ID: 1100588309

View in Genome Browser
Species Human (GRCh38)
Location 12:95999767-95999789
Sequence CACTGACGGTGCTGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100588302_1100588309 20 Left 1100588302 12:95999724-95999746 CCTGTACAACGTGGACTAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 136
1100588301_1100588309 24 Left 1100588301 12:95999720-95999742 CCGGCCTGTACAACGTGGACTAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100588309 Original CRISPR CACTGACGGTGCTGCAGTCC TGG Intergenic
900146979 1:1162714-1162736 CAGTGACGGTGACGCAGGCCCGG - Intergenic
901471606 1:9460431-9460453 TACTCACTGTCCTGCAGTCCAGG - Intergenic
902755873 1:18548767-18548789 CACTGACGAGCCTGCAGCCCAGG + Intergenic
903755688 1:25658941-25658963 CACTGATGCTGCTGCTGGCCAGG - Intronic
904365375 1:30007799-30007821 CACTGAAGGTGAGGCAGTGCTGG - Intergenic
904853804 1:33479686-33479708 CACCGACTGTCCTGCAGTCCTGG - Exonic
906525281 1:46489974-46489996 CTCTTGCGGTCCTGCAGTCCCGG + Intergenic
911729774 1:101280952-101280974 CACTGAAAGTCCTGCAGTCTGGG + Intergenic
913250833 1:116910599-116910621 CCCGGAAGGTGCTGCGGTCCCGG + Intronic
915631449 1:157156086-157156108 CACTGACTGGGCTGGAGTCAGGG + Intergenic
917557663 1:176107364-176107386 TACTGACCTTGCTCCAGTCCTGG - Intronic
917560204 1:176143703-176143725 CACTGAAGGTTCTGCATTCTAGG - Intronic
919869465 1:201809465-201809487 CACTGACCTTGCTACAGCCCAGG - Exonic
920312052 1:205054339-205054361 CACTGACTGAGCTGCAGGACTGG - Intronic
920676006 1:208039248-208039270 CACTGAGGGTGCCTCATTCCAGG - Intronic
922375596 1:224961450-224961472 CACTCACAGTTCTGCATTCCTGG + Intronic
922571452 1:226636738-226636760 CACACACAGAGCTGCAGTCCTGG - Intronic
922677441 1:227561429-227561451 AACTGGCGGTGCTGCAGTGGCGG - Intergenic
923325219 1:232874731-232874753 CACTGAAAGTTCTGCATTCCAGG - Intergenic
1062843355 10:687977-687999 CACGGAGGGTGCTGCAGGCAGGG + Intronic
1063030034 10:2225439-2225461 CCAGGAAGGTGCTGCAGTCCCGG + Intergenic
1063100977 10:2950020-2950042 CACTGGCTGGGCTGCAGTCACGG - Intergenic
1063423301 10:5931300-5931322 TACTGATGGTGCTGCATACCTGG - Intronic
1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG + Intronic
1075488519 10:122847192-122847214 TTCTGACTGTGCTGCAGCCCAGG + Intronic
1076982450 11:211950-211972 CACTGCTGGTGCTGGGGTCCAGG + Intronic
1077886421 11:6390922-6390944 CACTGAAGGGGCTGCAGTGGAGG + Intronic
1078104286 11:8348995-8349017 CACTGATGGAGCCTCAGTCCAGG + Intergenic
1083796830 11:65021762-65021784 CGGTGACGGCGCTGCAGCCCTGG - Exonic
1083799584 11:65038765-65038787 CGCTTACGCTGCTGCACTCCAGG + Exonic
1084270486 11:68026854-68026876 CAGTGCCTGTGCTGCTGTCCTGG + Intronic
1089376489 11:117998840-117998862 CACTGTCTGTGCTGCCGTGCAGG - Exonic
1091324581 11:134676790-134676812 CAGAGACGCAGCTGCAGTCCAGG + Intergenic
1091631122 12:2161667-2161689 AACTGACGGTGCTGTAGAACAGG + Intronic
1092709903 12:11324964-11324986 CACTGGGGAAGCTGCAGTCCTGG + Intergenic
1095976354 12:47943155-47943177 CCCTGAAGGTCCTGCTGTCCTGG - Intergenic
1097553349 12:61104358-61104380 CACTGAGGCTGGTGCAGTACTGG + Intergenic
1098233030 12:68392072-68392094 TACTGACAGTGCTGCAGGCTGGG + Intergenic
1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG + Intergenic
1102912793 12:116731284-116731306 CACTGATGGTGCAGAAGTCATGG - Intronic
1108691737 13:52865297-52865319 GACTGACTCTGCTGCATTCCTGG + Intergenic
1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG + Intronic
1113786784 13:113006266-113006288 CACTGCCTGCCCTGCAGTCCTGG + Intronic
1117299977 14:54415426-54415448 CACTGCCTGGGCTTCAGTCCTGG - Intronic
1120871014 14:89337591-89337613 TGCTGACGGTGGTGCAGGCCAGG - Intronic
1121668783 14:95692290-95692312 CACTGGGGGTGCTGGAGGCCTGG - Exonic
1122633274 14:103117956-103117978 AACTGAGGTTGCTGCAGACCTGG + Intergenic
1129154190 15:73707524-73707546 CACTGACGGGGCTGGAGTGAGGG - Intronic
1132722543 16:1323833-1323855 CACCGGCGCTGCTGCCGTCCTGG + Intronic
1134609621 16:15598034-15598056 CACTGCTGGTGCTGCTTTCCAGG - Intronic
1137728002 16:50670024-50670046 CACTGGCTGTGATGGAGTCCTGG - Intronic
1142003659 16:87678951-87678973 TTCTCACGGTCCTGCAGTCCCGG - Intronic
1142025254 16:87809418-87809440 AACTGAGGGTCCTGCAATCCTGG + Intergenic
1144413858 17:15027260-15027282 CACTGACTGTGCTTGAATCCAGG - Intergenic
1147582918 17:41636994-41637016 CGCTGCCGGGGCTGCAGGCCTGG - Intergenic
1152477488 17:80527510-80527532 CCCTGACGCTGCTGAACTCCAGG - Intergenic
1157624726 18:49041858-49041880 CACTGACAGTCCTGCAGCCCAGG + Exonic
1157799415 18:50606877-50606899 CACTGCCGCTGCTGTAATCCTGG + Intronic
1157981124 18:52381625-52381647 CACTGAGGGGGCTCCAGACCTGG + Intronic
1160402065 18:78618525-78618547 CACTTATGGTGCTGCAGTATCGG - Intergenic
1160723184 19:605903-605925 CAGTGCCGGGGCTGCAGTCCTGG - Intronic
1161099636 19:2415336-2415358 CAAAGACGGGGCTGCACTCCAGG - Intronic
1162341817 19:10095943-10095965 CACAGACGATGCTGCTCTCCGGG + Intronic
1163999762 19:21086705-21086727 GACTGACTGGGCTGCATTCCTGG - Intronic
1164005714 19:21146792-21146814 GACTGACTGGGCTGCATTCCTGG - Intronic
1165004833 19:32796166-32796188 CACTGAGGGTGCTCCAGACGGGG + Intronic
1165591444 19:36973093-36973115 CAGTGACCGTGGTGCGGTCCAGG + Intronic
1167508468 19:49883372-49883394 CACTGAGGATGCAGCAGTGCTGG + Intronic
925914905 2:8597913-8597935 CACTGACAGTTCTGCATTCATGG - Intergenic
926155244 2:10449740-10449762 CACTGACTGTGCCTCAGACCTGG - Intergenic
927787169 2:25982074-25982096 CCCCAACGCTGCTGCAGTCCGGG + Exonic
929571437 2:43025546-43025568 CACTGACTGAGCTCCAGTGCAGG - Intergenic
932462413 2:71891481-71891503 CACTGATGGTGCAGCAGAGCTGG + Intergenic
946726885 2:222670429-222670451 CCCTGACCGTGCAGCAGTCTTGG + Intergenic
947728523 2:232415714-232415736 CACAGAATGTCCTGCAGTCCAGG - Intergenic
948975142 2:241459292-241459314 CACTGACGGTTCTGCTGGCAAGG + Intronic
1169278132 20:4247125-4247147 CACAAGCTGTGCTGCAGTCCTGG - Intronic
1171313460 20:24165639-24165661 GACTGACCATGCTGCAGGCCTGG - Intergenic
1175052510 20:56168329-56168351 CAATGACAGTGCTACATTCCTGG - Intergenic
1176427586 21:6558453-6558475 CACTGACCGTGCTCCTGGCCTGG + Intergenic
1177669583 21:24208665-24208687 GACTGCCGGCGCTGCAGTGCAGG - Intergenic
1179703078 21:43166770-43166792 CACTGACCGTGCTCCTGGCCTGG + Intergenic
1179887565 21:44320877-44320899 CACAGCCGGAGCTGCAGGCCGGG + Intronic
1180649888 22:17369326-17369348 CCCTGGCGGTGCAGCTGTCCGGG + Intronic
1183646643 22:39131175-39131197 CAGTGACAGTCCTGCATTCCAGG + Exonic
1183704798 22:39469837-39469859 CACTGCCGGGGCTGCAGGGCAGG + Intronic
1185075512 22:48680075-48680097 CACTGCAGCTGCTGCAGCCCCGG + Intronic
953997430 3:47530857-47530879 CACTGAGGGTGCTTGAGGCCAGG - Intergenic
954763556 3:52895253-52895275 CACTGACTGGGATGCAGTCAGGG - Intronic
959189043 3:103086222-103086244 CACTGAAGGTCCTGCAGCCCAGG + Intergenic
961313673 3:126019835-126019857 CACTAACAGCTCTGCAGTCCTGG + Intronic
961762747 3:129183729-129183751 CGCTGACGGAGCCGCAGTGCGGG - Intronic
967621809 3:191642700-191642722 CACTGACACTGCAGCAGTACTGG + Intergenic
