ID: 1100612150

View in Genome Browser
Species Human (GRCh38)
Location 12:96200298-96200320
Sequence CTCTTAAGACTGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612145_1100612150 26 Left 1100612145 12:96200249-96200271 CCTGCAGTGCTATAGAACACGAG 0: 1
1: 7
2: 127
3: 353
4: 715
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1100612148_1100612150 -8 Left 1100612148 12:96200283-96200305 CCTGTTGGAGACCTTCTCTTAAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1100612147_1100612150 -5 Left 1100612147 12:96200280-96200302 CCTCCTGTTGGAGACCTTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612150 Original CRISPR CTCTTAAGACTGATGAAGCT AGG Intronic