ID: 1100612383

View in Genome Browser
Species Human (GRCh38)
Location 12:96202239-96202261
Sequence CACATCTTGCAGCTTGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100612383_1100612388 25 Left 1100612383 12:96202239-96202261 CCTAACTCAAGCTGCAAGATGTG 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1100612388 12:96202287-96202309 CTCAGTTCCTCAAATGCTTAAGG 0: 1
1: 0
2: 0
3: 30
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100612383 Original CRISPR CACATCTTGCAGCTTGAGTT AGG (reversed) Intronic
901224488 1:7605165-7605187 CCCATCATGCAGCTGGAGATCGG - Intronic
904290856 1:29485197-29485219 CACAGCCTGGAGCTTGGGTTGGG - Intergenic
912260308 1:108105027-108105049 CACTGCTTGCACCTTGATTTTGG + Intergenic
912327198 1:108778039-108778061 CACATCTTGCAGTACAAGTTTGG - Intronic
912738432 1:112171241-112171263 CACTTCTTGCAGCATGTGGTTGG - Intergenic
920845686 1:209591294-209591316 TACATCTGGTAGCTTGTGTTTGG - Intronic
923842312 1:237686391-237686413 GACCTCTTGCAGCCTGGGTTGGG + Intronic
1063401291 10:5748607-5748629 CACATCTTGCAGCGTGTGGATGG - Exonic
1065851791 10:29796364-29796386 GACCTCCTGCAGCTTCAGTTGGG - Intergenic
1066538472 10:36417748-36417770 CTGATGTTGCAGCTTGAGTCTGG - Intergenic
1067544779 10:47184883-47184905 TACATCTTGCTGCCTGAGATAGG + Intergenic
1070741726 10:78907700-78907722 CACATGATGCAGCATGAGATGGG - Intergenic
1077459875 11:2703734-2703756 CACATCCTGCTGCTTGGGTGAGG - Intronic
1078436948 11:11333162-11333184 CTCATCTTGCCTCTTGAGGTAGG - Intronic
1083414878 11:62518973-62518995 CACATCTGGCATCTTGACCTTGG + Exonic
1084162140 11:67355697-67355719 GACATCTTCCAGCCTGGGTTGGG - Intronic
1086206941 11:84269739-84269761 CTCATCTTGCTGCTAGACTTGGG - Intronic
1086797925 11:91132257-91132279 CAGATTTAGCAGCTTGTGTTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1091281182 11:134382794-134382816 CACACCTCGCAGCTTGAAGTAGG + Exonic
1094480180 12:30875241-30875263 GACATCTTCCAAGTTGAGTTTGG - Intergenic
1094658546 12:32443889-32443911 CACAACTTATTGCTTGAGTTTGG - Intronic
1100612383 12:96202239-96202261 CACATCTTGCAGCTTGAGTTAGG - Intronic
1101454035 12:104810833-104810855 CACAGCTTGCAGGTGGAGTCAGG + Intronic
1102188970 12:110971486-110971508 CACATGTTGGAGCCTCAGTTGGG - Intergenic
1102473583 12:113174591-113174613 CACCTCCTTCAGCTGGAGTTTGG - Intronic
1104453163 12:128887923-128887945 CACATCATTCAGCCTGAGATGGG + Intronic
1105577606 13:21668743-21668765 AGCTTCTTGCAGCTGGAGTTAGG + Intergenic
1107332723 13:39319303-39319325 CACCTCATGGAGCTGGAGTTGGG - Intergenic
1112785969 13:102952281-102952303 CACATTTTGCAGGAAGAGTTGGG + Intergenic
1113613533 13:111664850-111664872 CCCAGCTGGCACCTTGAGTTTGG + Intronic
1115409212 14:33053410-33053432 CTCATCATACAGCTTGAGGTAGG - Intronic
1117480370 14:56137867-56137889 CACATATTTCAGTTTGAGGTTGG + Intronic
1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG + Intronic
1126322467 15:47439994-47440016 CACATATTTTAGGTTGAGTTCGG + Intronic
1129393178 15:75230785-75230807 CACATCCTGCAGCTGGAATCAGG + Intergenic
1129924726 15:79353955-79353977 CACATTTGGAAGCTTGTGTTTGG + Intronic
1131344765 15:91636478-91636500 AACATCGTGCAGCGTGAGATCGG - Intergenic
1133994987 16:10741311-10741333 CACCTCTTGCTCCGTGAGTTCGG - Intergenic
1134075628 16:11289379-11289401 CACATCTTGCACCCTGATCTTGG - Intronic
1134165794 16:11928319-11928341 CACATGTTGCAGCTTCTTTTTGG + Intronic
1134494928 16:14725421-14725443 CACATGTTGCAGCTTCTTTTTGG - Intronic
1134500311 16:14764541-14764563 CACATGTTGCAGCTTCTTTTTGG - Intronic
1134526853 16:14951153-14951175 CACATGTTGCAGCTTCTTTTTGG - Intronic
1134545552 16:15105195-15105217 CACATGTTGCAGCTTCTTTTTGG + Intronic
1134580268 16:15364509-15364531 CACATGTTGCAGCTTCTTTTTGG + Intronic
1134714430 16:16349630-16349652 CACATGTTGCAGCTTCTTTTTGG - Intergenic
1134722305 16:16392994-16393016 CACATGTTGCAGCTTCTTTTTGG - Intronic
1134739929 16:16533652-16533674 GACATCTTCCAGCTGCAGTTGGG + Intergenic
1134927570 16:18178512-18178534 GACATCTTCCAGCTGCAGTTGGG - Intergenic
1134945122 16:18318875-18318897 CACATGTTGCAGCTTCTTTTTGG + Intronic
1134952386 16:18359028-18359050 CACATGTTGCAGCTTCTTTTTGG + Intergenic
1135311187 16:21405733-21405755 CACATGTTGCAGCTTCTTTTTGG + Intronic
1135364139 16:21838184-21838206 CACATGTTGCAGCTTCTTTTTGG + Intronic
1135447703 16:22533164-22533186 CACATGTTGCAGCTTCTTTTTGG - Intronic
1136150341 16:28343628-28343650 CACATGTTGCAGCTTCTTTTTGG + Intronic
1136166578 16:28457466-28457488 CACATGTTGCAGCTTCTTTTTGG + Intronic
1136196397 16:28657566-28657588 CACATGTTGCAGCTTCTTTTTGG - Intronic
1136212737 16:28771691-28771713 CACATGTTGCAGCTTCTTTTTGG - Intronic
1136257459 16:29051610-29051632 CACATGTTGCAGCTTCTTTTTGG - Intronic
1136307891 16:29384729-29384751 CACATGTTGCAGCTTCTTTTTGG + Intronic
1136321307 16:29486273-29486295 CACATGTTGCAGCTTCTTTTTGG + Intronic
1136435987 16:30226243-30226265 CACATGTTGCAGCTTCTTTTTGG + Intronic
1137402486 16:48164865-48164887 CACATTTTGCTGCTGGAGGTGGG + Intergenic
1138617484 16:58181666-58181688 CACATCTTACAGCTCCATTTTGG - Intronic
1138845438 16:60559363-60559385 CACACTTTGAAACTTGAGTTTGG - Intergenic
1138946767 16:61860250-61860272 CACATGCTGCACCTTGATTTTGG + Intronic
1139787531 16:69406016-69406038 CACATCTTGCTGCTGCATTTGGG - Intronic
1139855581 16:69977162-69977184 CACATGTTGCAGCTTCTTTTTGG + Intergenic
1140029996 16:71328075-71328097 CACATTTTGGAGCTGGGGTTAGG + Intergenic
1140367152 16:74390929-74390951 CACATGTTGCAGCTTCTTTTTGG - Intronic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1144323965 17:14159452-14159474 CACATCCTGCAGTCTGTGTTTGG - Intronic
1144755352 17:17677034-17677056 CAAACCTAGCAGCCTGAGTTCGG + Intergenic
1146280118 17:31539261-31539283 CAAATCTGGCAGCCTAAGTTGGG - Intergenic
1152623324 17:81377070-81377092 CCTATCTTGCTGCTTGAGTTCGG - Intergenic
1154117053 18:11620350-11620372 CACATGTTGCAGCTTCTTTTTGG + Intergenic
1163067692 19:14811246-14811268 CCCTTCTTGCACCTTGATTTTGG - Intronic
1164090225 19:21944698-21944720 AACATATTTCAGCTTGATTTGGG - Intronic
1164889472 19:31810860-31810882 CATAACTTGCAGCTCGAGTGTGG + Intergenic
1164938197 19:32231093-32231115 CTAATCTTGCAGCCTGAGTGTGG - Intergenic
1165774424 19:38396245-38396267 CGGAACTTGGAGCTTGAGTTTGG + Intergenic
929099207 2:38293107-38293129 CAGTCCTTGCATCTTGAGTTGGG + Intergenic
929455021 2:42059412-42059434 CACATCTTGCCTCTGGTGTTGGG + Intergenic
929723239 2:44394215-44394237 CAAATGTTGCAGCTTAAGTCTGG + Intronic
931196429 2:60056284-60056306 CACATCTAGCTACTTGAGTATGG + Intergenic
932397672 2:71459321-71459343 CATCTCTTGCTGCTGGAGTTGGG - Intronic
932522309 2:72427264-72427286 CACATCTTTCAGCCTGGGGTGGG - Intronic
934701968 2:96449668-96449690 CACATCATGCAGCCAGAGTGCGG + Intergenic
935708226 2:105874670-105874692 GTCATCTTCCAGCTGGAGTTCGG - Intronic
936233375 2:110724018-110724040 CACATCGAGCAGCTTTATTTTGG + Intergenic
937729806 2:125214903-125214925 CACATTTTGGAGATTGAGTTTGG + Intergenic
939329982 2:140745518-140745540 CTCATCTTGCAACTTGTTTTGGG - Intronic
944612229 2:201422754-201422776 GACACCTTGCAGCTTGTCTTTGG - Intronic
1168956539 20:1838310-1838332 CACAGCTTGCAGGTGGAGCTGGG + Intergenic
1170539239 20:17371270-17371292 CGAATCTGGCAGCTGGAGTTGGG - Intronic
1172281887 20:33713758-33713780 CACATCTTGCAAGTTGGATTTGG + Intronic
1172995678 20:39068993-39069015 CACATCCTGAAGCTTGAGGAGGG + Intergenic
1175366011 20:58456721-58456743 GTCATCTTGCTGCTTGAATTCGG + Intergenic
1176690119 21:9896502-9896524 CACATCTTGCAACATGAAGTGGG + Intergenic
1183197709 22:36364868-36364890 CAAACTTTGCAGCTTGACTTGGG + Intronic
950457342 3:13100524-13100546 CGCCTCTTGCAGCTAGAGTTGGG + Intergenic
959564689 3:107822444-107822466 CACAACTTGCAGCTCAAGATCGG - Intergenic
961418735 3:126782515-126782537 CACATCATTTTGCTTGAGTTAGG - Intronic
965119136 3:164528784-164528806 CTCTTCTTCCAGCTTGATTTTGG - Intergenic
968276011 3:197440950-197440972 GACATCTCGCTGCTTGACTTAGG + Intergenic
971525471 4:27612254-27612276 CTCATCTTGCAGATTGTGTTAGG - Intergenic
973076998 4:45941236-45941258 CACTTCTGACACCTTGAGTTTGG - Intergenic
973726581 4:53782898-53782920 CACTTCCTGAAGCGTGAGTTGGG + Intronic
978963657 4:114714915-114714937 CCCATCTTGGAGCTGGAGCTGGG + Intergenic
979606966 4:122648888-122648910 AAGATCTTGGAGATTGAGTTGGG + Intergenic
986230536 5:5860700-5860722 ACATTCTTGCAGCTTGAGTTTGG - Intergenic
989007928 5:36835831-36835853 CACATCTTCAAGGTTGAATTTGG + Intergenic
990946663 5:61256459-61256481 GACATCTTGCAACATGAGTGGGG - Intergenic
991222973 5:64237122-64237144 GACAGCTTGCACCTTGAGCTTGG + Intronic
992421199 5:76606944-76606966 CACAGCTCGAAGCTTGAATTTGG - Intronic
993773606 5:91962855-91962877 CACATCCTGCAACTGGAGTCAGG + Intergenic
994761323 5:103857902-103857924 CCCAGCTTGCAGCTTCTGTTTGG + Intergenic
995269320 5:110203464-110203486 TACTTCTTGCATTTTGAGTTTGG - Intergenic
997086880 5:130811098-130811120 TACAACTTGCTGCTTGAATTTGG - Intergenic
997519887 5:134516185-134516207 CAGAAATTGCAGCTTGGGTTTGG - Intergenic
999390269 5:151184473-151184495 CACATCGTGCAGCGTGAGTTTGG - Intronic
999487735 5:152016060-152016082 CACATCTAGAAGTTTGATTTTGG + Intergenic
999741720 5:154560436-154560458 CCCATCTTGGAGCTGGAGCTGGG + Intergenic
1004644961 6:17552064-17552086 CAAATCTTCCAGCTGGAGGTTGG + Intronic
1007883041 6:45188380-45188402 CATAACTTGCAGTTTGAGGTGGG - Intronic
1011651086 6:89506786-89506808 CACACCTTGCAGCTAGAGATCGG - Intronic
1011980786 6:93375249-93375271 CACATATTGGAACATGAGTTTGG - Intronic
1016980582 6:149850232-149850254 CCCATTTTGCAGCTTGAGGGCGG + Intronic
1017965688 6:159263310-159263332 AACATTTTGCAGGTTGATTTTGG + Intronic
1018984939 6:168629216-168629238 TGCACCTTGCAGCTTGAGTGAGG - Intronic
1020681661 7:11244699-11244721 CTCCTCTTGTAGCTTGATTTAGG - Intergenic
1021523872 7:21564876-21564898 AACATTTTGCAGGTTGAGTAAGG - Intronic
1023116938 7:36871984-36872006 CACATCTTGCAACCTGATTCTGG + Intronic
1023183227 7:37507397-37507419 CACATCTTGCTGCATGCATTTGG - Intergenic
1029578820 7:101421233-101421255 CTGATGTTGCAGCTTGAGATGGG + Intronic
1037505208 8:19522875-19522897 GACATCTTGCAGCCTTACTTTGG - Intronic
1043291978 8:78613319-78613341 CATATCTAGCAGCTTGAGTCTGG - Intergenic
1043330549 8:79112279-79112301 TACATATTGCAGCTTGGTTTAGG + Intergenic
1043518158 8:81015801-81015823 CACTTCTTGCAACGTGACTTTGG + Intronic
1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG + Intergenic
1045519535 8:102891843-102891865 CACTTCTTGTAGCTTGGGTCAGG + Intronic
1050013122 9:1205636-1205658 CACAGCTTGCAGTTAGAGCTGGG + Intergenic
1050129538 9:2396987-2397009 CACTGCTTGCAGCTGGAGTTGGG - Intergenic
1053779144 9:41584973-41584995 CACATCTTGCAACATGAAATGGG - Intergenic
1054167103 9:61795214-61795236 CACATCTTGCAACATGAAATGGG - Intergenic
1054217041 9:62369656-62369678 CACATCTTGCAACATGAAGTGGG - Intergenic
1054670444 9:67785684-67785706 CACATCTTGCAACATGAAATGGG + Intergenic
1055944698 9:81682305-81682327 CATCTATTGAAGCTTGAGTTGGG - Intronic
1056380706 9:86054644-86054666 CACTTGTTGGAGCTGGAGTTTGG - Intronic
1057192084 9:93094005-93094027 CACATCTGGCTGCTAGATTTTGG + Intergenic
1194391485 X:93322641-93322663 CACCTCCTGCAGCTGCAGTTTGG - Intergenic
1196863729 X:120051851-120051873 CCCAGCATGCAGCTTGAGATCGG - Intergenic
1196879370 X:120184479-120184501 CCCAGCATGCAGCTTGAGATCGG + Intergenic
1199381971 X:147181924-147181946 CACATTTTGAGGCTGGAGTTGGG - Intergenic
1201057172 Y:10006358-10006380 CTCATCTTGCACCCTTAGTTGGG - Intergenic
1202103436 Y:21335432-21335454 CTCATCTTGCACCCTTAGTTTGG + Intergenic