ID: 1100613534

View in Genome Browser
Species Human (GRCh38)
Location 12:96212568-96212590
Sequence ATGTTGTTATAGGGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100613520_1100613534 16 Left 1100613520 12:96212529-96212551 CCCTGCAATTCCCAGGACTTCTA 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 244
1100613522_1100613534 6 Left 1100613522 12:96212539-96212561 CCCAGGACTTCTAAATCTGTTTC 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 244
1100613518_1100613534 30 Left 1100613518 12:96212515-96212537 CCTGAAAAGATTTTCCCTGCAAT 0: 1
1: 0
2: 4
3: 16
4: 219
Right 1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 244
1100613521_1100613534 15 Left 1100613521 12:96212530-96212552 CCTGCAATTCCCAGGACTTCTAA 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 244
1100613523_1100613534 5 Left 1100613523 12:96212540-96212562 CCAGGACTTCTAAATCTGTTTCC 0: 1
1: 0
2: 2
3: 21
4: 251
Right 1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG 0: 1
1: 0
2: 0
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100613534 Original CRISPR ATGTTGTTATAGGGGGGAGG TGG Intronic
903308615 1:22433613-22433635 ATTTTGATATACGGGGGTGGAGG + Intergenic
903370627 1:22833002-22833024 ATGTGTTTATATGGGGGTGGGGG - Intronic
905038217 1:34930518-34930540 ATGCTGTAATGGGGGGGAGGGGG + Intergenic
907525665 1:55052591-55052613 GATTTGTTATAGGGTGGAGGGGG + Intronic
908685592 1:66715461-66715483 ATGTTGTTGTTGGGGGGGCGTGG + Intronic
908698049 1:66867076-66867098 ATGTTGTGAGAGGGAAGAGGTGG - Intronic
911592191 1:99761121-99761143 ATTTTGTTTTGGGGGGGTGGGGG + Intronic
913197019 1:116465739-116465761 TTGTTGTTATAAGGGGCAAGGGG - Intergenic
913289270 1:117257625-117257647 ATGTGGATATAGGGAGGAAGAGG - Intergenic
914327762 1:146636965-146636987 ATGTTGTGATAGATGGGTGGTGG + Intergenic
915040984 1:152968051-152968073 CTGTTGTGGTGGGGGGGAGGGGG + Intergenic
915123194 1:153645487-153645509 TTGTTTTTTTAGGGGGGAGGGGG + Exonic
915780561 1:158545322-158545344 ATGTTGTGGGTGGGGGGAGGGGG + Intergenic
916092463 1:161318271-161318293 ATGTTTATATGCGGGGGAGGGGG - Intronic
917201609 1:172522798-172522820 GTGTCGTTATAGGGTGGAAGGGG - Intergenic
917329047 1:173862868-173862890 ATGTGCTTATTTGGGGGAGGGGG + Intergenic
918288550 1:183082923-183082945 ATGTTGTGATATGGTGGAGCAGG + Intronic
920455542 1:206098326-206098348 ATACAGTTATTGGGGGGAGGGGG - Intronic
920818138 1:209354800-209354822 TTGTTGTTGTTGTGGGGAGGAGG + Intergenic
920856155 1:209663909-209663931 ATGTGGGTTTAGGGGAGAGGAGG + Intergenic
923448866 1:234097927-234097949 ATGGTGTTATAGGGTGATGGTGG + Intronic
923449005 1:234098734-234098756 ATGGTGTTATAGGGTGATGGTGG + Intronic
924715371 1:246567847-246567869 ATGTTTTTTAAGGGGAGAGGGGG - Intronic
1062803362 10:396346-396368 ATTTGGATAAAGGGGGGAGGTGG - Intronic
1064978823 10:21145997-21146019 ATTTTGTTCCAGGGGCGAGGAGG - Intronic
