ID: 1100613089

View in Genome Browser
Species Human (GRCh38)
Location 12:96208501-96208523
Sequence CTTTCTGTGAAGGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100613082_1100613089 0 Left 1100613082 12:96208478-96208500 CCTTCTCCAGGCCACTGCCAGGG 0: 1
1: 0
2: 6
3: 44
4: 446
Right 1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 264
1100613079_1100613089 28 Left 1100613079 12:96208450-96208472 CCTGAGAAGAGCATGCAATGGCG 0: 1
1: 0
2: 0
3: 76
4: 5769
Right 1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 264
1100613084_1100613089 -6 Left 1100613084 12:96208484-96208506 CCAGGCCACTGCCAGGGCTTTCT 0: 1
1: 1
2: 4
3: 36
4: 471
Right 1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100613089 Original CRISPR CTTTCTGTGAAGGAGCTGGA AGG Intronic
900519851 1:3100238-3100260 CTCTCTGGGAAGGAGGTAGATGG + Intronic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
901135039 1:6987586-6987608 CTTTAGGTGAATTAGCTGGAAGG + Intronic
901806162 1:11740002-11740024 CTGTCTGGGAAAGAGCTGGGCGG + Intronic
903112675 1:21150126-21150148 GTTCCTGTGAAGAAGCAGGAGGG - Intronic
903692112 1:25181693-25181715 CTTTCCCCGAAGGAGCTGGCCGG + Intergenic
904046131 1:27609636-27609658 CTTTATTTGAAGGAGCAGCATGG - Intergenic
905262730 1:36730862-36730884 TTTTCTGGGAAGGAGGTGGGAGG + Intergenic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
907316140 1:53574013-53574035 CTATCTTTGCAGGAGCTGGCTGG - Intronic
908436761 1:64114520-64114542 CTTTCTTTAAAGGTGCTGCAGGG - Intronic
911479701 1:98422535-98422557 CTTTCTTGAAAGGAGCTCGAAGG + Intergenic
913545550 1:119865580-119865602 CTGACTGCAAAGGAGCTGGAGGG - Intergenic
915062270 1:153195938-153195960 TTTTCTGGGAAGGACCTGGGAGG - Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
921687627 1:218108281-218108303 CATTTTGTGAAGGAGCTGAAGGG + Intergenic
922660744 1:227428607-227428629 CTTTCTGTGAAGGAGCCTAAAGG + Intergenic
923967023 1:239153626-239153648 CTTGCTGTGAGGTTGCTGGAAGG - Intergenic
1067375740 10:45726826-45726848 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1067883450 10:50067514-50067536 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1070756882 10:78998752-78998774 TTTCCTGGGAAGCAGCTGGAGGG + Intergenic
1070964268 10:80520093-80520115 CTTTCTGTGAAGGGGGTTGGTGG + Exonic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1073089696 10:100924705-100924727 CTTTATCTGAAGGTGCTGCAGGG - Exonic
1073095505 10:100977286-100977308 GGTGCTGAGAAGGAGCTGGATGG + Intronic
1073440472 10:103549685-103549707 CCTGCTGTGGAGGAGCTGGGAGG - Intronic
1074057438 10:109935349-109935371 CTTTGTTTGAAGCTGCTGGAAGG - Intergenic
1075251309 10:120876850-120876872 TAATCTGTGAAGGAGCTAGATGG + Intronic
1075548746 10:123376648-123376670 CTTGCTGTGTAAGATCTGGAAGG - Intergenic
1077151543 11:1075144-1075166 CTGACTTTCAAGGAGCTGGAAGG + Intergenic
1078102378 11:8337520-8337542 CTTTCTGTGGAGGAGCCAGGAGG + Intergenic
1078341239 11:10499105-10499127 CTGTCTGTGAGGCAGCTGGCGGG + Intronic
1078488818 11:11750188-11750210 ATTTCAGTGGAGGAGATGGAAGG + Intergenic
1078954604 11:16177283-16177305 CATTCTGTGAAAGTGCTGGCAGG + Intronic
1079599680 11:22295523-22295545 CATAGTGTGATGGAGCTGGACGG + Intergenic
1080279314 11:30538558-30538580 GTTTCTCTGAAGGAGGTGGGAGG - Intronic
1080885635 11:36365151-36365173 CCTTCTGTGAAGGAGGTAGCTGG + Intronic
1083877957 11:65534529-65534551 GTTTCTGTTAGGCAGCTGGATGG + Intronic
1084689758 11:70718290-70718312 CTTTCTGTGAAGGGGCAGCCGGG + Intronic
1084734502 11:71095645-71095667 CTTTCTGGGATGGAGGGGGATGG - Intronic
1086086517 11:82960874-82960896 CAGACTGTGAAGGAGCTGTACGG - Intronic
1086132220 11:83412688-83412710 CTTTCTGTCAAGGAATTTGAAGG + Intergenic
1086740760 11:90365631-90365653 ATTTCTGTGAACCAGTTGGAAGG + Intergenic
1087809453 11:102594595-102594617 CTTTCTTTGAGGGATCTGTAGGG + Intronic
1092244436 12:6855736-6855758 CTTTCTGTAAAGAAGCAGGAAGG - Exonic
1092669654 12:10848533-10848555 TGTTCTGTGAAGCTGCTGGAAGG + Intronic
1092704619 12:11268795-11268817 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092708523 12:11309531-11309553 CCATCTGTGAAGGTGCTGGAAGG + Intronic
1092712733 12:11354681-11354703 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092716530 12:11394657-11394679 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092978318 12:13767985-13768007 CTTTCTGTGAAGGAACAGAGAGG - Intronic
1093912719 12:24765524-24765546 CTTTCTGTTGAGGATCTGGAAGG - Intergenic
1096939456 12:55326059-55326081 CCTTCTGTTAAGGGGCTGGGGGG - Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097166253 12:57088031-57088053 CTTCCTGCGGCGGAGCTGGAAGG - Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1099716740 12:86304341-86304363 ATTTTTGTGAAAGAGCTTGAAGG + Intronic
1099755299 12:86838993-86839015 TTTTCTGTGAAAAAGCTAGATGG + Intergenic
1099986043 12:89665709-89665731 CCTTCTGTTCAGGAGCTAGAAGG + Intronic
1100586550 12:95985963-95985985 CTCTCTGTGGAAGAGGTGGAGGG + Exonic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1101837241 12:108304152-108304174 CCTACAGGGAAGGAGCTGGAGGG - Intronic
1101862734 12:108496308-108496330 ATTTTTGTGAAGGAGATGGCAGG - Intergenic
1103458576 12:121086307-121086329 CCTTCAGTGGAGGAGCTGGCAGG + Intergenic
1103780743 12:123397244-123397266 CTTTCTGTGAAGGAAACGCAGGG + Intronic
1103902477 12:124310560-124310582 CTTTCTGTTGAGGAGCAGGATGG + Intronic
1104055019 12:125222930-125222952 CTTTCTTTGAAGGATCAGGCAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106995175 13:35472334-35472356 CTTTCTGGGAGGGAGCAGGAAGG + Intronic
1107102087 13:36604492-36604514 CTCCCTGTGATGGGGCTGGAGGG - Intergenic
1109942892 13:69394487-69394509 CTGTCTGTCAGGGAGCTGGCAGG + Intergenic
1112819146 13:103310651-103310673 CTTTCTTGGACGGAGATGGATGG + Intergenic
1113465688 13:110511429-110511451 TTTTCAGAGAAGGAGCTGGGAGG + Intronic
1113825337 13:113248072-113248094 CCTCCTGTGAAGGTGCTGGCTGG + Intronic
