ID: 1100581499

View in Genome Browser
Species Human (GRCh38)
Location 12:95943740-95943762
Sequence GGACCCTGATGCGTTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100581499_1100581505 19 Left 1100581499 12:95943740-95943762 CCCATTGGAACGCATCAGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1100581505 12:95943782-95943804 TCACTGTCCAACCATCAGAAGGG 0: 1
1: 0
2: 1
3: 22
4: 241
1100581499_1100581508 26 Left 1100581499 12:95943740-95943762 CCCATTGGAACGCATCAGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1100581508 12:95943789-95943811 CCAACCATCAGAAGGGGTTGAGG 0: 1
1: 0
2: 1
3: 10
4: 149
1100581499_1100581504 18 Left 1100581499 12:95943740-95943762 CCCATTGGAACGCATCAGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1100581504 12:95943781-95943803 ATCACTGTCCAACCATCAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 163
1100581499_1100581506 20 Left 1100581499 12:95943740-95943762 CCCATTGGAACGCATCAGGGTCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1100581506 12:95943783-95943805 CACTGTCCAACCATCAGAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100581499 Original CRISPR GGACCCTGATGCGTTCCAAT GGG (reversed) Intronic