ID: 1100607279

View in Genome Browser
Species Human (GRCh38)
Location 12:96162111-96162133
Sequence CATAAGCACCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100607279_1100607283 -9 Left 1100607279 12:96162111-96162133 CCCTTCTCCATCTGGTGCTTATG No data
Right 1100607283 12:96162125-96162147 GTGCTTATGGTGTGATCCTGAGG No data
1100607279_1100607287 25 Left 1100607279 12:96162111-96162133 CCCTTCTCCATCTGGTGCTTATG No data
Right 1100607287 12:96162159-96162181 CCTGTGATCCACTTCATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100607279 Original CRISPR CATAAGCACCAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr