ID: 1100612150

View in Genome Browser
Species Human (GRCh38)
Location 12:96200298-96200320
Sequence CTCTTAAGACTGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612147_1100612150 -5 Left 1100612147 12:96200280-96200302 CCTCCTGTTGGAGACCTTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1100612145_1100612150 26 Left 1100612145 12:96200249-96200271 CCTGCAGTGCTATAGAACACGAG 0: 1
1: 7
2: 127
3: 353
4: 715
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1100612148_1100612150 -8 Left 1100612148 12:96200283-96200305 CCTGTTGGAGACCTTCTCTTAAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612150 Original CRISPR CTCTTAAGACTGATGAAGCT AGG Intronic
903468089 1:23566468-23566490 CTCCTAAGCCTGCTGATGCTTGG - Intergenic
903632435 1:24786264-24786286 TTCTAAAGACTGATTAAACTAGG + Intronic
904530996 1:31169092-31169114 CAGTTAAGACTTAGGAAGCTGGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
905659808 1:39712796-39712818 CTCCTAAGACTGAGGGAACTGGG - Intronic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
907537872 1:55181750-55181772 TCCTTAACACTGATGATGCTAGG - Intronic
909555191 1:76945779-76945801 CTATTAAGACTAATGGAGGTTGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
914366144 1:146980402-146980424 CTCTAAAGACCATTGAAGCTAGG - Intronic
917190537 1:172413525-172413547 CTCTTAAAACTGGGGAAACTGGG - Intronic
919672980 1:200354910-200354932 CTGTTAAGACTAAAGAAGGTTGG - Intergenic
920422974 1:205848358-205848380 GCCTTGAGAATGATGAAGCTTGG - Intronic
1063650029 10:7925916-7925938 CTCTTAAGACTGGTAAGGCCAGG + Intronic
1063841600 10:10078543-10078565 CCCTGAAGAATGATGAAGCCTGG + Intergenic
1065120568 10:22526101-22526123 CTTGTAAGACTGCTGATGCTGGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1069769233 10:70887348-70887370 CTCTCTGGACTGATGTAGCTTGG + Intronic
1069869908 10:71526795-71526817 CTTTTAAAAATGAGGAAGCTGGG + Intronic
1072365305 10:94703307-94703329 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1073620571 10:105043319-105043341 CTATTAAGACTTACGAAACTGGG + Intronic
1074034816 10:109727845-109727867 CTCTTAATACTCATGAAGAAGGG - Intergenic
1074996554 10:118762110-118762132 CTCATAAGCCTGATGAATTTAGG + Intergenic
1076324957 10:129613966-129613988 CTCTTAAAAATGGTGAAGGTGGG - Intronic
1078679328 11:13461331-13461353 CTCTTGAGAATGCTGAAGATGGG + Intronic
1078926577 11:15880713-15880735 TTCTTAAGAGTGAGGGAGCTGGG - Intergenic
1079432634 11:20408791-20408813 CTCTTAAGATTGATTAATGTTGG + Intronic
1080033552 11:27687981-27688003 CATTTAAGTCTGCTGAAGCTGGG + Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082832013 11:57625509-57625531 CTCTGGAGACTGGTGGAGCTAGG + Intergenic
1083020885 11:59505728-59505750 CTATCAAGATTGATGAGGCTTGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086320267 11:85639059-85639081 TTTTTTAGAATGATGAAGCTAGG - Intergenic
1086659882 11:89402480-89402502 CGGTTAAGACTGATGCAGCCGGG + Exonic
1086728586 11:90220703-90220725 CTCTTAAAACTGATAAAGAAAGG - Intronic
1092581626 12:9849160-9849182 CGTTTAAGTCTGCTGAAGCTTGG + Intergenic
1092959776 12:13585224-13585246 ATCTTCAGAGTCATGAAGCTGGG + Intronic
1093402347 12:18761488-18761510 CATTTAAGTCTGCTGAAGCTGGG - Intergenic
1094006207 12:25754688-25754710 CTCTTAAGAATTACTAAGCTGGG + Intergenic
1095650179 12:44598514-44598536 CTCCTAAGAGTGATGAACTTTGG - Intronic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1101027618 12:100627690-100627712 CTCTTAACATTGCTGAAGTTGGG + Intronic
1102229848 12:111255131-111255153 TTCTAAAGACTGATTAAGGTTGG - Intronic
1108841510 13:54622443-54622465 CTCTTAAGACAGAGGAATCCAGG + Intergenic
1109118226 13:58418194-58418216 CTCTGAACACTGATGAAACGAGG + Intergenic
1110918354 13:81051953-81051975 CTCTTAACATTGATAAAGCATGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118978223 14:70695493-70695515 AACTTAAGAAGGATGAAGCTGGG + Intergenic
1120275250 14:82365020-82365042 GTTTTATTACTGATGAAGCTGGG - Intergenic
1121535662 14:94689076-94689098 CTATTAAGAATGAAGACGCTGGG + Intergenic
1121884371 14:97529720-97529742 CTCCAAAGGCTGAAGAAGCTGGG + Intergenic
1131948299 15:97652107-97652129 GTCTTACTCCTGATGAAGCTGGG - Intergenic
1133106451 16:3513176-3513198 CTCTAAAGACTTCTGAAGCCTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134876410 16:17703426-17703448 CTATTAAGAATGATGAGACTAGG + Intergenic
1137296565 16:47099153-47099175 CTTTTAAGAATGTTGAGGCTGGG - Intronic
1138126504 16:54443176-54443198 CCCTTAAATCTGGTGAAGCTAGG + Intergenic
1140983088 16:80129412-80129434 CTCTTAAGACTTTTAAAGATTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153405905 18:4739193-4739215 ATCTTAACACTGTAGAAGCTTGG + Intergenic
1153755521 18:8279311-8279333 CTCTCAAGCCTGATGTAGCAGGG + Intronic
1153955534 18:10092773-10092795 CTCTTAAGACCCATGATGCTTGG - Intergenic
1155079999 18:22399687-22399709 CTCTTAGGACTAAAGAAGTTGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156390619 18:36647357-36647379 CTCTGATGACTAATGAAGTTGGG - Intronic
1156670928 18:39468563-39468585 CTCTTAAGAGTGAAGGAGCTAGG + Intergenic
1158713701 18:59859595-59859617 TTCTGGAGACTGAAGAAGCTGGG + Intergenic
1165949655 19:39466921-39466943 CTATAAAGATTGATGAGGCTGGG + Intronic
926044529 2:9699994-9700016 CTTTGGAGTCTGATGAAGCTAGG + Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929400573 2:41576414-41576436 CTCTAATGACTGATAAATCTAGG + Intergenic
930079906 2:47437597-47437619 CTCTTAAAACTAAAAAAGCTGGG + Intronic
931754372 2:65359335-65359357 GTGTTAAAACTGAGGAAGCTTGG - Intronic
932116007 2:69047969-69047991 CTATTTAAACTGATGAAGCCAGG - Intronic
933303609 2:80570342-80570364 CCTTTAAGAGTGATGAGGCTGGG - Intronic
935545898 2:104399305-104399327 CTCTGAGGACTGAGGAAACTAGG - Intergenic
936560757 2:113537789-113537811 CTCTAAAGACTGAGGATCCTTGG - Intergenic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
937508568 2:122566181-122566203 CTCTTCCTACTCATGAAGCTAGG - Intergenic
940607198 2:155941086-155941108 CTCTTAACACTGACATAGCTGGG - Intergenic
943896496 2:193369254-193369276 CTCTTAGGGCTGAAGAAGCAAGG + Intergenic
944946799 2:204697288-204697310 GTGTTAAGACTGAGGAACCTGGG + Intronic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
