ID: 1100612148

View in Genome Browser
Species Human (GRCh38)
Location 12:96200283-96200305
Sequence CTTAAGAGAAGGTCTCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612148_1100612154 30 Left 1100612148 12:96200283-96200305 CCTGTTGGAGACCTTCTCTTAAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1100612154 12:96200336-96200358 GCAATAGAGTAAAGAAAACGAGG 0: 1
1: 0
2: 1
3: 28
4: 251
1100612148_1100612151 -7 Left 1100612148 12:96200283-96200305 CCTGTTGGAGACCTTCTCTTAAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1100612151 12:96200299-96200321 TCTTAAGACTGATGAAGCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 140
1100612148_1100612150 -8 Left 1100612148 12:96200283-96200305 CCTGTTGGAGACCTTCTCTTAAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612148 Original CRISPR CTTAAGAGAAGGTCTCCAAC AGG (reversed) Intronic