ID: 1100618203

View in Genome Browser
Species Human (GRCh38)
Location 12:96247822-96247844
Sequence AGTCATAGGACAACGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618203_1100618207 7 Left 1100618203 12:96247822-96247844 CCTCAAAACGTTGTCCTATGACT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1100618207 12:96247852-96247874 AGGTCACTGTGTAAATGTGAAGG 0: 1
1: 0
2: 1
3: 22
4: 240
1100618203_1100618208 8 Left 1100618203 12:96247822-96247844 CCTCAAAACGTTGTCCTATGACT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1100618208 12:96247853-96247875 GGTCACTGTGTAAATGTGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618203 Original CRISPR AGTCATAGGACAACGTTTTG AGG (reversed) Intronic
901333366 1:8427349-8427371 AGCCCTAGGACAAAGCTTTGGGG - Intronic
901661432 1:10800282-10800304 GGTCCTAGGACAAAGTTTGGTGG + Intergenic
905113331 1:35614512-35614534 AGTAGTAAGACAAAGTTTTGAGG + Intronic
905842741 1:41198168-41198190 AGTAATATGACAAAGTGTTGGGG - Intronic
906125547 1:43425003-43425025 AGTCATAGGACAATTTGGTGAGG + Intronic
909839184 1:80296632-80296654 AGACAGAGGACATGGTTTTGTGG - Intergenic
911331560 1:96530696-96530718 AGTCAAAGGAGATCATTTTGAGG + Intergenic
912889777 1:113517349-113517371 AGACATATGGCAATGTTTTGAGG - Intronic
914246574 1:145890519-145890541 AGGCATAGGACAAGATTTAGTGG + Intergenic
917613053 1:176709384-176709406 AGTCTTAGGACAACCCTGTGAGG - Intronic
919088681 1:192951755-192951777 AGTCATAGGACAATTAATTGTGG + Intergenic
920841984 1:209562848-209562870 GGTCATATGACAACATGTTGGGG - Intergenic
923286081 1:232497190-232497212 AGGCATGGGAGAACGTTCTGAGG + Intronic
1064509739 10:16076904-16076926 AGTCAGAGGAAAAGGTTTTAGGG + Intergenic
1070273833 10:74985145-74985167 CATCATAATACAACGTTTTGTGG - Exonic
1072219482 10:93315631-93315653 AGTCAAAGGAAATCGTTGTGAGG - Intronic
1075198192 10:120379116-120379138 AGTAATAGGACAACGTCATTTGG - Intergenic
1075575372 10:123573561-123573583 GGTCAGAGGACCACATTTTGAGG + Intergenic
1085564101 11:77497278-77497300 TGTCATTGGTCAACCTTTTGAGG - Intergenic
1085676839 11:78529279-78529301 AATCATAAGTCAACCTTTTGAGG - Intronic
1085797979 11:79561043-79561065 CGTCATAGGTCAATGTTTTAGGG + Intergenic
1085890453 11:80573111-80573133 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1095335991 12:41027067-41027089 AGTCATTGGAGAAAGATTTGAGG + Intronic
1098101864 12:67026465-67026487 ATCCTTAGGACAACCTTTTGAGG - Intergenic
1098399921 12:70064199-70064221 AGGCAAAGGACAACACTTTGGGG - Intergenic
1100618203 12:96247822-96247844 AGTCATAGGACAACGTTTTGAGG - Intronic
1104249433 12:127077512-127077534 AGACATAGGACAATGCTTTTTGG + Intergenic
1104445475 12:128829615-128829637 ACTCATAGGATCACTTTTTGGGG - Intergenic
1105599040 13:21869497-21869519 AGTCATAGAACAATGTTGTGGGG - Intergenic
1105733850 13:23247331-23247353 AGTCTTACGAAAAGGTTTTGAGG - Intronic
1106745543 13:32702027-32702049 AGTCAGAGGAAAACATTTTAGGG - Intronic
1111615130 13:90652797-90652819 AGTCAAAGGAGATCATTTTGGGG + Intergenic
1112859303 13:103810504-103810526 AGAAATAGGACAACTTTTTCTGG - Intergenic
1115795317 14:36929014-36929036 AGTCATATGAGACCGTTTTCTGG - Intronic
1121247160 14:92470110-92470132 AGTCCTAGGACCACACTTTGAGG - Intronic
1123775495 15:23575163-23575185 AGTCAAAGGAGAACATTTTGGGG + Intronic
1129088697 15:73125289-73125311 AGTCATAGAAATATGTTTTGTGG + Intronic
1129484469 15:75856555-75856577 AGTCTTAGGAAAACTATTTGAGG + Intronic
1131155102 15:90070018-90070040 ACTCATAGGCCACCGTTATGGGG - Intronic
1134416517 16:14048159-14048181 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1135830866 16:25771736-25771758 AGTCATTGGACTAGGTATTGAGG - Intronic
1140731572 16:77861355-77861377 AGTCATTGGACAAAATGTTGTGG - Intronic
1142138886 16:88463828-88463850 AGCCAGAGGACACAGTTTTGAGG - Intronic
1145183878 17:20777321-20777343 GGTCATATGATAACCTTTTGAGG + Intergenic
1147834336 17:43319384-43319406 AGTCAAAGGAAATCATTTTGGGG - Intergenic
1155263591 18:24069841-24069863 AGTCATAGGACAAGTTTTAGAGG - Intronic
1155380897 18:25220825-25220847 AGTCATGAGACAACATTCTGAGG + Intronic
1159578754 18:70210786-70210808 ATTCATAGGACAAAGTTATGGGG - Intergenic
1160383797 18:78481344-78481366 AGTTATAGTCAAACGTTTTGAGG - Intergenic
1161675524 19:5646112-5646134 ATTCTTAGGAGAACTTTTTGTGG + Intronic
1165299104 19:34956884-34956906 AGTCATAGGACAGAGGTCTGAGG + Exonic
1165974715 19:39665717-39665739 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1166985667 19:46659066-46659088 AGTCATAAGACAAGGGTTGGGGG + Intronic
925229007 2:2214181-2214203 AGTCATGGGACAACTTCTAGTGG + Intronic
929020261 2:37546290-37546312 AGTCAAACGACATCATTTTGGGG - Intergenic
931619120 2:64192129-64192151 AGCCATAGGAAGATGTTTTGGGG - Intergenic
932923017 2:75939652-75939674 AATCATAAGACAACTTTCTGGGG - Intergenic
933702255 2:85263828-85263850 AGGCATAGGCCAAGGTTCTGAGG + Intronic
938952667 2:136269755-136269777 AGTCAAAGGAGATCATTTTGGGG + Intergenic
939934267 2:148270687-148270709 AGTCAGAAGACAAAGTTGTGAGG - Intronic
943818944 2:192293685-192293707 AGTCATAGCTCAAGATTTTGAGG + Intergenic
944144537 2:196492561-196492583 AGTCAGAGGACAAAGGATTGTGG + Intronic
1169611824 20:7389387-7389409 AGTCATAGGTCAAATTTTTGGGG + Intergenic
1169691432 20:8336620-8336642 AGTCCTAGGACTACACTTTGAGG + Intronic
1179548864 21:42130647-42130669 AGTCATGTGACAACTTTTAGAGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
956527061 3:70176528-70176550 ACTCATAGAACATCATTTTGAGG - Intergenic
958041358 3:88230492-88230514 TGTCTAAGGACAACCTTTTGTGG - Intergenic
958955086 3:100458413-100458435 AGTCAAAGGAGATTGTTTTGGGG - Intergenic
959233581 3:103690153-103690175 AGTCAAAGGAGATCATTTTGCGG - Intergenic
961900158 3:130202525-130202547 AGTCAAAGGAGATCATTTTGGGG - Intergenic
963943981 3:151124983-151125005 GGTGATAGGACACCCTTTTGTGG + Intronic
964098521 3:152962297-152962319 AGTCAAAGGAGATCATTTTGGGG - Intergenic
966416248 3:179693022-179693044 AGTCATAGAACACTTTTTTGGGG - Intronic
967520117 3:190420237-190420259 AGCCTTAGGACAAGTTTTTGAGG + Intergenic
967634943 3:191790533-191790555 AGTCACAGGAGATCATTTTGAGG - Intergenic
971943539 4:33245589-33245611 AGTCAAAGGAGATCATTTTGAGG - Intergenic
972054279 4:34780470-34780492 AGTCAAAGGAAATCATTTTGGGG - Intergenic
973048792 4:45568973-45568995 CATTATAGGTCAACGTTTTGAGG - Intergenic
976817464 4:89165750-89165772 AGTCATTGGAAAGAGTTTTGTGG - Intergenic
978282654 4:107036197-107036219 AGTCAGGGGACAACGCTTCGGGG - Exonic
989470906 5:41817276-41817298 AGTCAGAAGACATCGATTTGTGG + Intronic
990144518 5:52744023-52744045 AGTCACAGTGCAACCTTTTGTGG - Intergenic
990844502 5:60122034-60122056 AGTCAAAGGAGATCATTTTGGGG - Intronic
992220124 5:74563655-74563677 ACTCAGAGGACAGTGTTTTGTGG - Intergenic
993560310 5:89398868-89398890 GGGAATAGGACAACTTTTTGTGG - Intergenic
996196417 5:120612034-120612056 AGTCAAAGGAGATCATTTTGGGG + Intronic
996971445 5:129373771-129373793 TGAAATAGGACAACTTTTTGAGG - Intergenic
997590764 5:135070871-135070893 AATCATCGGTCAACGTCTTGAGG + Intronic
998576591 5:143323908-143323930 AGTCAAAGGAGATCATTTTGGGG - Intronic
1000458977 5:161488328-161488350 AGTCCTAGGAGTATGTTTTGGGG + Intronic
1005113621 6:22313331-22313353 AGTCAAAGGAGAATATTTTGGGG - Intergenic
1007426744 6:41751439-41751461 GGTCAAAGGACCACCTTTTGAGG + Intronic
1010517337 6:76789602-76789624 AGTCAAAGGAGAATATTTTGGGG - Intergenic
1014022240 6:116604586-116604608 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1016531373 6:145061167-145061189 ATTCATAGGACAGTATTTTGGGG - Intergenic
1016943556 6:149506059-149506081 AATAATGGGACCACGTTTTGGGG - Intronic
1020113726 7:5463247-5463269 AGTCATACGGCAACATTTTCAGG - Intronic
1020345142 7:7154325-7154347 AGTCAAAGGAGATCATTTTGGGG + Intergenic
1020780977 7:12516722-12516744 AGTCAAAGGAGATCATTTTGGGG + Intergenic
1022961790 7:35433698-35433720 ATTTATTTGACAACGTTTTGTGG - Intergenic
1023210081 7:37793596-37793618 AGTCATAGGATAGGGTCTTGAGG + Intronic
1028767581 7:94577303-94577325 AGTCACAAAACAACGCTTTGGGG - Intergenic
1030006269 7:105123706-105123728 AGTCACAGGATAACATTATGAGG - Intronic
1031497291 7:122466047-122466069 AGGTATAGGACAAAGTTTTTGGG - Intronic
1034551397 7:151822841-151822863 ATTCATTGGGCAACCTTTTGTGG - Intronic
1044442996 8:92243050-92243072 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1046771451 8:118120649-118120671 AGTGATAGGACAGCCTCTTGTGG + Intergenic
1047726483 8:127688379-127688401 AGGCAGAGGACAAAGTTTTGCGG + Intergenic
1048675068 8:136769562-136769584 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1051975358 9:22941883-22941905 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1052187707 9:25619637-25619659 AGTCAAAGGAGATCATTTTGGGG - Intergenic
1052885865 9:33647669-33647691 GGTCAAAAGACAACTTTTTGGGG - Intergenic
1055776333 9:79770358-79770380 ATTCATGGGACAAGGTTTTGAGG + Intergenic
1203653467 Un_KI270752v1:1009-1031 AGTCAGAGGACAACTTGCTGGGG - Intergenic
1186954667 X:14669153-14669175 AGTCAAAGGAGATCATTTTGGGG - Intronic
1188122580 X:26327462-26327484 AGTAGTAGGAAAAGGTTTTGGGG + Intergenic
1188397844 X:29706577-29706599 AGTCAAAGGAGATCATTTTGGGG - Intronic
1189757582 X:44286397-44286419 AGTCTTACGAAAAGGTTTTGAGG - Intronic
1190850955 X:54241100-54241122 AGTAAGAGGAAAAGGTTTTGTGG + Intronic
1193223647 X:78956322-78956344 AGTCAGAAGACAACATTTTAGGG + Intronic
1194321193 X:92447931-92447953 AGTCAAAGGAGATCATTTTGGGG + Intronic
1194952706 X:100145512-100145534 AGTCAAAGGACATCATTTTGGGG + Intergenic
1199932081 X:152533350-152533372 AGTCATGAGAAAACTTTTTGGGG - Intergenic
1200629310 Y:5561078-5561100 AGTCAAAGGAGATCATTTTGGGG + Intronic