948284583 2:236773831-236773853 CTCTTAACGCTGACGAGGCTTGG + Intergenic
948576327 2:238952850-238952872 CCCTAATGACTGATGAAGTTGGG + Intergenic
1170556504 20:17519079-17519101 CTCTTAAGACTGCTGAGGATGGG + Intronic
1171037826 20:21730516-21730538 CTCTGAGGACTGCAGAAGCTGGG + Intergenic
1171131360 20:22656711-22656733 CTTTAGAGACTGATGAAGGTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183792411 22:40083478-40083500 TTCTTAATTCTGATGAAGTTTGG + Intronic
950718210 3:14864480-14864502 CTCTGGAGTCTGATGAAGTTTGG + Intronic
952651703 3:35735439-35735461 CTCATATGACTGATGATCCTTGG + Intronic
952897454 3:38087221-38087243 CTCTTGGGACTGGTGGAGCTGGG - Intronic
957594456 3:82244260-82244282 CTTGTAAGAATGATGAAACTAGG - Intergenic
960699042 3:120423198-120423220 CTTTTCAGACTGAAGAATCTAGG + Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
962913489 3:139876918-139876940 CTCTTACCACTAGTGAAGCTAGG - Intergenic
964396356 3:156250120-156250142 CTATTAGGATTGATCAAGCTTGG + Intronic
966250221 3:177857621-177857643 CTCTTAACACTGCTTTAGCTGGG + Intergenic
966495001 3:180570266-180570288 CTCTTGAGACTGATTTAGGTAGG + Intergenic
966565803 3:181379727-181379749 CTCTGAAGACTGCTGAATTTAGG - Intergenic
966965120 3:184983882-184983904 CTTTTAAGACTCACCAAGCTTGG + Intronic
971460933 4:26895611-26895633 GACTTAAAACTGATGAAACTGGG - Intronic
971845589 4:31914030-31914052 TTCTTAAGAATTATGCAGCTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
979602748 4:122604325-122604347 CTCTTCAGAATTCTGAAGCTTGG + Intergenic
980437695 4:132800206-132800228 CCCTTAAGGTTCATGAAGCTGGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982060072 4:151596324-151596346 CTCTTAAGAATGTTGAATGTTGG + Intronic
983076499 4:163332586-163332608 TCCTAAAGATTGATGAAGCTAGG + Exonic
983906431 4:173187510-173187532 CTATTAAGATTGCTGAAACTTGG + Intronic
984168883 4:176337287-176337309 TTCATAACACTGAAGAAGCTGGG - Intergenic
986576310 5:9216636-9216658 CTCTAAAAACTTATGAATCTGGG + Intronic
987425806 5:17771569-17771591 CTCTTAAGATTGATGCATTTGGG + Intergenic
988145729 5:27304204-27304226 TTCTGGTGACTGATGAAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995786066 5:115829648-115829670 CTCTCAAGTCTGATTAAACTTGG - Exonic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
998032270 5:138880845-138880867 CACTTAAGGTTGATGAAGCTTGG + Intronic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
1001939000 5:175728038-175728060 CTCTTAAGATTTGTGGAGCTTGG - Intergenic
1002675983 5:180913158-180913180 ATGGGAAGACTGATGAAGCTGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008241245 6:49114820-49114842 CTCTTAAGACTAAATAAGCCTGG - Intergenic
1008806151 6:55431114-55431136 CTCTTACAACTTACGAAGCTGGG + Intergenic
1009694719 6:67087622-67087644 CTCTTAAGGATGTTGAATCTTGG + Intergenic
1011602095 6:89069481-89069503 CTTTCAAGCCCGATGAAGCTGGG - Intergenic
1013774334 6:113662715-113662737 CTCTCAAGACTGCAGAAACTTGG - Intergenic
1013992408 6:116269053-116269075 CTCTTAAGACTGGTGAAAGCAGG - Intronic
1014765189 6:125397919-125397941 CTTTTAAGACTGTTGAATTTTGG - Intergenic
1015692588 6:135941397-135941419 CTCTTGATACCCATGAAGCTGGG - Intronic
1016309127 6:142714465-142714487 CGCACATGACTGATGAAGCTGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018658066 6:166059164-166059186 CATTTCAGACTGCTGAAGCTTGG - Intergenic
1020342726 7:7130205-7130227 CTCATAACACTCATAAAGCTGGG - Intergenic
1020787998 7:12592949-12592971 CACTGAAGACTGATGAGGCCAGG - Intronic
1021930456 7:25576302-25576324 CCTTTAAGACAGATGTAGCTTGG + Intergenic
1023392506 7:39723684-39723706 TTCTTAAGACTGACAAGGCTGGG + Intergenic
1024941615 7:54768786-54768808 CAGTTATAACTGATGAAGCTGGG - Intergenic
1025637645 7:63337250-63337272 CTCTTAACACTGCTTTAGCTAGG + Intergenic
1025645052 7:63410849-63410871 CTCTTAACACTGCTTTAGCTAGG - Intergenic
1027444589 7:78258253-78258275 CTCTTCAGACTGTGGCAGCTGGG + Intronic
1028337260 7:89673244-89673266 CCCTTAAGAATGTTGAGGCTGGG + Intergenic
1028619089 7:92803972-92803994 CTCTTAAGATTAATTAAGGTAGG - Intronic
1028701559 7:93786688-93786710 CTCTTAAGCCTGAAGTAGCAAGG - Intronic
1031212902 7:118853980-118854002 CTCTGAAAACTGATAAAACTAGG + Intergenic
1031414021 7:121474100-121474122 CTCTTAAGACTCCAGAAGCTAGG + Intergenic
1035002238 7:155622316-155622338 CTTTTAAGACATTTGAAGCTGGG + Intronic
1037634665 8:20691084-20691106 CTCTTAAGACTGAGGAAATATGG + Intergenic
1040775089 8:51033260-51033282 CTCTCAAAACTGATGAACCAGGG - Intergenic
1041128041 8:54665682-54665704 CTCTAAGAACTGATGAAACTGGG - Intergenic
1041163930 8:55072640-55072662 CTCTGAGGACAGATAAAGCTGGG - Intergenic
1045692974 8:104778407-104778429 ATCTAAAGGGTGATGAAGCTAGG + Intronic
1045705255 8:104915309-104915331 CTTTTAAGACTGTTGAATATTGG + Intronic
1047300455 8:123609448-123609470 CTCTTAAGATTGCAGAAGCTGGG - Intergenic
1047477905 8:125252542-125252564 ATCTTAATACTGATGAAACAGGG - Intronic
1049891921 9:77535-77557 CTCTAAAGACTGAGGATCCTTGG + Intergenic
1050300453 9:4253185-4253207 CGTTTAAGTCTGCTGAAGCTGGG + Intronic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1051819439 9:21147795-21147817 CTCTAAAAACTTATGAATCTGGG + Intergenic
1053733344 9:41078628-41078650 CTCTAAAGACTGAGGATCCTTGG + Intergenic
1054695076 9:68352937-68352959 CTCTAAAGACTGAGGATTCTTGG - Intronic
1056193559 9:84207508-84207530 CACTTAAAACTAATGAAGCCTGG + Intergenic
1057158620 9:92868176-92868198 CTCTTGAGTCTCAAGAAGCTGGG - Intronic
1057443814 9:95099846-95099868 CTCCTGGGACTGGTGAAGCTAGG - Exonic
1057481022 9:95446056-95446078 AATTTAAGACTAATGAAGCTTGG + Exonic
1058072820 9:100619183-100619205 CGTTTAAGTCTGCTGAAGCTGGG + Intergenic
1059070473 9:111130520-111130542 CTCTTAAGACTCATGCTGTTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1191168482 X:57417802-57417824 CTTTTAAGTCTGCTGAAGCTGGG + Intronic
1192756631 X:74052832-74052854 CTCTTAACACTGCTTTAGCTTGG - Intergenic
1194476031 X:94360971-94360993 TTTTTAAGGCTGATGAGGCTGGG + Intergenic
1196266477 X:113653443-113653465 CTCTTAAGACTGCTGCCGCCAGG - Intergenic
1197299885 X:124765091-124765113 CTCCTAAGACACATGAAGCCAGG + Intronic
1199469770 X:148181613-148181635 CTTTTAAGTCTGCTGAAGCTGGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic