ID: 1100610478

View in Genome Browser
Species Human (GRCh38)
Location 12:96187848-96187870
Sequence CCAAAGAGGTGGAGAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100610478_1100610484 -7 Left 1100610478 12:96187848-96187870 CCAGCTATTCTCCACCTCTTTGG No data
Right 1100610484 12:96187864-96187886 TCTTTGGAAGACCGAATAAGGGG No data
1100610478_1100610482 -9 Left 1100610478 12:96187848-96187870 CCAGCTATTCTCCACCTCTTTGG No data
Right 1100610482 12:96187862-96187884 CCTCTTTGGAAGACCGAATAAGG No data
1100610478_1100610483 -8 Left 1100610478 12:96187848-96187870 CCAGCTATTCTCCACCTCTTTGG No data
Right 1100610483 12:96187863-96187885 CTCTTTGGAAGACCGAATAAGGG No data
1100610478_1100610486 18 Left 1100610478 12:96187848-96187870 CCAGCTATTCTCCACCTCTTTGG No data
Right 1100610486 12:96187889-96187911 TTAAATGAAGCATGAGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100610478 Original CRISPR CCAAAGAGGTGGAGAATAGC TGG (reversed) Intergenic
No off target data available for this crispr