ID: 1100586418

View in Genome Browser
Species Human (GRCh38)
Location 12:95984555-95984577
Sequence TATAAAGCAGCACCTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100586413_1100586418 -2 Left 1100586413 12:95984534-95984556 CCCCAGAAATAGCCACAATGCTA 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1100586418 12:95984555-95984577 TATAAAGCAGCACCTGGCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
1100586414_1100586418 -3 Left 1100586414 12:95984535-95984557 CCCAGAAATAGCCACAATGCTAT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1100586418 12:95984555-95984577 TATAAAGCAGCACCTGGCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
1100586415_1100586418 -4 Left 1100586415 12:95984536-95984558 CCAGAAATAGCCACAATGCTATA 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1100586418 12:95984555-95984577 TATAAAGCAGCACCTGGCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100586418 Original CRISPR TATAAAGCAGCACCTGGCTC TGG Intronic
901050345 1:6423132-6423154 AATAAAGCATCACCTAGCCCTGG + Intronic
901532355 1:9861538-9861560 GCCAAAGCAGCACCAGGCTCAGG + Intronic
907071167 1:51536248-51536270 TATAATGCATTACCTGGATCAGG - Intergenic
909693268 1:78434928-78434950 TATAAATCAGCAAATGCCTCAGG + Intronic
911271908 1:95812356-95812378 TATAAAGGAATACCTGGCTGGGG + Intergenic
917855370 1:179095077-179095099 TATACAGGAGCTCCTGGCTCAGG - Exonic
918255743 1:182745456-182745478 TTTAAAGCAGAACCTTGATCGGG + Intergenic
918496424 1:185142430-185142452 TATAAAGAAGGACCTGGATTGGG + Intronic
921047908 1:211490461-211490483 CATAGAGCAGCACCTGAGTCAGG + Intronic
921411352 1:214839557-214839579 AATAAAGCTGCAGCCGGCTCAGG + Intergenic
922534194 1:226367901-226367923 TTTAAGACAGCTCCTGGCTCAGG - Intronic
922570498 1:226631873-226631895 TATAACCCAGCCCCTGGCTCTGG - Exonic
923068301 1:230540019-230540041 TCTAAAGGAGCAGCTGGTTCAGG - Intergenic
923339528 1:232995824-232995846 TATAAAACAGCACCTGGAACTGG - Intronic
923772151 1:236947031-236947053 TAGAAAGAACCACCTGGTTCAGG - Intergenic
923772157 1:236947067-236947089 TAGAAAGAAGCACCTGGTTCAGG - Intergenic
1064234630 10:13562903-13562925 TATAAAGGAACACCTGACTCTGG + Intergenic
1065013993 10:21444603-21444625 TATAAAGAAGCACCTGAGACTGG - Intergenic
1065094042 10:22263370-22263392 TAAAAGGCAGAGCCTGGCTCTGG + Intergenic
1066410552 10:35164754-35164776 TATAAAGGAATACCTGGCTGGGG + Intronic
1067798404 10:49337906-49337928 CAGAAGGCATCACCTGGCTCAGG - Intergenic
1068573915 10:58662112-58662134 TATTGAGTAGCACCTGCCTCTGG + Intronic
1068591346 10:58856021-58856043 TACAAAGCAGTACCTGGAACTGG - Intergenic
1068645134 10:59457751-59457773 CATAAAGCAGGAGCTTGCTCAGG + Intergenic
1070100361 10:73380156-73380178 TATAAACCACCAAATGGCTCAGG - Exonic
1070872094 10:79765008-79765030 TATAAAACAGGAGCTTGCTCAGG + Intergenic
1071135822 10:82452964-82452986 TATAATGTAGTCCCTGGCTCAGG + Intronic
1071639012 10:87287176-87287198 TATAAAACAGGAGCTTGCTCAGG + Intergenic
1071656226 10:87450774-87450796 TATAAAACAGGAGCTTGCTCAGG - Intergenic
1073475607 10:103750706-103750728 TAGAACCCAGCACCTGACTCCGG + Intronic
1074583545 10:114744733-114744755 CATGAAGCAACACCAGGCTCTGG + Intergenic
1075140671 10:119832307-119832329 TATAAATCAGCAACTGGCATAGG + Intronic
1076682540 10:132181171-132181193 TGGAGAGCAGCAGCTGGCTCTGG + Intronic
1077530157 11:3091271-3091293 GAAAAAGCAGAACCTGGCTGTGG + Intronic
1083864872 11:65448314-65448336 TGAAAAGCAGCACCTCACTCTGG + Intergenic
1084535328 11:69753084-69753106 TACAAATCAGGACCTGGCCCTGG + Intergenic
1086897757 11:92333426-92333448 AGTAAAGCAGCAGCTGGCCCCGG + Intergenic
1089340756 11:117755783-117755805 AACAAAGGAGCACCTGGCTGTGG + Intronic
1091385461 12:91918-91940 CATCAAGGAGCAGCTGGCTCTGG - Intronic
1092598807 12:10035899-10035921 TAAAAAGCAGTACCAGGCACCGG - Intronic
1092641298 12:10513635-10513657 TCTAAAGCTGAACATGGCTCAGG - Intronic
1094287885 12:28815328-28815350 TATACAGCAGGTCCTAGCTCTGG + Intergenic
1094496261 12:30991185-30991207 TAGAATGCAGCACCAAGCTCAGG - Intronic
1095379549 12:41573614-41573636 GAGAAAGCAGCACCTGGTTAGGG + Exonic
1095819425 12:46461128-46461150 CTTAAAACAGCATCTGGCTCAGG + Intergenic
1096773528 12:53950921-53950943 TAGAAAGCAGCACCTGGGGAAGG + Intergenic
1097842555 12:64336106-64336128 TATATAGCAATACCTGACTCAGG + Intronic
1097958638 12:65511456-65511478 TCTCCAGCAGCACATGGCTCAGG + Intergenic
1100291906 12:93223620-93223642 TATAGAGTAGAACCAGGCTCTGG - Intergenic
1100586418 12:95984555-95984577 TATAAAGCAGCACCTGGCTCTGG + Intronic
1101761529 12:107662635-107662657 AATAAAGCAGCACGTGCCTTTGG + Intergenic
1104194745 12:126524431-126524453 TATAAAGGAGAAGCTGGCTATGG + Intergenic
1106369126 13:29114179-29114201 TATAAAGAAGTACCTGGGACTGG - Intronic
1106825921 13:33520354-33520376 TGTAAAACAGCATCTGTCTCAGG - Intergenic
1106986205 13:35354371-35354393 TATAAAGCAGTACATGGTTTGGG + Intronic
1109242156 13:59902496-59902518 TATAAAGAAACACCTGACACTGG - Intronic
1113262330 13:108578496-108578518 TATAAACAAGCATCTGGCCCAGG + Intergenic
1114675864 14:24440099-24440121 TTTAAGGCAGCCCCTAGCTCTGG + Exonic
1119165731 14:72490922-72490944 TAAAAAGCAGAATCTGACTCAGG + Intronic
1119516069 14:75249461-75249483 AACAAAGCAGCATCTGGCACAGG + Intronic
1124364312 15:29061480-29061502 TAGAAAGCACCAGCTGGGTCAGG - Intronic
1128389931 15:67175864-67175886 TACAATGCAGCCTCTGGCTCCGG + Intronic
1129958231 15:79658886-79658908 TATAAAGGAGCACCTGAGGCTGG + Intergenic
1133066437 16:3210708-3210730 TATAAAGAAATACCTGACTCTGG - Intergenic
1133228449 16:4354696-4354718 TCTAGAGCAGCACCAGTCTCAGG - Exonic
1133238880 16:4403118-4403140 TTTGCAGCCGCACCTGGCTCTGG - Intronic
1134089290 16:11382906-11382928 TATAAAGGAGCACCTGAGGCTGG + Intronic
1134113587 16:11531594-11531616 TATATGGTAGCACCTGCCTCTGG + Intergenic
1134327567 16:13220947-13220969 TCTAAAACAGCCCCTGGCTTGGG - Intronic
1134783114 16:16916899-16916921 TATAAACCAACACATGGCTCCGG + Intergenic
1142559464 17:801298-801320 TACAAAGCAGCCCCTTCCTCCGG - Intronic
1144961068 17:19044390-19044412 TATCAAGCAGCAACTGCATCGGG - Intronic
1144974093 17:19130134-19130156 TATCAAGCAGCAACTGCATCGGG + Intronic
1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG + Intergenic
1151604188 17:75125878-75125900 TCCCAAGCAGCACCTGGGTCAGG - Intronic
1151849499 17:76682015-76682037 TCTTAAGCAGCAGCTGCCTCTGG + Intronic
1151994117 17:77597893-77597915 GATAAAGCAGCCTCTGGCTGGGG - Intergenic
1155115782 18:22765228-22765250 TATAGCTCAGCACCTGGCTTTGG - Intergenic
1157608663 18:48942183-48942205 TTTTAAGCAGCTCCTGGCTTGGG - Intronic
1158129890 18:54140650-54140672 TATAAAGAACCACCTGACACTGG - Intergenic
1158737312 18:60097913-60097935 TAGAAAGCAGAACATGGCCCTGG + Intergenic
1160166726 18:76519407-76519429 GATAAAGCATCACGAGGCTCCGG - Intergenic
1164050461 19:21582270-21582292 TATAAAGAAGGACCTGGGTCCGG + Intergenic
1165831305 19:38731877-38731899 GTTAAAACAGCACCTGGCACTGG - Intronic
1166558561 19:43717393-43717415 CATAAAACGGCGCCTGGCTCAGG - Intronic
925038704 2:713389-713411 TACAAAGCATCACGTGGCTTTGG + Intergenic
925225218 2:2178297-2178319 TGTAAAGCAGCAAATGGCTTGGG - Intronic
926594148 2:14771736-14771758 TACAAAGCAGCAGCTGCCTCAGG + Intergenic
926837826 2:17044049-17044071 TATAGAGCAGCACCTGGGAAAGG + Intergenic
928836349 2:35551467-35551489 TATAAAGAACCACCTGGGACAGG + Intergenic
929033366 2:37669750-37669772 AATAAAACAGCACCAGCCTCTGG - Intronic
932704083 2:74009981-74010003 CATCAGGTAGCACCTGGCTCAGG - Intronic
936255116 2:110904529-110904551 TTTAAAACAGCACCTGTCACTGG - Intronic
936509177 2:113131760-113131782 GATAAAGGAGCACAGGGCTCTGG - Intronic
936814414 2:116442480-116442502 TATAAAGAAACACCTGGGCCAGG - Intergenic
937205194 2:120231926-120231948 TATAAAGCAGAACCAGCCCCAGG - Intergenic
937467576 2:122148158-122148180 TAAAAAGCAGCAGATGGTTCAGG + Intergenic
944302909 2:198144908-198144930 TAAAATCCAGCAGCTGGCTCCGG - Intronic
945821852 2:214674206-214674228 TTTAGAGCAGCAGCTGGCTTGGG - Intergenic
946238414 2:218339791-218339813 TGTACACCCGCACCTGGCTCGGG + Exonic
946354433 2:219176376-219176398 TATGATGCAGATCCTGGCTCTGG + Intronic
947101495 2:226625915-226625937 CCTAAAGCAGCACCTGCCTCTGG - Intergenic
948799611 2:240426081-240426103 TATAGAAAAGCACCTGGCTCAGG - Intergenic
948925767 2:241096177-241096199 TTTTAAGAAGCTCCTGGCTCGGG - Exonic
1169760840 20:9092040-9092062 TATAAAGCAGCATTTGAATCAGG + Intronic
1170019419 20:11819451-11819473 TCGTAAGCAGCACCTGGATCAGG + Intergenic
1172648369 20:36485742-36485764 GATAAAGTAGCACCTGGCCCAGG + Intronic
1172868885 20:38122339-38122361 CCTAAATCAGCACCTGGCCCTGG + Intronic
1176232914 20:64041178-64041200 GATACACCAGCACCTGGCCCAGG + Intronic
1178618200 21:34152499-34152521 TAGAGAGCAGAACCAGGCTCTGG - Intergenic
1178671469 21:34595113-34595135 CTTACAGCAGCACCTGGCACTGG + Intronic
1182171921 22:28239519-28239541 TATTTAGCAGCACCTATCTCAGG - Intronic
950088172 3:10276126-10276148 CAGACAGCAGCACCTGCCTCAGG + Intronic
953105083 3:39869975-39869997 TATAATGCATATCCTGGCTCTGG + Intronic
954142960 3:48619811-48619833 CATCAAACAGCAGCTGGCTCTGG - Intergenic
956462897 3:69489526-69489548 TATAAAGTAGCAACTCACTCTGG - Intronic
959587580 3:108039450-108039472 TATAAATAAGTAACTGGCTCAGG + Intergenic
959887074 3:111515381-111515403 TATAAAGCTGCACCTGGTACAGG - Intronic
963137543 3:141920950-141920972 TATGAAGCAGCATATGGCTGTGG - Intronic
963249431 3:143089441-143089463 TTTAAAGCAGCACTGGGCTCTGG - Intergenic
963680764 3:148372734-148372756 TATAAGGCAGCTCCTCCCTCTGG + Intergenic
965756232 3:172030069-172030091 TATAAAGCACCACCTGAGACTGG - Intergenic
965770439 3:172176195-172176217 GATTAAGCAACACCAGGCTCTGG - Intronic
967007424 3:185397800-185397822 TATAAAAAAGCCCCTGGCTCCGG - Intronic
967892827 3:194375167-194375189 TGTACACCAGCACTTGGCTCAGG - Intergenic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
968439952 4:618279-618301 TGTAAAGCATCACCTGGGGCTGG + Intergenic
970795092 4:19902304-19902326 TAATAAGCAGCTCCTGGCTTTGG + Intergenic
973757105 4:54086123-54086145 TATAAAGCAGAACCTGGCAGAGG - Intronic
974600447 4:64072922-64072944 TATAAAGCATTGCCTTGCTCAGG - Intergenic
974722579 4:65761009-65761031 TGTAAAGCTGCACCTGGCATTGG - Intergenic
977748832 4:100583787-100583809 TATCATGCAGGACCTGGATCTGG - Intronic
982098153 4:151942241-151942263 TATTCAGCAGGACCTGGGTCAGG - Intergenic
985030890 4:185788103-185788125 AACAAAGCAGCAGCTGGCGCTGG - Intronic
985615533 5:918313-918335 TGGAAAGCAGAGCCTGGCTCTGG + Intronic
985980258 5:3456739-3456761 TGGAAGGCAGCAGCTGGCTCAGG + Intergenic
986436704 5:7741231-7741253 TCTAAAACAGAACCTGGATCAGG + Intronic
994766184 5:103921036-103921058 TATAAAGAAACACCTGACGCTGG - Intergenic
995686741 5:114780254-114780276 ACTAAAGCAGCACTTGGCTTAGG - Intergenic
995842552 5:116457007-116457029 TATAAAGCAGGACCTTACTTTGG - Intronic
997520712 5:134523300-134523322 TGTAAAGCAGCAACTGGCACAGG - Intergenic
998060642 5:139116088-139116110 TCTGAAGGAGCACCTGACTCTGG - Intronic
998330919 5:141326340-141326362 TAAAAGGCAGCACCTCACTCGGG - Intergenic
999425677 5:151486033-151486055 TATAAAGAAGCACCTGAGACTGG + Intronic
1000265406 5:159631601-159631623 TATAAAGCAGTACCTGGGACTGG + Intergenic
1001544916 5:172565099-172565121 TCTCAGGCAGTACCTGGCTCCGG + Intergenic
1001573560 5:172747010-172747032 ATTACAGCAGCCCCTGGCTCAGG + Intergenic
1003023127 6:2529414-2529436 GATCAATCAGCACCTGCCTCTGG + Intergenic
1003761187 6:9180681-9180703 TATAAAGAAGTACCTGGGACTGG + Intergenic
1006061486 6:31423444-31423466 AATAAAGCAGCACCTTTGTCTGG + Intergenic
1007419215 6:41709394-41709416 TCTAATGCAGTACCTGGCACAGG + Intronic
1008968738 6:57341787-57341809 TATGCAGCAGCACCTGACTTAGG - Intronic
1009157723 6:60243605-60243627 TATGCAGCAGCACCTGACTTAGG - Intergenic
1011043267 6:83054446-83054468 TCTAGAGCAGTACCTGTCTCTGG - Intronic
1011552696 6:88544497-88544519 GATAAACCAGCTCCTTGCTCTGG + Intergenic
1012758324 6:103262889-103262911 GATAAAGAAACACCTGACTCAGG - Intergenic
1013052197 6:106547259-106547281 TATGAGGAAGCACCTGGCCCTGG - Intronic
1017194621 6:151686387-151686409 TAAAAACCAGCACCTGGGGCTGG + Intronic
1017216687 6:151916265-151916287 TATAGAGGAGAGCCTGGCTCTGG + Intronic
1017339674 6:153305654-153305676 TATAAAGGAACACCTGGGGCTGG - Intergenic
1017425772 6:154319709-154319731 TCAAAAGCAGCAAGTGGCTCCGG + Intronic
1017506518 6:155073498-155073520 TATAAAGTAGGACTTGGCTATGG - Intronic
1019179095 6:170175994-170176016 TCTGAAGCAGCACCGGGCTGTGG + Intergenic
1020824667 7:13011499-13011521 TATAAAGAAGTACCTGAGTCTGG - Intergenic
1023388937 7:39688792-39688814 TATAAAGAAGTACCTGACACTGG + Intronic
1024147939 7:46536254-46536276 TATAAAGAAATACCTGGATCTGG - Intergenic
1025030663 7:55554231-55554253 TCTAATACAGCACCTGGTTCAGG + Intronic
1026372668 7:69717314-69717336 TATGGAGCAGCTGCTGGCTCTGG + Intronic
1027781807 7:82529413-82529435 TATGAAGCCTCACCTGTCTCTGG + Intergenic
1029162333 7:98561452-98561474 TAGAAAAAAGCACCTGGGTCTGG - Intergenic
1029327123 7:99819379-99819401 TATAAAGAAGTACCTGAGTCTGG - Intergenic
1029521215 7:101063891-101063913 TATAAAGCAACACCTGGGGCTGG - Intergenic
1032494816 7:132353115-132353137 AATAAACAAGCACATGGCTCTGG - Intronic
1033091979 7:138394194-138394216 TATAAAGAAGTACCTGGGACTGG - Intergenic
1033605742 7:142927430-142927452 TATAAAGAACTACCTGGCACAGG + Intronic
1033762452 7:144450558-144450580 AATAAAGCAGCACATAGATCTGG - Intergenic
1036396730 8:8377030-8377052 CAGAAAGCAGCATCTGGCTGGGG - Exonic
1042926468 8:73972690-73972712 TATGAAGCAGCATCTGTCCCTGG + Intronic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1045921733 8:107538077-107538099 GATGAAGCAGCAGCTGGCTTGGG + Intergenic
1047006204 8:120622953-120622975 TATAAGGCAGCCACTGGCTGTGG - Intronic
1048020301 8:130532071-130532093 TATAAAGCAGTACCTGAGACTGG - Intergenic
1048077337 8:131086000-131086022 TATAAAGCAGCAGGAGGCCCTGG + Intergenic
1048758518 8:137766133-137766155 TATAAAGAAGCACCTGAAGCTGG - Intergenic
1050029177 9:1367276-1367298 TATAAAGAAGCACCTGGGACTGG + Intergenic
1050075061 9:1854593-1854615 TAGAAGGCAGCACCAGGCCCTGG - Intergenic
1051493320 9:17691208-17691230 TATAAAGCAACAACTGGAACAGG - Intronic
1054837418 9:69692554-69692576 TATAAAGGAACACCTGACACTGG + Intergenic
1059005734 9:110400036-110400058 TACAAAGCAACAGCTGTCTCAGG + Intronic
1059491430 9:114670848-114670870 TATAAATAAGCATCTAGCTCAGG - Intergenic
1062163522 9:135093292-135093314 TTTGAAGAAGCACTTGGCTCTGG + Intronic
1190742797 X:53301293-53301315 TGCAAAGCAGGACCTAGCTCAGG + Intronic
1190844379 X:54178011-54178033 TATAAAGTAGCACTAGGCTAGGG + Intronic
1192656828 X:73002342-73002364 AATAAACAAGCGCCTGGCTCTGG + Intergenic
1192665292 X:73080659-73080681 AATAAACAAGCGCCTGGCTCTGG - Intergenic
1193276333 X:79592580-79592602 TAGAATCCAGCACCTAGCTCTGG + Intergenic
1196007744 X:110853715-110853737 TCTAAAGCTGCAGCTGACTCTGG - Intergenic
1197279655 X:124520236-124520258 TAGAAGGCAGCATTTGGCTCTGG + Intronic
1197758844 X:130014104-130014126 TATATACCAGCGGCTGGCTCGGG - Exonic