1065330700 10:24595374-24595396 ATGTTGTTGGAGGGTGGGGGAGG - Intronic
1065422962 10:25567574-25567596 GTGTTTGTATAGGTGGGAGGAGG + Intronic
1066306402 10:34147204-34147226 GTGCTGTTATCGGGGTGAGGTGG - Intronic
1067144986 10:43688393-43688415 ATTTTTTTATGGGGGGGGGGGGG + Intergenic
1068411119 10:56656701-56656723 CTGTTGTTGTGGGGGGGAAGGGG - Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1070055697 10:72932581-72932603 ATGTTCTTAGAGGGCGGTGGGGG - Exonic
1072105531 10:92270022-92270044 AAGTTGTTATGGGGGGTGGGGGG + Intronic
1073402376 10:103268997-103269019 ATGGTATCATAGGGGGGAGCTGG - Intergenic
1073935336 10:108624645-108624667 ATGTTGGTATAGAGGGGATCTGG - Intergenic
1074071148 10:110070971-110070993 TTGTTGTTTTTGGGGGGGGGGGG + Intronic
1074346629 10:112692560-112692582 CTGTTTTTATTGTGGGGAGGTGG + Intronic
1077601523 11:3578054-3578076 ATGTGTTTATGGTGGGGAGGCGG - Intergenic
1078590995 11:12640926-12640948 ATGTGGTGATGGGGGGGATGTGG - Intergenic
1078949330 11:16111812-16111834 ATGTTATTCCAGGGGGGAAGAGG + Exonic
1079587538 11:22144534-22144556 AAGTAGTTATAAGGGGGAAGAGG + Intergenic
1082745591 11:56958079-56958101 AGGTTTTTTTTGGGGGGAGGGGG + Intergenic
1084257430 11:67952623-67952645 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1084531849 11:69732136-69732158 GTTTTGTTTTTGGGGGGAGGTGG - Intergenic
1084645680 11:70456177-70456199 ATCTTGTGGGAGGGGGGAGGGGG + Intergenic
1084761299 11:71272824-71272846 TTCTTGATATAGGAGGGAGGCGG - Intergenic
1084815340 11:71642631-71642653 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1085880098 11:80457087-80457109 TTGTTGTTAAAGTGGGGAGCGGG - Intergenic
1086062670 11:82716140-82716162 TTGTTGTTATATGTGGGAAGAGG + Intergenic
1087158328 11:94925723-94925745 AGGTTTTTATAGGGAGGAGTAGG + Intergenic
1088055810 11:105575873-105575895 TTGTTTTTTTTGGGGGGAGGGGG - Intergenic
1088856585 11:113760677-113760699 TTTTTTTTAGAGGGGGGAGGGGG - Intronic
1090474514 11:127007467-127007489 ATGTGGTCATATGGGGGGGGGGG - Intergenic
1092387188 12:8044826-8044848 TTGGTGTTATAGAGGGGAGGGGG - Exonic
1093563048 12:20565563-20565585 AAGGTGATATAGGGTGGAGGAGG + Intronic
1093662348 12:21772372-21772394 TTGTTTTTTTCGGGGGGAGGTGG - Intronic
1098148186 12:67519151-67519173 ATGTTGTTACAGGGGGTAAGTGG - Intergenic
1098577759 12:72063171-72063193 AGGTTGTCATAGGTGGGAAGTGG - Intronic
1100613534 12:96212568-96212590 ATGTTGTTATAGGGGGGAGGTGG + Intronic
1101348120 12:103905076-103905098 ATGTTATTAGGGGAGGGAGGAGG - Intergenic
1101778845 12:107817594-107817616 CTGTTGTTCTAGGTGTGAGGTGG - Intergenic
1102134454 12:110561612-110561634 ATGTTGATATAGGCTGGATGCGG - Intronic
1106826374 13:33525792-33525814 AGGTTGTTTTTGGTGGGAGGGGG + Intergenic
1108082488 13:46751018-46751040 ATGTATTTAGTGGGGGGAGGGGG + Intronic
1108673289 13:52713364-52713386 GTGTTGTTATAGCTGGGAAGTGG - Intronic
1110046309 13:70836471-70836493 ATCTTTTTTTGGGGGGGAGGGGG + Intergenic
1112736311 13:102423390-102423412 AAGTTGTTATAGTAGAGAGGAGG + Intergenic
1112946799 13:104938221-104938243 ATGTTGTTATCGGGAGGTGCAGG + Intergenic
1115925779 14:38431888-38431910 ATCATGTTATAATGGGGAGGAGG + Intergenic
1115953136 14:38744420-38744442 ATGGTTTTATAAGGGGGTGGGGG - Intergenic
1117082374 14:52165610-52165632 ATGTTGATCTGGGGGGGGGGGGG - Intergenic
1118474751 14:66106175-66106197 ATGTTTGTATAGAGGGGTGGGGG + Intergenic
1118495581 14:66305283-66305305 ATGTTTTCATGGGGAGGAGGAGG - Intergenic
1119636147 14:76275017-76275039 ATGTTGCTATATGGTGGATGGGG + Intergenic
1120061653 14:79990421-79990443 ATGATGTTATAGGTTGGAGGAGG + Intergenic
1121060295 14:90901882-90901904 ATGTTTTTATATGGGGGTTGAGG + Intronic
1125343532 15:38697067-38697089 ATGTTGGTATAAGGGGCATGGGG - Intronic
1126250926 15:46566725-46566747 AAGTTATTATAGGGAGGAGGTGG - Intergenic
1126513473 15:49507083-49507105 ATATTGTTATGGGGGGTGGGGGG - Intronic
1126794070 15:52245546-52245568 CTGTTGTCATAGGGCGGGGGTGG + Intronic
1128690654 15:69722205-69722227 ATGTTGTCGGAGGTGGGAGGAGG - Intergenic
1129103490 15:73288162-73288184 TTGTTGTTGTTGGGGGCAGGAGG + Intronic
1130012075 15:80159887-80159909 ACGTGGTCATAGGGGGGATGAGG + Intronic
1130136798 15:81188267-81188289 ATGTTGTTATGAGGTGGAGAGGG + Intronic
1130221447 15:82022817-82022839 TAGTTGTTATATGTGGGAGGAGG + Intergenic
1130379558 15:83359933-83359955 ATTTTTTTTTAGGGGGCAGGAGG + Intergenic
1130850540 15:87789404-87789426 CTGTTGTGAGTGGGGGGAGGGGG + Intergenic
1134293199 16:12920698-12920720 ATGTTGATATTGGGGAGAGTGGG - Intronic
1135109649 16:19680912-19680934 CTGTTTTTTTAGGGGGGGGGCGG - Intronic
1135338004 16:21620429-21620451 ATTTTTTTAAGGGGGGGAGGTGG - Intronic
1135599040 16:23765941-23765963 ATGTTGTTATGGGAAGAAGGAGG + Intergenic
1136925460 16:34368647-34368669 ATGTTTTTAAAAGGGGGAGGAGG + Intergenic
1136979114 16:35043159-35043181 ATGTTTTTAAAAGGGGGAGGAGG - Intergenic
1137480865 16:48850740-48850762 ATGCTTTTATAAGGGGGAGAAGG + Intergenic
1137785684 16:51135320-51135342 CTGTTGTTCTGGGGCGGAGGGGG - Intergenic
1137964161 16:52914343-52914365 ATGTTATTGAAGGGTGGAGGTGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138371233 16:56528157-56528179 ATTTTGATATCGGGGGGAGATGG + Intergenic
1138556290 16:57772881-57772903 AGGCTCTTATAGGGGGAAGGGGG + Intronic
1139953466 16:70682651-70682673 ATGTGGTTACCGTGGGGAGGGGG - Intronic
1141492026 16:84380227-84380249 ATGCTGATATCTGGGGGAGGGGG - Intronic
1144204406 17:12969239-12969261 ATGTTGATAAAGGGGGGAAAAGG - Intronic
1144543240 17:16166740-16166762 ATGTTGATAAAGGAGGGAGGGGG - Intronic
1145908350 17:28528561-28528583 ATGGTGTTTTATGGGGGATGGGG - Intronic
1145931653 17:28690245-28690267 ATTTTTTTATTGGGGGCAGGAGG + Intronic
1146275727 17:31514430-31514452 ATGTGGCTGTAGGGGGAAGGTGG + Intronic
1147388521 17:40095661-40095683 TTGTTGTCATTGGGGGCAGGTGG + Exonic
1149342767 17:55703530-55703552 ATGTTATTTTTGGTGGGAGGTGG + Intergenic
1149508987 17:57221602-57221624 ATGCTGATAGTGGGGGGAGGGGG + Intergenic
1150819169 17:68421226-68421248 TTGTGGTTATAGGGGACAGGAGG - Exonic
1151036014 17:70800786-70800808 ATGTTTTTTTTGGGGGGATGGGG + Intergenic
1151756542 17:76078466-76078488 TTGTTGTTGTTGGGGGGAAGTGG + Intronic
1154400288 18:14030554-14030576 CTGTTTTTATTGGGGGCAGGTGG + Intergenic
1155026974 18:21949846-21949868 ATGTTGCAATTGGCGGGAGGCGG - Intergenic
1155207492 18:23573359-23573381 ATGTTATTGCAGGGTGGAGGTGG - Intronic
1155459211 18:26057663-26057685 ATGTTGTGAGAGCGTGGAGGTGG + Exonic
1156013671 18:32523368-32523390 TTTTTTTTGTAGGGGGGAGGTGG - Intergenic
1156678299 18:39557933-39557955 AGTATATTATAGGGGGGAGGTGG + Intergenic
1159186996 18:64988148-64988170 TTGTAGTAATAGGGGGCAGGGGG - Intergenic
1160117902 18:76099279-76099301 ATGATGTGACACGGGGGAGGAGG - Intergenic
1163739546 19:19002880-19002902 ATGCTCTTCTTGGGGGGAGGTGG - Intronic
1164155462 19:22593917-22593939 AGGTTGTTAGAGGAGGGAAGTGG + Intergenic
1164393287 19:27843828-27843850 ATGTTTTAATAGGGAGGATGGGG + Intergenic
1164738609 19:30560319-30560341 ATGATGGTTTATGGGGGAGGTGG - Intronic
1165380922 19:35479552-35479574 ATGCTTTTAGAGGAGGGAGGGGG - Intergenic
1165489426 19:36114705-36114727 ATGTTGTTACTGTGGGGAGGGGG + Exonic
1166035713 19:40166792-40166814 ATCTTCTTTTGGGGGGGAGGGGG - Intergenic
1166956470 19:46468752-46468774 ATATTTTTTTTGGGGGGAGGGGG + Intronic
1167135691 19:47613912-47613934 ATGTATTCATTGGGGGGAGGGGG + Intronic
925860576 2:8171890-8171912 AGGTGCTTAGAGGGGGGAGGTGG - Intergenic
927591337 2:24360498-24360520 ATGTTGTTGTGGGGCTGAGGCGG - Exonic
927597451 2:24409043-24409065 TTGTTTTTTTGGGGGGGAGGGGG - Intergenic
933281382 2:80336232-80336254 ATATTCTTATAGGGTGAAGGGGG + Intronic
937230100 2:120393361-120393383 ATGTGGGTATAGGAAGGAGGAGG - Intergenic
938945590 2:136209184-136209206 ATGTTGTTACAGAGCGGATGAGG + Intergenic
939953273 2:148501590-148501612 TTGTTTTTATTGTGGGGAGGTGG + Intronic
940157887 2:150678406-150678428 ATGATGTTATAGGGTGCAGTAGG + Intergenic
941791341 2:169555552-169555574 ATTTTGTTATGGGGAGGATGTGG - Intronic
942626349 2:177904880-177904902 CTGTTGTTATTTGGGGGAAGGGG - Intronic
943112868 2:183627541-183627563 ATGTTGATATAGGAGGGAGAGGG + Intergenic
944108239 2:196102595-196102617 GTGTTGTTATAGAGATGAGGAGG + Intergenic
944204340 2:197141724-197141746 TTTTTGTTATGGGGGAGAGGAGG - Intronic
944247692 2:197548469-197548491 TTGGTATTTTAGGGGGGAGGGGG + Intronic
944901600 2:204222123-204222145 ATGTTGTTAAAGGTGGGGGGTGG - Intergenic
945699087 2:213149076-213149098 ATGTTCTAATAGGGAGGGGGAGG + Intronic
946229813 2:218284302-218284324 CTGTTGTTAGAGGGGGCAGTGGG - Intronic
948667383 2:239545253-239545275 GTGCTGTTATAGGAGGGAGTAGG - Intergenic
1169905578 20:10600044-10600066 ATTTTTTTAGGGGGGGGAGGTGG + Intronic
1171559055 20:26105251-26105273 ACGTTGATAAAGGAGGGAGGGGG - Intergenic
1173264051 20:41461707-41461729 AAGTTGTTCTTGGGGGCAGGAGG + Intronic
1173483890 20:43426172-43426194 GTGTTGTTATGGGGGTAAGGGGG + Intergenic
1173609110 20:44353785-44353807 ATATTTTTATATGGGGGTGGGGG - Intergenic
1173908735 20:46648390-46648412 ATATTGTTATATGGGAGAGGAGG + Intronic
1175478698 20:59296173-59296195 ATGTTCTTTTAAGAGGGAGGGGG - Intergenic
1178100089 21:29258610-29258632 ATTTTGTTGGCGGGGGGAGGTGG - Intronic
1179970329 21:44833328-44833350 CTGTTTTTTTTGGGGGGAGGGGG + Intergenic
950023937 3:9808139-9808161 GTGATGTTAAAGGGAGGAGGGGG + Intronic
950090067 3:10288978-10289000 AGGTTGTCGTAGGGAGGAGGTGG + Intronic
953536563 3:43781557-43781579 ATGTTGATACAGCAGGGAGGGGG + Intergenic
953830421 3:46293377-46293399 ATGTTGTTGTAGGGGGTAGAGGG - Intergenic
954409100 3:50362173-50362195 ATGCTGGTTTAGTGGGGAGGTGG - Intronic
955684964 3:61540276-61540298 CTGTTGGAATAAGGGGGAGGAGG - Intergenic
956516699 3:70057207-70057229 ATTTTGTTATTGGGGAAAGGGGG + Intergenic
956702449 3:71970364-71970386 ATGTTTTTATATGGAGAAGGAGG + Intergenic
957072368 3:75577110-75577132 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
959222227 3:103535018-103535040 ATGTGGTTATAAAGGAGAGGAGG + Intergenic
959642932 3:108661721-108661743 ATGCTGTAATTGAGGGGAGGTGG + Intronic
960703536 3:120460070-120460092 ATTTTCTTTTCGGGGGGAGGAGG - Intergenic
960943406 3:122949266-122949288 ATGTTGTTTTTGGGGAGAGGAGG - Intronic
961224138 3:125223952-125223974 ATGTTTTTTTCGGGGGGAGGGGG - Intergenic
962377044 3:134867058-134867080 ATGTTTGTATAGATGGGAGGGGG + Intronic
963942455 3:151108501-151108523 ATGTTCTTTTGGGGGAGAGGTGG + Intronic
967094604 3:186166751-186166773 ATGTTGGGATAGGAGAGAGGGGG + Intronic
968254756 3:197258416-197258438 ATATAGTTATGGGGGGGCGGGGG + Intronic
968978618 4:3834836-3834858 ATGTTTCTATAGTGGGGAGAGGG + Intergenic
969737990 4:9003929-9003951 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
969873384 4:10118141-10118163 ATGTTGTTGTAAGCGGGAGATGG + Intergenic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
971600796 4:28588799-28588821 ATTTTTTTAAAGGGGGGTGGTGG - Intergenic
975096277 4:70460791-70460813 ATGTTGTCATATGGGGGCTGTGG + Intronic
977057873 4:92216290-92216312 ATGTTGTTATAGTGAGCAGGTGG + Intergenic
977469233 4:97421186-97421208 ATTTTCTTATAGATGGGAGGAGG - Intronic
977718131 4:100207177-100207199 AGGTTGTTAGAGGAGGGAAGTGG + Intergenic
978039046 4:104035854-104035876 CTCTAGTTATAGGAGGGAGGTGG + Intergenic
978887731 4:113784760-113784782 ATGGGGTGATAGGGAGGAGGTGG + Intergenic
980604454 4:135071213-135071235 CTGTTGTGGGAGGGGGGAGGGGG + Intergenic
980893372 4:138837966-138837988 ATGTTTTTTTTGTGGGGAGGTGG + Intergenic
986865293 5:11979696-11979718 AAGTTGTTATAGGAGAGAGGGGG - Intergenic
987547077 5:19324799-19324821 ATGTTGTTATTGGCTGGATGAGG + Intergenic
990146232 5:52763467-52763489 TTGTTGTGAGAGGGGTGAGGTGG + Intergenic
994361042 5:98848666-98848688 ATGTTGACATGGGGGAGAGGTGG - Intergenic
995686932 5:114782005-114782027 ATGGTGATAGAGTGGGGAGGTGG - Intergenic
996013752 5:118508285-118508307 ATGTTGCTATATGTAGGAGGAGG - Intergenic
996759434 5:126972457-126972479 ATGTGCTTTTATGGGGGAGGAGG + Intronic
998861984 5:146453271-146453293 AAGTTTTTAAAGGGGGCAGGGGG - Intronic
999607442 5:153331476-153331498 TTGTTGTTATTTTGGGGAGGGGG - Intergenic
1000259107 5:159568941-159568963 TTGTTGTTGTAGGGGTGAAGAGG - Intergenic
1000488047 5:161872813-161872835 CTGCTGTGATAGGGTGGAGGTGG + Intronic
1000840502 5:166212111-166212133 CTGTTGGTAGAGTGGGGAGGTGG - Intergenic
1000907724 5:166982781-166982803 ATGTTTTTTTTGGGGGGGGGAGG + Intergenic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1009571511 6:65391215-65391237 ATATTGTTATAGGGGACAGGAGG - Intronic
1011491594 6:87898900-87898922 CTCTTTTTTTAGGGGGGAGGGGG + Intergenic
1011941437 6:92847779-92847801 ATTTTGTTGTAGGGTGGAGAGGG + Intergenic
1013147780 6:107411801-107411823 ATGTTAGTATTGGGGGGTGGGGG + Intronic
1013328549 6:109073446-109073468 ATGTTTTTAAAGGGGGGTTGGGG - Intronic
1013669237 6:112380921-112380943 ATGTTGTTGTAGGGGGAATGTGG - Intergenic
1014178446 6:118355827-118355849 ATTTATATATAGGGGGGAGGGGG - Intergenic
1014727631 6:124991431-124991453 ATGCTGGTATGGGGGGGATGAGG - Intronic
1015709683 6:136126277-136126299 ATGTTGTTTTTGGGGGGTTGTGG - Intronic
1016090699 6:139975609-139975631 ATTTTGTTCTATGGGGGAGATGG + Intergenic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1017599404 6:156064277-156064299 GTGTTTTTTTTGGGGGGAGGGGG - Intergenic
1017951275 6:159137167-159137189 ATGTTGCAGTTGGGGGGAGGGGG + Intergenic
1018783864 6:167092974-167092996 GTGTTGATGTTGGGGGGAGGTGG + Intergenic
1021600586 7:22359247-22359269 ATGTTGTCATTGGGGTGATGGGG - Intergenic
1022150989 7:27606158-27606180 ATGTTTAAATATGGGGGAGGGGG + Intronic
1023035920 7:36131313-36131335 ATGTTGGCAGAGGGGGTAGGAGG + Intergenic
1025266827 7:57468415-57468437 ATGTTCTTCTAGTGGGGATGAGG + Intronic
1025278628 7:57608312-57608334 ACGTTGATAAAGGAGGGAGGGGG + Intergenic
1026825124 7:73576948-73576970 CTGTTCTTTTATGGGGGAGGTGG - Intronic
1028253679 7:88565943-88565965 ATGTTGTCTTTGGGGGGGGGGGG + Intergenic
1028367840 7:90054975-90054997 ATGATGATACAGTGGGGAGGCGG + Intergenic
1028409154 7:90509176-90509198 ATGGTGTTATTGGGGGGATGGGG + Intronic
1028774639 7:94663485-94663507 TTGTTGTTGTTGGGGGGAGGGGG - Exonic
1030366737 7:108655305-108655327 AAGTTGTCATAAAGGGGAGGAGG + Intergenic
1030948305 7:115755635-115755657 ACGTTGTTCTAGCTGGGAGGTGG - Intergenic
1031238526 7:119209646-119209668 CTGTTTTTATTGGGGGGAAGAGG + Intergenic
1031381111 7:121087094-121087116 CTGTTGTTATTGGGTGGAGAGGG - Intronic
1031500871 7:122514480-122514502 CTGTTTCTAAAGGGGGGAGGGGG - Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1036243079 8:7095210-7095232 ATGTGTTTATAGTGGGGATGTGG + Intergenic
1036257719 8:7218837-7218859 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036258969 8:7225834-7225856 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036307652 8:7613677-7613699 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036309768 8:7677433-7677455 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036311022 8:7684430-7684452 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036358506 8:8061678-8061700 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036359768 8:8068686-8068708 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036419087 8:8579283-8579305 ATATTGTTACAGGGGAGAGATGG + Intergenic
1036891192 8:12598284-12598306 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036892452 8:12605274-12605296 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036898744 8:12656221-12656243 ATGTGTTTATAGTGGGGATGTGG - Intergenic
1044467037 8:92519415-92519437 ATGTTTTTCTTGGGGGGAGGAGG - Intergenic
1045301754 8:100917278-100917300 ATGCTGTTATAGGGGGTGGGGGG - Exonic
1046230088 8:111344324-111344346 ATGTTATCATTGGGGGAAGGAGG + Intergenic
1047211744 8:122846134-122846156 ATGTTGGCAGAGAGGGGAGGAGG + Intronic
1049945568 9:591998-592020 ATGGTGTTACAGGCTGGAGGGGG - Intronic
1051743561 9:20274306-20274328 ATGTGGTTATGTGGGGGAAGAGG + Intergenic
1054204449 9:62118486-62118508 ATGGTGTTATAGGCGGTCGGGGG - Intergenic
1054733999 9:68732120-68732142 ATGTTGGAATAGGGAGGTGGAGG + Intronic
1055066514 9:72124721-72124743 ATGTTGTTATATGATGGAGGTGG + Intronic
1055960813 9:81818450-81818472 GTGTGGTTGTAGGGGGCAGGTGG + Intergenic
1056319291 9:85421329-85421351 ATTCTGTTGTAGGGGGCAGGAGG - Intergenic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1058040369 9:100295573-100295595 CTGTGGTTATAGGGGACAGGTGG + Intronic
1061573766 9:131493625-131493647 ATGGTGTTTTAGGGGGGTTGGGG + Intronic
1186579702 X:10804619-10804641 ATGTGGTTATAGGATGTAGGGGG + Intronic
1187127140 X:16464390-16464412 GTGTTTTTTTGGGGGGGAGGGGG - Intergenic
1187607579 X:20903238-20903260 CTGTTGTTTTTGGGGTGAGGGGG + Intergenic
1190320044 X:49174752-49174774 ATGTTGTTGTTGGGGTGGGGAGG - Exonic
1191196145 X:57725623-57725645 CTGTTGTGAGATGGGGGAGGGGG - Intergenic
1193873687 X:86833906-86833928 ATGTTGTTGGAGGAGGGAGGTGG - Intergenic
1194709008 X:97211431-97211453 AGATTGGTATAGGCGGGAGGTGG + Intronic
1195781923 X:108476559-108476581 AGGTTGTGGTAGGGAGGAGGTGG - Intronic
1196766160 X:119245709-119245731 ATGGTGGTGTCGGGGGGAGGGGG + Intergenic
1197335351 X:125204587-125204609 AGGGTGTTATAGGGTGGAGAGGG + Intergenic
1198089242 X:133311596-133311618 ATGTTGGGACAGGGGAGAGGAGG + Intronic
1199496431 X:148457587-148457609 GTGGTGGTATAGGTGGGAGGAGG - Intergenic
1201644586 Y:16215883-16215905 ATGATGTTATAGAGGAGATGGGG + Intergenic
1201658229 Y:16369438-16369460 ATGATGTTATAGAGGAGATGGGG - Intergenic