ID: 1100612147

View in Genome Browser
Species Human (GRCh38)
Location 12:96200280-96200302
Sequence AAGAGAAGGTCTCCAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612147_1100612151 -4 Left 1100612147 12:96200280-96200302 CCTCCTGTTGGAGACCTTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1100612151 12:96200299-96200321 TCTTAAGACTGATGAAGCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 140
1100612147_1100612150 -5 Left 1100612147 12:96200280-96200302 CCTCCTGTTGGAGACCTTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612147 Original CRISPR AAGAGAAGGTCTCCAACAGG AGG (reversed) Intronic