG + Intergenic
1197300290 X:124771528-124771550 ATACGTAAGCTGAAGAAGGCAGG + Intronic
1198251890 X:134887124-134887146 ATAAAGAAACAGAAGTAGCCTGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic