ID: 1100589263

View in Genome Browser
Species Human (GRCh38)
Location 12:96010192-96010214
Sequence TACACTAATAAGGAAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100589263_1100589265 8 Left 1100589263 12:96010192-96010214 CCTGAAACTTCCTTATTAGTGTA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1100589265 12:96010223-96010245 TACTAAGTTAAGAATTAGCCTGG 0: 1
1: 0
2: 3
3: 55
4: 1066
1100589263_1100589266 9 Left 1100589263 12:96010192-96010214 CCTGAAACTTCCTTATTAGTGTA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1100589266 12:96010224-96010246 ACTAAGTTAAGAATTAGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 165
1100589263_1100589269 27 Left 1100589263 12:96010192-96010214 CCTGAAACTTCCTTATTAGTGTA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1100589269 12:96010242-96010264 CTGGGAAAGGACCCTACTTATGG 0: 1
1: 0
2: 1
3: 6
4: 100
1100589263_1100589267 14 Left 1100589263 12:96010192-96010214 CCTGAAACTTCCTTATTAGTGTA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1100589267 12:96010229-96010251 GTTAAGAATTAGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100589263 Original CRISPR TACACTAATAAGGAAGTTTC AGG (reversed) Intronic
903897324 1:26616215-26616237 GACACTACTAAGTAAGTTTTAGG + Intergenic
905377186 1:37530694-37530716 AACACTAATAAGGAAATTGATGG + Intergenic
911814991 1:102337195-102337217 TACACTAATAAAGATCTTTAAGG - Intergenic
913261649 1:117003839-117003861 TACATAAATCAGGAAGTTACTGG + Intronic
914948904 1:152092645-152092667 TACACTAAGTAGGAATTTTGTGG - Intergenic
915050493 1:153066401-153066423 AACACTAAAAAGTAAATTTCAGG + Intergenic
917254414 1:173098959-173098981 TTTACTAATAAAGAAATTTCAGG - Intergenic
918946177 1:191068395-191068417 GACACAAAAAAAGAAGTTTCTGG - Intergenic
920285738 1:204878015-204878037 TACACTGAAAAGAAAGCTTCTGG - Intronic
924100243 1:240595559-240595581 TTCCCTAATAAGGGAATTTCAGG + Intronic
924492811 1:244555776-244555798 TACACTAATAATGAAATAGCTGG + Intronic
924673969 1:246156828-246156850 TACACTAAAAAGGAAATCACAGG + Intronic
1063917680 10:10900562-10900584 TACTAGATTAAGGAAGTTTCAGG - Intergenic
1075483556 10:122801791-122801813 TTCAATAATTAGGAAGTTTGAGG - Intergenic
1075751609 10:124776832-124776854 TACAGTAATTAGGAAGTTCAAGG + Intronic
1076247898 10:128961955-128961977 GAGACTCATAAGGATGTTTCTGG - Intergenic
1079853030 11:25562059-25562081 TACCCTAATATGTAAATTTCAGG - Intergenic
1082106235 11:48224751-48224773 CACACAAATAAGGAAAATTCAGG - Intergenic
1082676290 11:56108330-56108352 TACACTAATAGGGAAATTATAGG - Intergenic
1082772444 11:57218774-57218796 TAAAATAAAAAAGAAGTTTCAGG + Intergenic
1089044561 11:115488904-115488926 TACAGTAATAAAGATGTATCTGG - Intronic
1090293624 11:125567829-125567851 TTCACAAATGAGGAAGTTTGTGG - Intergenic
1091481339 12:834894-834916 AATACTAAAAAGGAAGATTCTGG - Intronic
1093382659 12:18512591-18512613 TATACTAATAATGAACTATCTGG - Intronic
1093642582 12:21544288-21544310 TAGACAAATAAGGGAGTTTGTGG - Intronic
1095912426 12:47442223-47442245 TATAGTAATAAGGCAATTTCAGG - Intergenic
1096572798 12:52533416-52533438 TATATTAATAAGGAAATTTAGGG - Intergenic
1096767665 12:53906631-53906653 TCCACTAAATAGGAAGTTTCAGG - Intergenic
1100589263 12:96010192-96010214 TACACTAATAAGGAAGTTTCAGG - Intronic
1106759596 13:32855703-32855725 TATACTAGTCTGGAAGTTTCAGG - Intergenic
1107387448 13:39927533-39927555 TACACTAGAAAGGGAGTTACTGG - Intergenic
1108833393 13:54507599-54507621 TACACTAATAAGGAATTAGTTGG - Intergenic
1108918636 13:55648868-55648890 TACACATATAAGGAAGTATCAGG - Intergenic
1110609162 13:77470031-77470053 CACACTCATATGGAAGTTTCAGG + Intergenic
1110708466 13:78623036-78623058 TAAACTACTAGGGAAGTTTTGGG + Intronic
1111936924 13:94567181-94567203 AACACTAATATGTAAGTTGCAGG - Intergenic
1115794531 14:36918855-36918877 TACACTTAAAAGGATCTTTCGGG - Intronic
1116892039 14:50277987-50278009 TACACAATTGTGGAAGTTTCTGG - Intronic
1118935572 14:70284798-70284820 TACACTTATAACAAATTTTCTGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120538982 14:85732339-85732361 AACACTAAGAAGGAGGTTTTAGG + Intergenic
1125871216 15:43103684-43103706 CAGACTAAGAAGGAAGTTTAAGG + Intronic
1126222748 15:46233149-46233171 TATACTGACAAGGAAATTTCAGG + Intergenic
1129018831 15:72495596-72495618 TACATGTTTAAGGAAGTTTCAGG - Intronic
1130214910 15:81959069-81959091 TACACTTATCAGGAAGTTATGGG + Intergenic
1131548384 15:93334653-93334675 TAAAATAAGAAGGAAGTTTTAGG - Intergenic
1133066605 16:3212055-3212077 GACACTCAGAAGCAAGTTTCTGG - Intergenic
1135243078 16:20828076-20828098 TATACAAATAAAAAAGTTTCAGG + Intronic
1138725312 16:59131348-59131370 TACACTAGCAAGGAACTATCTGG - Intergenic
1139968679 16:70760308-70760330 TATCCTAGAAAGGAAGTTTCAGG + Intronic
1146152934 17:30492093-30492115 TCCACTAATAATAAAGTATCAGG - Intronic
1148814578 17:50318377-50318399 TACCCTTATAATGAAGCTTCGGG - Intergenic
1153248774 18:3099374-3099396 TCCACTAATAAAGGAGTTTCAGG - Intronic
1156109034 18:33700985-33701007 TACAGTAATAAAGCAGTTTGGGG + Intronic
1158230766 18:55251957-55251979 CACAATAAAAAGGAAGTTTAAGG - Intronic
1164788808 19:30959019-30959041 TCCATAAATAAGGAAGTTCCAGG + Intergenic
1165483159 19:36077894-36077916 TTCACTTATAAGGAATATTCAGG - Intronic
934020141 2:87941138-87941160 TACACGAATAACCAATTTTCCGG - Intergenic
935914966 2:107939264-107939286 TAAACATATAAGGATGTTTCTGG + Intergenic
936143757 2:109964726-109964748 TACACAAATAAAGAAGTATGCGG - Intergenic
936180440 2:110262689-110262711 TACACAAATAAAGAAGTATGCGG - Intergenic
936200930 2:110406742-110406764 TACACAAATAAAGAAGTATGCGG + Exonic
937942737 2:127298736-127298758 TACTCTAATAAGTAACCTTCTGG - Exonic
938340135 2:130530373-130530395 CACAGTACTAAGGAAGTTTGTGG + Intergenic
938349701 2:130590375-130590397 CACAGTACTAAGGAAGTTTGTGG - Intergenic
942600413 2:177635237-177635259 TACACTACTAAAGAAAATTCTGG - Intronic
943911814 2:193578759-193578781 TACACTAACAAGAAACTGTCTGG + Intergenic
944776144 2:202967391-202967413 TACACTACTATGTAAGTTTAAGG - Intronic
946540499 2:220679239-220679261 TATACTATTAATGAATTTTCAGG + Intergenic
1179256563 21:39721592-39721614 AACACTAATAAGGGTGTTTCTGG - Intergenic
1182751026 22:32642298-32642320 AATAATAATAAAGAAGTTTCTGG + Intronic
950688076 3:14633300-14633322 GACAGTATTAAGGAAGTTCCAGG - Intergenic
954695579 3:52423210-52423232 TTTTCTAATAAGGAAGGTTCTGG - Exonic
955102938 3:55869707-55869729 CACTCTAATAAGGAAGTTGGTGG - Intronic
957618562 3:82565934-82565956 TAAACTATTGAGAAAGTTTCTGG + Intergenic
957941816 3:87015872-87015894 GACACTCCTTAGGAAGTTTCAGG + Intergenic
958626950 3:96638597-96638619 TACACAAATAATGAAATTCCTGG - Intergenic
963529507 3:146456352-146456374 TAGACTCTTAAGGAAGTTTATGG - Intronic
964682848 3:159361591-159361613 TACATTAAGAAGGACCTTTCTGG + Intronic
966472153 3:180302064-180302086 TAAACTCATTAGAAAGTTTCAGG + Intergenic
966598283 3:181747826-181747848 TAAACTAATACAAAAGTTTCTGG + Intergenic
967447498 3:189584011-189584033 CACAGTAATAAGAAAATTTCAGG - Intergenic
971913320 4:32825121-32825143 TATTCTAAAATGGAAGTTTCTGG - Intergenic
972255968 4:37355704-37355726 AAGACTACTAAGGAAGATTCTGG - Intronic
972568520 4:40289902-40289924 AACACTGATACTGAAGTTTCAGG - Intergenic
977313077 4:95411236-95411258 TCCTCTAATAAAGACGTTTCAGG - Intronic
978441885 4:108741825-108741847 TACACGCATAAAGACGTTTCTGG - Intergenic
980079935 4:128333557-128333579 TACACAAATAAGGCAATTTCAGG + Intergenic
980668837 4:135975775-135975797 GACACTAATTTGCAAGTTTCTGG + Intergenic
981145889 4:141323620-141323642 TACAAGAATAATGAAATTTCAGG + Intergenic
982151528 4:152463335-152463357 TAAACTTACAACGAAGTTTCTGG - Intronic
982513194 4:156310263-156310285 TACACTAATAGCGAATTATCTGG + Intergenic
982555356 4:156855310-156855332 AACACTAACGAGGAAGTTTCTGG + Intronic
983158200 4:164378432-164378454 GACACTGAGAAGGAAGCTTCTGG + Intronic
984051036 4:174865571-174865593 TACCCTAAAATGGAAGTATCAGG - Intronic
984812856 4:183810254-183810276 TACACAATGAAGGAGGTTTCTGG - Intergenic
987521944 5:18997215-18997237 TACTCTAAAAAGAAAGTTTAGGG - Intergenic
987835290 5:23152836-23152858 TACCCTCTTATGGAAGTTTCTGG + Intergenic
988209243 5:28181609-28181631 TACACCCATAATGAACTTTCTGG - Intergenic
989593646 5:43135311-43135333 TACACTAACAATGAACTATCTGG + Intronic
990050722 5:51496267-51496289 TATTCAAATAAGGAAGTTTATGG - Intergenic
990797910 5:59565215-59565237 TACACTATTTAGAAAGTTACTGG + Intronic
992308667 5:75470932-75470954 TACACTAACAATGAACTATCTGG + Intronic
992858293 5:80886756-80886778 TTCATAAATAAGGAAGTATCAGG - Intergenic
993057202 5:82995399-82995421 TGCACTAATAAATGAGTTTCAGG - Intergenic
994189203 5:96849463-96849485 TACACTAACAATGAAGTATCTGG + Intronic
999013176 5:148065895-148065917 TACACTAAAACGTAATTTTCAGG - Intronic
999640386 5:153666449-153666471 TATACCAAGAAGGAAGTATCAGG - Intronic
1001515040 5:172349736-172349758 TAGACTAATTAGAAGGTTTCTGG + Intronic
1002913043 6:1505792-1505814 TACACTAATAAAGAAGGTGCTGG - Intergenic
1003800192 6:9655659-9655681 TACACACATCAGGACGTTTCAGG - Intronic
1004510879 6:16283718-16283740 CACAGTAATAAGAAATTTTCAGG + Intronic
1005032106 6:21519104-21519126 TGCACTTATAAGTAAGTTGCAGG - Intergenic
1007296619 6:40827240-40827262 TATAAGAATAAGGAAGTATCTGG - Intergenic
1008004309 6:46393801-46393823 TACACTGACAAGCAAGCTTCAGG - Intronic
1010061473 6:71627458-71627480 TACACTAACAATGAAAATTCTGG - Intergenic
1010263965 6:73846980-73847002 CACACTAAGAAGAAAGTTTATGG - Intergenic
1012073243 6:94650424-94650446 TAAATTGATAAGGAAGATTCTGG + Intergenic
1012414339 6:98996642-98996664 TACACTAAAGAGGAATTTACTGG + Intergenic
1015149663 6:130022657-130022679 TACAGTGATATGGAAGATTCTGG + Intronic
1015614472 6:135060685-135060707 TATAATAATAAAGATGTTTCAGG + Intronic
1016008519 6:139114065-139114087 CAACCTAAAAAGGAAGTTTCTGG + Intergenic
1016069057 6:139715656-139715678 TAGAATGACAAGGAAGTTTCTGG - Intergenic
1016209576 6:141512900-141512922 GACACTAATAATAGAGTTTCAGG - Intergenic
1023529689 7:41139363-41139385 TACAGAGATAAGCAAGTTTCTGG + Intergenic
1024108797 7:46123272-46123294 TACACTAACAATGAACTATCTGG - Intergenic
1024385975 7:48752192-48752214 CCAAGTAATAAGGAAGTTTCAGG + Intergenic
1024756494 7:52539380-52539402 TAGAATAAAAAGGAATTTTCTGG - Intergenic
1024818950 7:53304531-53304553 TTCACAAATAAGGAAGTTGAGGG + Intergenic
1026518653 7:71095341-71095363 TACAATAATTAGGAGGTTTTTGG + Intergenic
1027531845 7:79344575-79344597 TGCAAAAATAAGAAAGTTTCTGG + Intronic
1027862273 7:83600269-83600291 TACACTAGAAAGGAAGCATCTGG + Intronic
1036075071 8:5489419-5489441 TATACTTATAAGGAATTTTAAGG + Intergenic
1037370878 8:18177008-18177030 TACACTAATAACAAACTATCTGG - Intronic
1038610227 8:29054202-29054224 TTCAGTAATACGGAAGTTTAGGG - Intronic
1038974684 8:32680742-32680764 TAAACAAATAAGGAAGTTTAAGG - Intronic
1044628463 8:94256920-94256942 TACACTAATGAGGCAGCTTGAGG + Intronic
1048041144 8:130729822-130729844 TTCACTAATAAGAAAGGTTTTGG - Intergenic
1048773578 8:137921084-137921106 TACATTAATGAGGCAGTTGCTGG + Intergenic
1050345390 9:4680617-4680639 TATACTATTAAGGATTTTTCAGG + Intronic
1050953350 9:11625321-11625343 TTCATTAATTAAGAAGTTTCAGG + Intergenic
1051133541 9:13891398-13891420 TACACTAGTAAGAAACTTTAGGG - Intergenic
1051407229 9:16750880-16750902 TACAGTAACACAGAAGTTTCTGG + Intronic
1051791724 9:20811660-20811682 TCCACTTATAAGGAATTTGCAGG - Intronic
1052156556 9:25199677-25199699 TTGACTACTAAGGAAGTTTTAGG + Intergenic
1053365420 9:37519207-37519229 TACATTAAGAAGAAAATTTCCGG - Intronic
1056328566 9:85502839-85502861 AAAACTAAGTAGGAAGTTTCAGG + Intergenic
1057332374 9:94128017-94128039 TACAGGAATAAGGAAGTTATTGG + Intergenic
1058492096 9:105514026-105514048 TATAATAATTAGGCAGTTTCAGG + Intronic
1186380024 X:9047994-9048016 GATTCTAATAAGGAATTTTCCGG - Intronic
1187185014 X:16976216-16976238 TATACTAACAGGGAAATTTCTGG + Intronic
1187514454 X:19954771-19954793 TACACAAATAAGGCAGTTGTAGG - Intronic
1190238831 X:48640473-48640495 TACACTAACAATGAACTATCTGG + Intergenic
1190627282 X:52348575-52348597 TAGACTAGTAATGAAGTTCCAGG - Intergenic
1191979361 X:66909021-66909043 TGCACTAATAATGGAATTTCAGG - Intergenic
1192236754 X:69301061-69301083 TCCACTGAAAAGGTAGTTTCTGG + Intergenic
1192868576 X:75163108-75163130 TACAATTGTAAGGAAGTTTTTGG - Intergenic
1193198585 X:78661964-78661986 CACACTAATAAGAAATATTCAGG + Intergenic
1194968323 X:100315162-100315184 TACCCTACTAAGGAAATTCCAGG - Intronic
1197869259 X:131050220-131050242 GCCCCTAATAAGGAAATTTCTGG - Intergenic
1198283472 X:135166800-135166822 TACACCAATAGGGAACTATCTGG + Intronic
1199124382 X:144097990-144098012 TACACGAATAACCAATTTTCCGG + Intergenic
1199671129 X:150149107-150149129 ATCATTAATAGGGAAGTTTCTGG - Intergenic