968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG + Exonic
969618178 4:8265685-8265707 CGCAGACGGTGCTGCTGTCCTGG - Intergenic
970480215 4:16464984-16465006 CACTGAAGGTGTAGCAGTCATGG - Intergenic
973779456 4:54274547-54274569 CACGGTGGCTGCTGCAGTCCTGG + Exonic
976002100 4:80386235-80386257 CTCTGGCGGGGCTGCAGGCCGGG - Intronic
976214943 4:82707401-82707423 CACGGACGGTCCTGCAGGACAGG + Intronic
978895632 4:113884357-113884379 CACTGAGGGTGTTGCTGTCTGGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
979808034 4:124999713-124999735 CACTGAAGCTGCTGCTGTCCTGG + Intergenic
985570891 5:644100-644122 CCCTGAGGGTGCTGCAGGGCTGG + Intronic
985656913 5:1137131-1137153 CAGTGAGGCCGCTGCAGTCCCGG + Intergenic
985757148 5:1725791-1725813 CCCTGACGGAGCTGCAATGCCGG - Intergenic
986706337 5:10457477-10457499 CACCGGCTGTGCTCCAGTCCTGG + Intronic
996852603 5:127969257-127969279 CACTGAAAGTGCTGCATCCCAGG + Intergenic
997124545 5:131212634-131212656 CACTGACACTGATGTAGTCCTGG - Intergenic
1003320566 6:5047304-5047326 CACTGAAGGTCCTGCACCCCAGG + Intergenic
1003445601 6:6181023-6181045 CACTCACGGTCCTCCAGTTCTGG + Intronic
1005959252 6:30684521-30684543 CACAGTTGATGCTGCAGTCCCGG - Exonic
1012995017 6:105964377-105964399 GGCTGACGGAGCTGCAGGCCTGG - Intergenic
1015822437 6:137279020-137279042 CACTGGAGGTGCTGCTGTTCAGG + Intergenic
1020430542 7:8112734-8112756 CACTGAAGCTGCAGGAGTCCAGG + Intergenic
1023010117 7:35918495-35918517 CACTGGAGCTGCAGCAGTCCTGG - Intergenic
1023259191 7:38341419-38341441 CACAGAGGGTGCTGCAGAACTGG - Intergenic
1024026342 7:45413103-45413125 CACTAAGGGTCCTGAAGTCCTGG + Intergenic
1024080708 7:45853084-45853106 CACTGGAGCTGCAGCAGTCCTGG + Intergenic
1024116865 7:46202639-46202661 CATTGACAGTGATTCAGTCCTGG + Intergenic
1025007449 7:55365652-55365674 CACGGCCGGGGCTGGAGTCCCGG - Exonic
1025123747 7:56328596-56328618 CACTGGAGCTGCAGCAGTCCTGG - Intergenic
1027700571 7:81465081-81465103 CTCTGACAGTTCTGAAGTCCGGG - Intergenic
1032855423 7:135829819-135829841 CACAGCCCGTGCTGCACTCCAGG - Intergenic
1034093431 7:148384746-148384768 CAGTGATGGTGCTGGAATCCAGG - Intronic
1035700724 8:1637872-1637894 CCCGGACGCTGCTGCAGTGCTGG - Intronic
1035712180 8:1726525-1726547 CACTGTCCGTGCTCCAGGCCGGG - Intergenic
1037149245 8:15616026-15616048 GCCTCACTGTGCTGCAGTCCAGG + Intronic
1039144612 8:34433217-34433239 CACTGACGGTTCAGCATCCCAGG - Intergenic
1039906802 8:41792278-41792300 CCCTGAGAGGGCTGCAGTCCAGG + Intronic
1048424079 8:134306393-134306415 CAATGAGGGAGCTGCAGTCAGGG + Intergenic
1049215465 8:141405863-141405885 CACTGCCTGTGCTGGAGGCCAGG - Intronic
1050673382 9:8023885-8023907 CACTGTCAATTCTGCAGTCCAGG + Intergenic
1052023851 9:23553876-23553898 GACTGGCGGTGCTGTTGTCCAGG - Intergenic
1056550125 9:87645955-87645977 CCCAGAAGGTGCTGCAGGCCTGG - Exonic
1059597974 9:115743912-115743934 AATTGACGTTGCTGCAGACCTGG - Intergenic
1061914282 9:133741179-133741201 CTCTGACGGGGCAGAAGTCCAGG + Intergenic
1062190324 9:135244721-135244743 CCCTGACGGAGCTGAATTCCAGG + Intergenic
1189466323 X:41280362-41280384 AACTGACAGCTCTGCAGTCCAGG - Intergenic
1190065492 X:47239127-47239149 CAGGGAAGGTGCTGGAGTCCTGG - Exonic
1194642898 X:96424725-96424747 CACTGAAAGTACTGCATTCCAGG + Intergenic
1195800445 X:108702782-108702804 CATTGACGAGGCTGCAGGCCAGG - Intergenic
1200694467 Y:6346648-6346670 CAATGGTGCTGCTGCAGTCCAGG - Intergenic
1201040810 Y:9828062-9828084 CAATGGTGCTGCTGCAGTCCAGG + Intergenic
1201058598 Y:10020429-10020451 CAGTGATGGAACTGCAGTCCAGG + Intergenic