ID: 1100608644

View in Genome Browser
Species Human (GRCh38)
Location 12:96172114-96172136
Sequence CTTGAGTGGCAGAAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100608644_1100608647 -1 Left 1100608644 12:96172114-96172136 CCAGGTTCCTTCTGCCACTCAAG No data
Right 1100608647 12:96172136-96172158 GTCTCAGTCCAAACTCCTTCAGG No data
1100608644_1100608648 0 Left 1100608644 12:96172114-96172136 CCAGGTTCCTTCTGCCACTCAAG No data
Right 1100608648 12:96172137-96172159 TCTCAGTCCAAACTCCTTCAGGG No data
1100608644_1100608649 3 Left 1100608644 12:96172114-96172136 CCAGGTTCCTTCTGCCACTCAAG No data
Right 1100608649 12:96172140-96172162 CAGTCCAAACTCCTTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100608644 Original CRISPR CTTGAGTGGCAGAAGGAACC TGG (reversed) Intergenic
No off target data available for this crispr