ID: 1100602932

View in Genome Browser
Species Human (GRCh38)
Location 12:96127846-96127868
Sequence GGTCGCAGAGGACACCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100602932_1100602936 19 Left 1100602932 12:96127846-96127868 CCAACTTGGTGTCCTCTGCGACC No data
Right 1100602936 12:96127888-96127910 AATTACTCCAGCCTCAGACAGGG No data
1100602932_1100602935 18 Left 1100602932 12:96127846-96127868 CCAACTTGGTGTCCTCTGCGACC No data
Right 1100602935 12:96127887-96127909 GAATTACTCCAGCCTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100602932 Original CRISPR GGTCGCAGAGGACACCAAGT TGG (reversed) Intergenic
No off target data available for this crispr