1114935301 14:27528817-27528839 GTTTCTCTGAAGGGGCAGGAAGG + Intergenic
1116250595 14:42477639-42477661 TTTTCTGTGAGAGAGCAGGAGGG + Intergenic
1116805763 14:49492742-49492764 CTTCCAGTGAAGGGGCTGGTGGG + Intergenic
1117263379 14:54060119-54060141 CTTTCTGTGAAAGTCCTAGATGG + Intergenic
1118792512 14:69107990-69108012 CTTTCTGTGAAGCAGCTCCTGGG + Intronic
1119031556 14:71196838-71196860 CTGACTGTCAAGGAGCTGAAGGG - Intergenic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1120554475 14:85912197-85912219 CTCTCTGTGAAAGACTTGGAGGG + Intergenic
1121167553 14:91821093-91821115 ATTTCTGTAAAAAAGCTGGAAGG - Intronic
1122062097 14:99143013-99143035 CTATCTCTCAAGAAGCTGGACGG + Intergenic
1122601742 14:102925106-102925128 GTGGCTGTGAAGGGGCTGGAAGG - Intronic
1123998583 15:25735472-25735494 CTTTCTGTTTTGGAGCAGGAAGG + Intronic
1125167505 15:36725200-36725222 TTATCTGTGAAGGAGAAGGAAGG - Intronic
1126174610 15:45723823-45723845 CTCCTTGAGAAGGAGCTGGAGGG + Intergenic
1126796425 15:52263702-52263724 CTTTCTGAGAAGGTGGTGGGTGG - Intronic
1127104872 15:55602959-55602981 CTTTGTGAGACTGAGCTGGAGGG + Intergenic
1127319730 15:57831315-57831337 CCCTCAGAGAAGGAGCTGGAAGG + Intergenic
1127965876 15:63922597-63922619 GATTCTGTGGAGGGGCTGGAAGG + Intronic
1128337698 15:66797977-66797999 CTTTCTGTGATGCAGCCAGATGG + Intergenic
1128381936 15:67119555-67119577 CTGTCTATGAAGCAGATGGATGG + Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129175637 15:73837970-73837992 CTTCCTGGGGAGGAGCTGCAAGG - Intergenic
1130906835 15:88246715-88246737 CTTCCTGGGAAGGAGGTGGCTGG - Intronic
1132041202 15:98525620-98525642 CTTCCTGGGATGGAGATGGAGGG - Intergenic
1132744004 16:1429220-1429242 CTGCCTGTGAAGGAGCAGTAAGG + Intergenic
1136014429 16:27386274-27386296 CTTGCTGTGAGGGAGATTGAGGG + Intergenic
1136293404 16:29289117-29289139 CTCTCTGCGAAGGAGCTTGCTGG + Intergenic
1137076591 16:35972544-35972566 CTTTCTTTGATTGAGCAGGATGG - Intergenic
1138984604 16:62313168-62313190 CTTTCTATGAACGAGGTGGGAGG - Intergenic
1141399305 16:83733217-83733239 TGTTCTGTGAAGGAGCTGGAGGG - Intronic
1142099285 16:88263123-88263145 CTCTCTGTGAAGGAGCTTGCTGG + Intergenic
1146889716 17:36498522-36498544 CTTGCTGCTAAAGAGCTGGATGG - Exonic
1149005580 17:51801957-51801979 CTTCCTGGGAAGGAGGTGCAGGG + Intronic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1152380946 17:79941985-79942007 CTTTCTGAGAACGAGCTGGTGGG + Intronic
1152556253 17:81054664-81054686 CTTTGTGAGAAGGAGCTGCAGGG - Intronic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1154009601 18:10563820-10563842 CTTTCTGGGAAGGATGTAGAAGG + Intergenic
1155056626 18:22189529-22189551 GTTCCTGTGAAAGAGCTGAAAGG + Intronic
1155255396 18:23992920-23992942 CTGTGTGTGTAGGTGCTGGAGGG - Intronic
1156089593 18:33449961-33449983 CTTACTATGAAGGAGCTTGCAGG + Intergenic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156341789 18:36215869-36215891 CTTTCTCTGAAGGAGTCGGCTGG - Exonic
1157385632 18:47257889-47257911 CTTTCTGTCATGGAGCTTAAGGG + Intergenic
1157593729 18:48851320-48851342 CTTTCTGTGATGGGGCTGCTTGG - Intronic
1158103282 18:53855079-53855101 CTTTCTCTGAAGGAAGAGGAGGG - Intergenic
1158659602 18:59374247-59374269 GTTCCTGGGAAGGAGCTGAATGG + Intergenic
1158854628 18:61530807-61530829 CATTCTGGGAAGGAACTGGGGGG - Intronic
1159272200 18:66167816-66167838 ATTCTTGTGAAGGAGCTTGAGGG - Intergenic
1159949280 18:74468645-74468667 CTCTGTGTGGAGGAGATGGAGGG + Intergenic
1160909705 19:1468946-1468968 CTTTCTGGGCAGGGGCTGGGAGG - Exonic
1164530239 19:29042917-29042939 CACACTGTGAAGGAGCAGGATGG - Intergenic
1167948046 19:53005126-53005148 CATTATGTGGAGGACCTGGATGG - Intergenic
925340742 2:3133933-3133955 CTTTTTGAGCAGGAGCTGTAAGG + Intergenic
925672600 2:6327259-6327281 CATTCTGTGAAGCAGCCAGAAGG - Intergenic
926153494 2:10437163-10437185 CATGCTGTTAAGCAGCTGGAGGG - Intergenic
926376867 2:12238676-12238698 CTTACAGCCAAGGAGCTGGATGG - Intergenic
926813655 2:16779206-16779228 CTTTCAGGCAAGGAACTGGAAGG + Intergenic
928635638 2:33243097-33243119 ATGTCTGGGCAGGAGCTGGATGG - Intronic
928890042 2:36193901-36193923 CTTGCTGGGAAGAAGCTGGCAGG + Intergenic
928981592 2:37141306-37141328 ATTTCAGAGAAGTAGCTGGATGG - Intronic
930435302 2:51333331-51333353 CTTTGGGAGAATGAGCTGGAAGG + Intergenic
931147002 2:59530055-59530077 CTATGTGTGAAGGAGCAGGTGGG - Intergenic
934071209 2:88385285-88385307 GCTTCTGTGAAGGGGCTGGCGGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935287274 2:101576289-101576311 CTCTGTGTGAAGGAGAGGGAGGG + Intergenic
935671009 2:105557203-105557225 CTTCCTGAGAAGGAGCTGTGGGG - Intergenic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
937711329 2:124983690-124983712 CTTTCTGTGACCCAGCTGGCAGG + Intergenic
937758931 2:125576103-125576125 CCTTCTGTAAAGTACCTGGAAGG + Intergenic
938595484 2:132783716-132783738 ATTACGGTGAAGGAGCTGGAGGG + Exonic
939014731 2:136889268-136889290 CTTTATGTAAATGAACTGGAAGG - Intronic
939021897 2:136967206-136967228 CTTTCTTTGAAGGACTTTGAAGG - Intronic
943270569 2:185797233-185797255 CTTTATCTGAAGTATCTGGAGGG + Exonic
944992795 2:205256774-205256796 GTTTCTGGGAAGGAGATGAAAGG + Intronic
945646847 2:212506937-212506959 CTTTCTATGAAAGTGCTAGATGG - Intronic
946972698 2:225112736-225112758 CTTCCTGTGAGTGGGCTGGAGGG - Intergenic
946986997 2:225284619-225284641 CTCTCTGTGAATCAGCTGTATGG + Intergenic
948599341 2:239099602-239099624 CTTTCTGTCCGGGAGCTGGGTGG - Intronic
1169297110 20:4409435-4409457 CTTTCAGGGAAAGAGCTAGATGG - Intergenic
1169596167 20:7201895-7201917 CTTACTGTGAAAGACCTAGAGGG + Intergenic
1170422621 20:16207632-16207654 CATTCTGGGAGGGAGCTGTAAGG + Intergenic
1170916111 20:20627656-20627678 CTTTCTGTGCAGCAGAGGGAGGG + Intronic
1171420101 20:25012268-25012290 CTCTCTGTAATGGGGCTGGACGG + Intronic
1172056073 20:32155204-32155226 CTTGCTGGGGAGGGGCTGGAAGG - Intronic
1172330488 20:34072670-34072692 CTTTCTGAGAGCGAGCAGGAGGG + Intronic
1172576556 20:36013519-36013541 ATCTCTGTGAAGGAGTTGGGGGG + Intronic
1172603964 20:36202221-36202243 CCTGCTGTGGAAGAGCTGGATGG - Intronic
1173037240 20:39424208-39424230 CTCTCTTTGAAGGAGCAAGAAGG + Intergenic
1173402761 20:42739828-42739850 CTTTCTGTAATAGAGCAGGAAGG - Intronic
1175118959 20:56703640-56703662 CTCTCTGTGGAGGAGCTGGGAGG + Intergenic
1176675227 21:9771371-9771393 TTTTCTGTGTAGGAGCTTGAGGG + Intergenic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1179165935 21:38935079-38935101 CATTCTGTTATGGGGCTGGAGGG - Intergenic
1180592955 22:16956271-16956293 CTCTCTGTGAAGGCGCTGTGTGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183437565 22:37804596-37804618 CTTTCCCTGAAAGAGTTGGAAGG - Intergenic
1183847223 22:40552285-40552307 ATTGCTGTGAATGGGCTGGACGG - Exonic
1184706754 22:46219485-46219507 CTTTGAGTGAAGGAGGTGAACGG - Intronic
1185124648 22:49001926-49001948 CTTTCTGTCCAGGACCAGGAAGG - Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949979606 3:9493643-9493665 GTTTCTGTGAAAGAGCTGGGAGG - Intergenic
951262294 3:20524088-20524110 CTGTCTGAGTAGGAGCTGCAAGG + Intergenic
953562280 3:44000630-44000652 CACTCAGTGAAGGAGCTGGAGGG + Intergenic
954250854 3:49366269-49366291 CCTTTTGTGAAGCTGCTGGAAGG - Intronic
955785132 3:62529607-62529629 ATTGCGGTGAAGGAGATGGATGG + Intronic
955979072 3:64506553-64506575 CTTTCTGTGAGGTAGCTTGCTGG + Intergenic
956787544 3:72655129-72655151 CTGTCTGTGAAGGAATGGGAGGG - Intergenic
957587851 3:82155650-82155672 CTCCCTGTGAAGCAGCTGAAAGG - Intergenic
958560753 3:95744798-95744820 CTATCTGGGAAGGAGGTGGGGGG - Intergenic
959080361 3:101794441-101794463 CTGGCTGTGAAGAAGATGGAAGG + Intronic
962388025 3:134948712-134948734 CATGCTGTGAAGGAGCTGTGTGG + Intronic
962871457 3:139497016-139497038 CATTCTGTGAGGAAACTGGATGG + Intergenic
964642175 3:158920547-158920569 TGTTCTGTGAGGGAGCAGGAGGG - Intergenic
966541246 3:181092524-181092546 CTTTCAGAGAAAGAGCTTGAAGG - Intergenic
967889838 3:194357156-194357178 CTTTTTGTGCAGGAACTGGAAGG + Intronic
968951401 4:3695707-3695729 CTTTTTCTGAAGGAGCTTGTGGG + Intergenic
969418148 4:7074470-7074492 CCTACTGAGAAGGAGCAGGAGGG - Intergenic
970900361 4:21151750-21151772 CTTGCTGTGAATGAACTGAATGG + Intronic
971863160 4:32135576-32135598 GTTTCTTTGAAGGAGTTCGAAGG - Intergenic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
975063165 4:70029431-70029453 CTTTCTGTGATAGAGATGTAGGG + Intronic
975412345 4:74068314-74068336 CTTTCTGTGAGAGTCCTGGAAGG + Intergenic
976665924 4:87591733-87591755 CTTTCTGTGAAGAATCTTGCCGG - Intergenic
977458936 4:97299895-97299917 CTATCTGTGAAAGAGCTTGTTGG + Intronic
978040095 4:104049571-104049593 CAGTCTGTGAAGGAGATGTATGG - Intergenic
978321653 4:107503113-107503135 CGTTGTGTGAAGGACCTGGTAGG - Intergenic
979083959 4:116382015-116382037 ATTTCTATGAAGAAGCTGAACGG + Intergenic
979172473 4:117619620-117619642 CTTTCTGTCAGGGAGCTTGAAGG - Intergenic
983430083 4:167638527-167638549 CGTTCTTTGATAGAGCTGGAAGG - Intergenic
985400326 4:189587326-189587348 TTTTCTGTGTAGGAGCTTGAGGG - Intergenic
985546751 5:513781-513803 CTTCCTGAGAAGGAGCTGTCAGG - Intronic
986025234 5:3844438-3844460 CTTGCAGTAGAGGAGCTGGAAGG + Intergenic
986231435 5:5867787-5867809 GTTTCTGTGTAGGAACTTGAAGG - Intergenic
986361260 5:6980495-6980517 CTTTCCGTGAAGTGTCTGGAAGG + Intergenic
986579653 5:9252044-9252066 CTTTCAGTGAATGAGTTGGCAGG + Intronic
986838156 5:11665301-11665323 CTTTCAGTGAAGCAGCTGGATGG - Intronic
986843961 5:11731681-11731703 TTTTCTGAGATGGATCTGGAAGG - Intronic
986910003 5:12544251-12544273 GTTCCTGTGAGGGGGCTGGAGGG + Intergenic
987855617 5:23416049-23416071 CTTTCTGTGAACTAGCTGAATGG - Intergenic
990507100 5:56455736-56455758 GTTTTGGTGGAGGAGCTGGAAGG - Intergenic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
991933893 5:71783031-71783053 ATTTCTGTCAAGGAGAGGGAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996119151 5:119651527-119651549 CTTTCTCTGAAGGTTGTGGATGG + Intergenic
996700623 5:126447137-126447159 CTTTGTCTGAAGGAATTGGAAGG + Intronic
997244462 5:132335166-132335188 CTTTCTGTGAAGGGGATGACTGG - Intronic
998391349 5:141788907-141788929 CTGTCTGGGAAGGGGCTTGAGGG - Intergenic
998575761 5:143314115-143314137 GTTGCTGTTGAGGAGCTGGATGG + Exonic
998975075 5:147636422-147636444 ATTTCTTTGAAGGAGCTGGCAGG - Intronic
1000739077 5:164943127-164943149 CTTCCTGTGAAGGACCTGAATGG + Intergenic
1002152218 5:177243579-177243601 CTTTCTGTGACTGAAATGGATGG - Intronic
1002343220 5:178530595-178530617 CTAAGTGTGAAGGAGCTGGGAGG - Intronic
1003035046 6:2634482-2634504 CTTTCTCGGAAGCAGCTGGGGGG + Intronic
1003122278 6:3328422-3328444 CTTTATGTGACGGAGGAGGAAGG + Intronic
1003271709 6:4613430-4613452 CTGGCTGGGAAGGAGCAGGATGG - Intergenic
1003632450 6:7800413-7800435 CATTCTGTGAAGGAGATGTGAGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1006642036 6:35494607-35494629 CTTTCTGTGAAGGGGCTAGGAGG - Intronic
1006901099 6:37502071-37502093 CATTGAGTGATGGAGCTGGAAGG + Intergenic
1007263962 6:40583720-40583742 CTATCTGTGTAGTAGCGGGAGGG - Intronic
1008633916 6:53390488-53390510 ATTTCTCTGAAGGAGTTAGAAGG + Intergenic
1010889458 6:81288278-81288300 TTTACTGTGAATGAGATGGATGG - Intergenic
1011906139 6:92370635-92370657 CTGTCATTGAATGAGCTGGATGG - Intergenic
1013392588 6:109701677-109701699 CTTTCTGTGATGGGGGTGGGAGG - Intronic
1014383014 6:120767637-120767659 TTTTCTGGGATGGAGCTGGAGGG - Intergenic
1016527017 6:145013052-145013074 TTTTATGTGTAGGAGCTGAATGG + Intergenic
1016615370 6:146041784-146041806 TTTTCTGTGAGGAAGATGGAAGG + Intronic
1018455961 6:163952341-163952363 CTTTCTGTGCTGCTGCTGGAAGG - Intergenic
1021506712 7:21393791-21393813 ATTTCTATGAGGGAGCTAGAGGG - Intergenic
1024633522 7:51268373-51268395 CTGTTAGTGAAGGAGCTTGAGGG - Intronic
1024808743 7:53182221-53182243 CTTTCTCAGTAGGAGTTGGAAGG - Intergenic
1029416538 7:100446615-100446637 TGTTGTGTGAAGGAGCTGGTGGG + Intergenic
1031227978 7:119065538-119065560 CTTTCTGAGAAGGACCCTGAAGG + Intergenic
1031886096 7:127247435-127247457 CTTTTTGTTAAAGAGCTGAATGG - Intronic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1034971633 7:155423234-155423256 CATTCTGCGATGGGGCTGGAAGG - Intergenic
1035261628 7:157665169-157665191 CTTTAAGTGAAGTGGCTGGAAGG - Intronic
1036403400 8:8431216-8431238 CTTTGTGGGAAATAGCTGGATGG - Intergenic
1038459320 8:27702939-27702961 CTTTCTGTTTGGGAGCTGGTTGG - Intergenic
1040762265 8:50863352-50863374 ACTTCTGTGACGGTGCTGGAGGG - Intergenic
1041958792 8:63587258-63587280 TTTTCTCTGAATGAGTTGGAAGG + Intergenic
1046474495 8:114723994-114724016 CTCTCTGGAAAGGAGATGGAAGG + Intergenic
1048533071 8:135268294-135268316 CTTGGTGTGAGGAAGCTGGAGGG + Intergenic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049735513 8:144202774-144202796 CTGTCTGTGGAGGGGCTGGGAGG + Intronic
1049735721 8:144203309-144203331 CTCTCTGTGGAGGGGCTGGGAGG + Intronic
1052081319 9:24209619-24209641 CTCTCTTTGAAGGATATGGATGG + Intergenic
1053206125 9:36188094-36188116 CTATATGTGAAGGAGGTAGAGGG - Intergenic
1053234042 9:36436371-36436393 CTTTCAGAAAAGGAGCTGAATGG - Intronic
1057429119 9:94978150-94978172 CACACTGTTAAGGAGCTGGAAGG - Intronic
1057440414 9:95078925-95078947 CTTTCTGTTGGGGAGGTGGAGGG + Intronic
1057529774 9:95834126-95834148 ATTTCTGTGAGGAAGCTTGATGG - Intergenic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1060311513 9:122466729-122466751 CTTTCAGTGAAGGGGCTCCAAGG + Intergenic
1061010805 9:127953594-127953616 CTCCCTGTGCAGGAGCTGAAAGG - Exonic
1061147502 9:128808530-128808552 CACTCTGGGAAGGAGGTGGAAGG - Exonic
1061912561 9:133732717-133732739 CTTTCTCTGCAGGACCTGGGGGG + Intronic
1062108879 9:134771226-134771248 CTTTCTGTGAAGGACCTAGTGGG - Intronic
1062236029 9:135508025-135508047 ATATCTGGGAAGGAGCTGGTTGG + Intergenic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062432814 9:136533517-136533539 CTATCTGGGAAGGAGGTGGGCGG - Intronic
1062685973 9:137813677-137813699 CCTCCCGTGAAAGAGCTGGAAGG + Intronic
1185741171 X:2533529-2533551 CGCTCTGTAAAAGAGCTGGAGGG - Intergenic
1187003580 X:15207948-15207970 CTTTCTGTGATGGACCAGGAAGG - Intergenic
1189162039 X:38819344-38819366 CATTCTGCGAAGGGTCTGGAAGG - Intergenic
1190018445 X:46849966-46849988 CTCTGTGTGAAGGAGAGGGAGGG - Intronic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1192448007 X:71224708-71224730 CTTCCTTTTGAGGAGCTGGAGGG + Exonic
1192583197 X:72301524-72301546 CTAGCTGGGAAGGAGCTGGATGG - Intronic
1194854820 X:98915656-98915678 CTTTCTAAGAAGGAGCTCGTGGG - Intergenic
1201787026 Y:17795834-17795856 AATTATTTGAAGGAGCTGGAAGG - Intergenic
1201814527 Y:18110154-18110176 AATTATTTGAAGGAGCTGGAAGG + Intergenic
1201865795 Y:18652801-18652823 GGTACTTTGAAGGAGCTGGAAGG - Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic