ID: 1100582762

View in Genome Browser
Species Human (GRCh38)
Location 12:95950705-95950727
Sequence GCAGACACCACAACTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100582762_1100582766 19 Left 1100582762 12:95950705-95950727 CCATCTCTAGTTGTGGTGTCTGC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1100582766 12:95950747-95950769 GGAAGAGAAGACAATCTTACCGG 0: 1
1: 0
2: 1
3: 20
4: 254
1100582762_1100582763 -2 Left 1100582762 12:95950705-95950727 CCATCTCTAGTTGTGGTGTCTGC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1100582763 12:95950726-95950748 GCATTCCAGCCAGTAAGAATAGG 0: 1
1: 0
2: 5
3: 24
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100582762 Original CRISPR GCAGACACCACAACTAGAGA TGG (reversed) Intronic
901787477 1:11634319-11634341 GCAGGCACCAAACCTGGAGAGGG + Intergenic
903481198 1:23654624-23654646 CCAGACACCACAGCAACAGATGG + Intergenic
905809579 1:40902398-40902420 ACAGACACCACCCCTAGGGAAGG + Intergenic
906180796 1:43817035-43817057 GAATATAACACAACTAGAGAGGG - Intronic
907874528 1:58472885-58472907 GCATACACCACAAAGCGAGAGGG + Intronic
907953211 1:59203939-59203961 TCACACACCACCACCAGAGAGGG + Intergenic
909209865 1:72809327-72809349 GCAGACACCAGAATCACAGAAGG + Intergenic
911395917 1:97309713-97309735 GGTGACAACACAACTAGAAAAGG + Intronic
911603375 1:99871576-99871598 GCAGAAAACAGAACTAGAGTAGG + Intronic
912621904 1:111169172-111169194 GCAGAACCCACAGATAGAGAGGG + Intronic
912639079 1:111327311-111327333 ACAGACACAACAAGGAGAGATGG - Intergenic
915427636 1:155840637-155840659 ACAGACAGCTCATCTAGAGAAGG + Intronic
915561268 1:156689642-156689664 CGAGACACCACACCTAGCGAAGG - Intergenic
917004083 1:170393001-170393023 GCAGAGCCCACAAATACAGATGG + Intergenic
918653183 1:186991225-186991247 TCAGACACCAAAACCTGAGATGG + Intergenic
919039868 1:192371798-192371820 GCTGACTCCACAACTAGACTGGG - Intergenic
923122188 1:231002340-231002362 GCAGACAGCAGAATTAGGGAGGG + Intergenic
1065399297 10:25278182-25278204 GCACACACAAAAAATAGAGATGG + Intronic
1066305807 10:34139582-34139604 GCAGACACCAGGACTGGAGTAGG + Intronic
1067299893 10:44998602-44998624 GCAGGGACCAAAACCAGAGAAGG + Exonic
1067351341 10:45479013-45479035 GCTGACACCAAAACCAGACAAGG + Intronic
1067558240 10:47287063-47287085 GCAGACAAAACAGCTAGCGAAGG + Intergenic
1076585401 10:131543901-131543923 GCAGACCCCAGATTTAGAGACGG - Intergenic
1081439132 11:43061214-43061236 GCAGATTCCACATCTAGTGAGGG + Intergenic
1082660281 11:55900829-55900851 CCAGACACAACTTCTAGAGAAGG - Intergenic
1084044495 11:66560847-66560869 GCAGACCCCACATCTGAAGATGG - Intronic
1085869853 11:80336318-80336340 GCTGACACCATCACTAGAGCAGG - Intergenic
1088189670 11:107214374-107214396 TCAGCCATCACAACTTGAGAAGG + Intergenic
1089254438 11:117186853-117186875 GCAGACACCATCGCTAGACATGG - Intronic
1092750799 12:11717559-11717581 TCAGACATGACAGCTAGAGATGG - Intronic
1092774379 12:11929590-11929612 CCAGACACCACACATAGAGAAGG + Intergenic
1095633032 12:44400194-44400216 GCAACCACCAGAGCTAGAGAGGG + Intergenic
1095671759 12:44869635-44869657 GCAGAGGTCACAAATAGAGATGG - Intronic
1095980663 12:47972729-47972751 CCAGAAACCAAAACTTGAGAAGG - Intergenic
1096842492 12:54388323-54388345 GCTGACAGCACAACTTGAGCAGG - Intronic
1098525097 12:71478453-71478475 GCAGAGTCAACAATTAGAGAAGG - Intronic
1100582762 12:95950705-95950727 GCAGACACCACAACTAGAGATGG - Intronic
1100782546 12:98044717-98044739 GCAGACCCCACAGATACAGAGGG + Intergenic
1101342048 12:103850878-103850900 TCAGAAACCAAAACTAGAAATGG + Intergenic
1104351884 12:128051345-128051367 GTAGACACCTCCACTATAGATGG - Intergenic
1107254369 13:38405927-38405949 GCAGACACCAAAATAAGAGATGG - Intergenic
1112667698 13:101595415-101595437 GCAATCCCCAAAACTAGAGATGG - Intronic
1112931710 13:104747894-104747916 GCAGACACAACATCTACAGAGGG - Intergenic
1114852210 14:26394853-26394875 GCAGAAACCACAGTGAGAGAGGG - Intergenic
1118436839 14:65779271-65779293 GCAGACACCAAAACCAAGGAAGG - Intergenic
1118528735 14:66676792-66676814 CCAGATACCAAAACTAAAGAAGG - Intronic
1118614049 14:67563038-67563060 GCAGACCACACAACCAGTGAGGG + Intronic
1121459741 14:94065720-94065742 ACACACACCCCCACTAGAGAAGG + Intronic
1124206597 15:27725939-27725961 GCAGACGCCAGCTCTAGAGAGGG - Intergenic
1125069063 15:35530236-35530258 CCAGACAACACAACTCCAGAAGG + Intronic
1125478742 15:40065402-40065424 GAGGACAGCACAGCTAGAGAAGG - Intergenic
1125972913 15:43926661-43926683 GTAGACAGCTCAACTACAGAAGG + Intronic
1127485549 15:59414548-59414570 GCCAACACCACACCAAGAGAAGG - Intronic
1130386755 15:83418676-83418698 GCAGTCACCACAACTCCAGTTGG - Intergenic
1131849247 15:96521063-96521085 CCTGATACCACAACTAGACAAGG + Intergenic
1132944604 16:2526070-2526092 GCAGAGACCACGAGGAGAGATGG - Intronic
1133155440 16:3871919-3871941 GCAGACAGTACAACTAGAAATGG + Intronic
1135198480 16:20415396-20415418 GCAGAAACCAGCAATAGAGATGG + Intronic
1137451655 16:48580695-48580717 GCGGAAACCACAGATAGAGAAGG - Intronic
1138292732 16:55861740-55861762 GTAAACACCACAGCTGGAGATGG + Intronic
1140280227 16:73547026-73547048 GCAGGCACCTCATCTTGAGAGGG + Intergenic
1141249810 16:82345140-82345162 GCAGAAACTCCAACTAGAAAAGG + Intergenic
1141866087 16:86750958-86750980 GGAGCCACCACAGCTATAGACGG - Intergenic
1144460166 17:15452090-15452112 GCAGTAGCCACTACTAGAGAAGG + Intronic
1146174836 17:30659227-30659249 GCAGACACAACGACTAGCAATGG - Intergenic
1146348290 17:32075251-32075273 GCAGACACAACGACTAGCAATGG - Intergenic
1147298452 17:39504017-39504039 CCAGACACCACTAGTAGGGATGG + Intronic
1147688489 17:42300989-42301011 GCAGCCACAGCAACTGGAGATGG - Intronic
1148072993 17:44919553-44919575 GCAGACACAGCAAACAGAGAAGG + Intergenic
1150015048 17:61547296-61547318 GCAGAAACCAAATCTAGACAAGG - Intergenic
1156859729 18:41821791-41821813 GCAGAGACCTCAGCAAGAGAAGG - Intergenic
1160483030 18:79260490-79260512 GCAGAAACCAGGAGTAGAGATGG + Intronic
1164574203 19:29396224-29396246 CCATCCACCCCAACTAGAGAGGG + Intergenic
1165992990 19:39826664-39826686 GCACCCACCAGAACTGGAGATGG + Exonic
925069863 2:957769-957791 GCAGCCACCAGAGCTAGAGGAGG + Intronic
926083185 2:10005047-10005069 GCTGACAGCACATCTTGAGAGGG + Intergenic
929550605 2:42888511-42888533 GCAGGCACCTCAACTTCAGATGG - Intergenic
931908413 2:66868197-66868219 GCAGCCCCCACAACTCGAGGAGG - Intergenic
933566685 2:83958655-83958677 GCAGAGACAACAACTGGAAAAGG + Intergenic
934751351 2:96796005-96796027 GCAGAGACTACAATTAGAGAGGG - Intronic
937929380 2:127192668-127192690 GCAGACACGGCCACTAGAGGTGG + Intronic
938316763 2:130334973-130334995 GCAGAAGCCAGAAATAGAGATGG + Intergenic
939985593 2:148826896-148826918 GCAGAAACCAGGAATAGAGATGG + Intergenic
940452041 2:153850713-153850735 ATAGACACCCCATCTAGAGATGG + Intergenic
942905721 2:181178438-181178460 GCAGAATCCACATATAGAGATGG + Intergenic
944083827 2:195821081-195821103 ACAGACTGCACAACTATAGAAGG + Intronic
945848240 2:214973970-214973992 GCAAACACCAAAATTAGTGATGG + Exonic
1169073587 20:2748804-2748826 GCAGCCAGCACAAGTTGAGAAGG - Intronic
1170723484 20:18904390-18904412 CCAGAAACCACCACTAGAGGAGG - Intergenic
1178194774 21:30331749-30331771 ACAGAAAGCACAACTAGGGAAGG + Intergenic
1179658742 21:42861507-42861529 GCAGAGACCCCAGCGAGAGATGG + Intronic
1182676660 22:32044147-32044169 GCAGGCCCAACAACTAGAGGAGG + Intronic
1185348046 22:50319235-50319257 CCAGACATCACAGCCAGAGAAGG - Intronic
952243411 3:31558644-31558666 CCAGATACCAAAACTAGACAAGG - Intronic
953710721 3:45268040-45268062 TCAGACATCACACCTAGAGGAGG + Intergenic
957375969 3:79357794-79357816 TCTGGCTCCACAACTAGAGAAGG - Intronic
959903578 3:111686092-111686114 GGAGAAACTTCAACTAGAGAAGG + Intronic
960998503 3:123355459-123355481 GCAGAACCCACAAATACAGAGGG + Intronic
961626518 3:128267782-128267804 GCAGCAACCAGAAATAGAGATGG + Intronic
963568987 3:146968304-146968326 GCAGAAGCCAAAAATAGAGATGG + Intergenic
965015692 3:163153911-163153933 GCAGCCAGCAGAACTAGGGAGGG - Intergenic
966965015 3:184982355-184982377 GCAGAAACCACAGCTAGAACAGG - Intronic
969727933 4:8935360-8935382 CCTGACACCAAAACTAGACATGG + Intergenic
973864444 4:55097830-55097852 GCAGAGACATCAACTAGATAGGG + Intronic
976022593 4:80647623-80647645 GCATACACCACAACTAAAAAAGG - Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
981666576 4:147233792-147233814 GCAGAAACCACAGATACAGAAGG + Intergenic
984071083 4:175113483-175113505 CCTGACACCAAAACTAGACAGGG + Intergenic
984895660 4:184537439-184537461 GCAGGCACCACAGAGAGAGACGG - Intergenic
986415834 5:7527128-7527150 GCAGCCACCACAACATGAGGTGG - Intronic
987745979 5:21972660-21972682 GCAGATACCACAACTATAATTGG + Intronic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
990240433 5:53811418-53811440 GCACACAGCCCCACTAGAGAGGG - Intergenic
991766186 5:69982762-69982784 GCAGATACCACAACTATAACTGG + Intergenic
991781133 5:70135392-70135414 GCAGATACCACAACTATAACTGG - Intergenic
991845420 5:70857845-70857867 GCAGATACCACAACTATAACTGG + Intergenic
991873577 5:71135706-71135728 GCAGATACCACAACTATAACTGG - Intergenic
992027247 5:72682095-72682117 GGAAACACCAGAAGTAGAGAAGG - Intergenic
994208290 5:97060172-97060194 GCAGCCAGCAGAACTAGGGAGGG - Intergenic
995339835 5:111045921-111045943 GCAGAGAAAACAACTAAAGAAGG + Intergenic
995457337 5:112366413-112366435 GCAGACAGCCCAACAAGAGATGG + Intronic
1000633678 5:163619276-163619298 GCAGACAGCACCACTTCAGATGG - Intergenic
1001465043 5:171956892-171956914 GAAGCCACCCCAACAAGAGAGGG + Intronic
1002605901 5:180382547-180382569 GCCAACACCACAACTAGAAGGGG + Intergenic
1004340184 6:14801486-14801508 CCAGGCACCAAAACTAGAAAAGG + Intergenic
1004421947 6:15478393-15478415 GCAGAACCCACAGATAGAGAGGG + Intronic
1005139776 6:22615448-22615470 ACAGACACTAGCACTAGAGAAGG + Intergenic
1010237586 6:73588382-73588404 GGAGACACCACATCTAGATCAGG + Intergenic
1010376406 6:75175871-75175893 GCAGACATCACAGCTACAAAAGG - Intronic
1011493609 6:87917092-87917114 GTAGATACCATAAGTAGAGAGGG + Intergenic
1011588875 6:88951832-88951854 GCAGACAGCAGAATTAGGGAGGG + Intronic
1014338639 6:120173489-120173511 GTAGCCACCCCCACTAGAGAAGG - Intergenic
1015603015 6:134928796-134928818 GGAGATACCACCAGTAGAGAGGG - Intronic
1019399570 7:844541-844563 GCAGACACAACCACAAGTGAGGG - Intronic
1021424191 7:20481194-20481216 ACAGAAACCAAAAATAGAGATGG + Intergenic
1021662314 7:22932127-22932149 TCAGAAGCCACAAATAGAGATGG + Intergenic
1023953041 7:44862825-44862847 CCAACCACCACAACTACAGAAGG + Intergenic
1024237012 7:47406505-47406527 GCAGACACCAGAACCACGGAGGG + Intronic
1025018235 7:55459348-55459370 CCTGACACCAAAACCAGAGAAGG - Intronic
1026058869 7:67008517-67008539 GCAGCCACTACAACAAAAGATGG - Intronic
1026253045 7:68687354-68687376 GCGCACACCACCAGTAGAGATGG - Intergenic
1026719219 7:72816517-72816539 GCAGCCACTACAACAAAAGATGG + Intronic
1028643164 7:93066818-93066840 CCTGACATCACAACTAGACAAGG - Intergenic
1034971430 7:155422186-155422208 GCAGACAGCACAGGGAGAGAAGG + Intergenic
1040504804 8:48037592-48037614 ACAGAAACCACAATTAGAGAAGG - Intronic
1040582827 8:48711293-48711315 CCAGACTCCTCAACTAGAGAGGG - Intronic
1041102961 8:54415147-54415169 GCAGACAACACAGCTGGAGGAGG - Intergenic
1041126397 8:54644524-54644546 GCAGAAGCCATAAATAGAGACGG - Intergenic
1041566113 8:59280738-59280760 GGAGAGACCACACCTGGAGAGGG - Intergenic
1042841448 8:73127902-73127924 GCAGAAACCAAAAATAGAGATGG - Intergenic
1044751495 8:95420781-95420803 GGAGCCACCAAAACTGGAGAGGG - Intergenic
1047842314 8:128766632-128766654 GCAGCCACCAAAATTAAAGAGGG + Intergenic
1048333350 8:133485922-133485944 GCAGTCACCTCAAGTAGGGATGG - Intronic
1048830037 8:138466981-138467003 GCAGATCCCAGAACTAAAGATGG + Intronic
1049064039 8:140299007-140299029 CCAGACAGCACCGCTAGAGATGG + Intronic
1049563733 8:143326516-143326538 GCAGACCCCACAGATAGAGCTGG + Intronic
1050071438 9:1818725-1818747 GCAGATTCCACAAATACAGAGGG - Intergenic
1051921151 9:22266974-22266996 GCAGGACCCACAGCTAGAGAGGG - Intergenic
1052711901 9:32067465-32067487 GCAGACATCAGGAATAGAGATGG + Intergenic
1055686160 9:78777238-78777260 GCAGACACCACATATAGGAATGG - Intergenic
1056724789 9:89105175-89105197 GCAAACCCCACAAGTACAGAGGG - Intronic
1060106938 9:120878459-120878481 GCAGACACCCCCACCAGACAGGG + Intronic
1060596125 9:124850178-124850200 GCAGACTGCATTACTAGAGATGG + Intergenic
1186935763 X:14449191-14449213 GCAGACACCAAAATTGAAGAGGG + Intergenic
1186992713 X:15086695-15086717 GCAGATACCACAAAAGGAGAAGG - Intergenic
1188108808 X:26173419-26173441 GCAGAAACCACTGCTAGAGCTGG + Intergenic
1189269392 X:39740254-39740276 GCAGCCACCAAAACTTGGGAAGG - Intergenic
1189775011 X:44462698-44462720 GCAGAAACAAAACCTAGAGATGG - Intergenic
1190056530 X:47184512-47184534 GCAGAGAACACAGCCAGAGAGGG + Intronic
1190442853 X:50493287-50493309 GCAGAAAACACAAATACAGAGGG + Intergenic
1190468589 X:50752359-50752381 GCAGACAACACAATTTGAGATGG + Intronic
1193242173 X:79183866-79183888 GCAGAAACCACAGATACAGAAGG - Intergenic
1193254791 X:79334995-79335017 GCAGACTCCAAAAGAAGAGAAGG - Intergenic
1194262623 X:91716262-91716284 GCAGACACTAGAATTAGGGAAGG + Intergenic
1195437456 X:104861891-104861913 GCAGAATCCACAAATACAGAGGG + Intronic
1198520959 X:137451836-137451858 GCAGAAACCAAGAATAGAGATGG - Intergenic
1198816748 X:140599657-140599679 GCCTACACCACAAATAGAGTAGG - Intergenic
1200527975 Y:4297084-4297106 GCAGACAGCAGAATTAGGGAGGG + Intergenic
1201457425 Y:14184787-14184809 CCAGATACCAAAACTAGACAAGG - Intergenic