ID: 1100612145

View in Genome Browser
Species Human (GRCh38)
Location 12:96200249-96200271
Sequence CTCGTGTTCTATAGCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1203
Summary {0: 1, 1: 7, 2: 127, 3: 353, 4: 715}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612145_1100612150 26 Left 1100612145 12:96200249-96200271 CCTGCAGTGCTATAGAACACGAG 0: 1
1: 7
2: 127
3: 353
4: 715
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1100612145_1100612151 27 Left 1100612145 12:96200249-96200271 CCTGCAGTGCTATAGAACACGAG 0: 1
1: 7
2: 127
3: 353
4: 715
Right 1100612151 12:96200299-96200321 TCTTAAGACTGATGAAGCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 140
1100612145_1100612146 -4 Left 1100612145 12:96200249-96200271 CCTGCAGTGCTATAGAACACGAG 0: 1
1: 7
2: 127
3: 353
4: 715
Right 1100612146 12:96200268-96200290 CGAGAACTTACTCCTCCTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612145 Original CRISPR CTCGTGTTCTATAGCACTGC AGG (reversed) Intronic