ID: 1100618398

View in Genome Browser
Species Human (GRCh38)
Location 12:96249334-96249356
Sequence TTGAGCTGTCATGAAATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 158}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618398_1100618409 21 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618409 12:96249378-96249400 CGCGCCACTGCGGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1100618398_1100618405 15 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618405 12:96249372-96249394 GTGACGCGCGCCACTGCGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 27
1100618398_1100618413 28 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616
1100618398_1100618408 20 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1100618398_1100618411 26 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510
1100618398_1100618407 17 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1100618398_1100618403 11 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618403 12:96249368-96249390 GGTGGTGACGCGCGCCACTGCGG 0: 1
1: 0
2: 0
3: 4
4: 52
1100618398_1100618404 14 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1100618398_1100618401 -7 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618401 12:96249350-96249372 AGCTCAAGCCTGTGAGCTGGTGG 0: 1
1: 0
2: 2
3: 35
4: 642
1100618398_1100618406 16 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1100618398_1100618400 -10 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618400 12:96249347-96249369 GACAGCTCAAGCCTGTGAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 172
1100618398_1100618412 27 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618398 Original CRISPR TTGAGCTGTCATGAAATCCT GGG (reversed) Intronic
902883510 1:19388622-19388644 CGGAGCTGTCATGAAAGCCCTGG + Intronic
904352165 1:29915546-29915568 TTGAGGTTTCATGAAATCCTGGG - Intergenic
905467295 1:38164875-38164897 TTGAGATCTGAGGAAATCCTGGG - Intergenic
909867690 1:80694810-80694832 CTGAGCTAACATGAAATCCATGG + Intergenic
911275121 1:95850686-95850708 TTGAGATGTAATTAAATCATGGG + Intergenic
913487199 1:119342391-119342413 TTAAGCTGTCATTCATTCCTGGG - Intergenic
915053707 1:153104909-153104931 TTGAGTAGTTATGAAATTCTGGG - Intronic
917034408 1:170731336-170731358 ATGAGTTTTCCTGAAATCCTTGG - Intronic
921845350 1:219873575-219873597 TTAAGCTGGCCTGAGATCCTGGG - Intronic
924216226 1:241824946-241824968 TTGAATTGTCATGGATTCCTGGG - Intergenic
1067215800 10:44301707-44301729 TGGAGCTGTCAAAAAATCTTGGG - Intergenic
1068755858 10:60652196-60652218 TTGCTCTGTCTTGAACTCCTGGG - Intronic
1072250254 10:93576307-93576329 TTGAGCTGGCGTGAACTCTTAGG - Intronic
1072430176 10:95364232-95364254 TTCAGCTCTCATGAAATACTTGG - Intronic
1074004155 10:109402726-109402748 TTTTGGTGTCATGAAACCCTAGG - Intergenic
1079361734 11:19776145-19776167 TTGGGCAGCCATGACATCCTAGG - Intronic
1080834807 11:35930155-35930177 CTGGGCTGCCTTGAAATCCTGGG - Intergenic
1081183835 11:40018184-40018206 TTGTGCTGTTTTGAAGTCCTTGG + Intergenic
1081724151 11:45315227-45315249 TTGAGCTGGCATGAAAGTCAGGG - Intergenic
1086350918 11:85942628-85942650 TTGGGCAGTCAACAAATCCTAGG + Intergenic
1086592093 11:88526835-88526857 TTGAGCATTTATTAAATCCTAGG + Intronic
1088477570 11:110259460-110259482 TTATGCTGCCAAGAAATCCTTGG - Intronic
1089365566 11:117918994-117919016 TTGAGCTTTCATTCTATCCTTGG - Intronic
1089507750 11:118975521-118975543 TTGAGCAGCCTTGAACTCCTCGG + Intronic
1090644970 11:128760045-128760067 CTGAGCCTTCCTGAAATCCTGGG - Intronic
1092623255 12:10297115-10297137 TTGAGCTATCAGGATAACCTGGG - Intergenic
1093009652 12:14092972-14092994 TTGAGCTATCCTGGCATCCTAGG - Intergenic
1094312991 12:29106308-29106330 TTCAGATGACATGAAAGCCTAGG + Intergenic
1099860838 12:88223352-88223374 TTGATCTCTCATGAACTGCTTGG + Intergenic
1100618398 12:96249334-96249356 TTGAGCTGTCATGAAATCCTGGG - Intronic
1102479626 12:113212665-113212687 ATGAGCTGTCAAGAAATGATGGG - Intronic
1107097934 13:36556614-36556636 TTGGGCTCTCATAAAATCATTGG + Intergenic
1107197637 13:37672578-37672600 TTGTGCTGTCATGAAATTCTGGG - Intronic
1107834211 13:44400557-44400579 TTGACCTGTGATGATGTCCTGGG - Intergenic
1108046565 13:46389014-46389036 TTCAGCTGACCTGAATTCCTGGG - Intronic
1109062556 13:57635158-57635180 TGGAGCTGTCCTGAAACCTTTGG + Intronic
1109463867 13:62701394-62701416 TCGAGCTGTAATGATATACTTGG - Intergenic
1109683390 13:65783309-65783331 TAAAGCTGTCATGAGATCCTTGG + Intergenic
1109857422 13:68149945-68149967 ATGAGAAGACATGAAATCCTAGG + Intergenic
1111236214 13:85411993-85412015 TTGAGGCTTCATGAAATCATAGG + Intergenic
1113317126 13:109192840-109192862 TTTATCTGTTATGACATCCTGGG + Intronic
1114019713 14:18466926-18466948 TAGAACTGTTCTGAAATCCTAGG + Intergenic
1114076229 14:19162611-19162633 TTGAGGTGTCATGACCACCTGGG + Intergenic
1114085933 14:19236958-19236980 TTGAGGTGTCATGACCACCTGGG - Intergenic
1114759081 14:25291361-25291383 TTGAGCTGTGATCTAATCTTAGG - Intergenic
1117389305 14:55247878-55247900 TTTAGCTGTCATTAATCCCTGGG - Intergenic
1118195493 14:63622117-63622139 TTGACCTGTCATAAATCCCTTGG - Intronic
1118917359 14:70118909-70118931 TTGTTCTTTCATGAAATACTTGG + Intronic
1119352086 14:73974229-73974251 TTGAGATGTGATGAAAGCCATGG - Intronic
1120537565 14:85715652-85715674 CAGAGCTGTCATGAAAACATTGG - Intergenic
1120927341 14:89810889-89810911 TTGAGCTTTTATCCAATCCTGGG + Intronic
1121938188 14:98040334-98040356 TTGAGCTGTAATGAAATATCAGG - Intergenic
1202897475 14_GL000194v1_random:18581-18603 TTGAGGTGTCATGACCACCTGGG - Intergenic
1126158642 15:45587895-45587917 TTGACCACTCATGAAATGCTTGG + Intronic
1129272740 15:74428041-74428063 TTTAACTGTCATGACAGCCTGGG - Intronic
1130559753 15:84948641-84948663 TTTGGCTGTCATGGAATCCAAGG - Intergenic
1132466748 16:81136-81158 GTGAGTTGCCATGAAATCCCAGG + Intronic
1135792974 16:25415058-25415080 ATGAGTTGTCATGGAATACTTGG + Intergenic
1138953844 16:61947085-61947107 TTGATCAGTCTTGAAATTCTTGG - Intronic
1139973636 16:70791826-70791848 TTGAGCTGTGGGGAAAACCTGGG + Intronic
1140702519 16:77594507-77594529 TTGAGCTGTCATGCAATGGAAGG - Intergenic
1140995153 16:80251851-80251873 ATGAGCAATCATGAAATTCTAGG - Intergenic
1144777562 17:17792514-17792536 TTGAGCTGTCAGGAAGGGCTGGG + Intronic
1147900997 17:43784416-43784438 CTGAGCAGCCAAGAAATCCTAGG - Exonic
1152814463 17:82399251-82399273 CTGAGCTTACAGGAAATCCTGGG - Intronic
1157153841 18:45245315-45245337 TCCAGCTGCCATGAAGTCCTAGG - Intronic
1158075135 18:53519298-53519320 TTGAGCACTCATTAAATACTTGG + Intronic
1158268908 18:55691151-55691173 TGGAGCTGTGATGCAACCCTAGG - Intergenic
1159049391 18:63404985-63405007 TTTAACTGACATGAAATCCTAGG - Intronic
1159665198 18:71149974-71149996 TTCAGTTGTCATGAAAGCCAAGG - Intergenic
1161116091 19:2497278-2497300 GTCAGCTGTCATGAGACCCTGGG - Intergenic
1161644162 19:5443001-5443023 TTGAGCTCACCTGAAACCCTTGG - Intergenic
926079756 2:9975555-9975577 TTAAGCTGACTTGAACTCCTAGG - Intronic
926757446 2:16247564-16247586 TTTAGCAGTCATGAAAGTCTAGG - Intergenic
927400093 2:22701222-22701244 ATGAGATGTAATGAAATGCTAGG + Intergenic
929627329 2:43422793-43422815 TTGAGCTGCCTTGACCTCCTGGG + Intronic
931140763 2:59455168-59455190 TTGAGCTATGAGGAGATCCTGGG + Intergenic
931174141 2:59835752-59835774 TTGAGCTCCCATTTAATCCTGGG - Intergenic
933949803 2:87319137-87319159 TTGAGTTGTCATGTCATCCCAGG - Intergenic
936330390 2:111542460-111542482 TTGAGTTGTCATGTCATCCCAGG + Intergenic
936789243 2:116131245-116131267 TTAAGCTGTCATGAAAACCATGG + Intergenic
937800156 2:126073423-126073445 CTGAGCTGACATTAATTCCTGGG + Intergenic
938490824 2:131760132-131760154 TTGAGGTGTCATGACCACCTGGG + Intronic
938645786 2:133328831-133328853 CTGAAATGTCATGAAATGCTGGG + Intronic
939293335 2:140223117-140223139 TCGAGTTGTGATGAAATCTTCGG + Intergenic
939527067 2:143308637-143308659 GTAACCTGTCATGAAATGCTGGG + Intronic
941661483 2:168199944-168199966 TTAAGCTGTCAGCAAAGCCTTGG + Intronic
941662936 2:168214113-168214135 CTAAGCTGTCATGCAATCCCAGG + Intronic
944392016 2:199227676-199227698 TTGGGCTGTCAACAAATCCAAGG - Intergenic
944927813 2:204482931-204482953 TTGAGATGCCAGGAAATTCTAGG - Intergenic
945135720 2:206625716-206625738 TAGAGCTGGGATGAAATCCCAGG + Intergenic
945514793 2:210749703-210749725 CTGTGCTGTCATGAAATGTTAGG - Intergenic
945855210 2:215060957-215060979 TTCAGCTTTCCTGAGATCCTGGG - Intronic
946113595 2:217442084-217442106 TTTAGCTGGGATGAAATTCTAGG + Intronic
1171250719 20:23645014-23645036 TTGTGCTTTCAAGAAGTCCTGGG + Intergenic
1173530907 20:43768979-43769001 TTGAGCTGATATGACATTCTTGG - Intergenic
1176617160 21:9034570-9034592 TTGAGGTGTCATGACCACCTGGG - Intergenic
1176707982 21:10129091-10129113 TTGAGGTGTCATGACCACCTGGG + Intergenic
1178200756 21:30402130-30402152 TTTAACTGTCATCAAATTCTAGG - Intronic
1180292036 22:10856235-10856257 TTGAGGTGTCATGACCACCTGGG + Intergenic
1180444216 22:15397751-15397773 TAGAACTGTTCTGAAATCCTAGG + Intergenic
1180494840 22:15885657-15885679 TTGAGGTGTCATGACCACCTGGG + Intergenic
1182690759 22:32160168-32160190 TTGAGCCGTCATGGAAACTTGGG - Intergenic
949788370 3:7766284-7766306 TTGAGATGGAATGAAATACTGGG + Intergenic
950722886 3:14897517-14897539 TGGAGCTGTCATGAGGGCCTTGG + Exonic
951639981 3:24826313-24826335 GTGAGCTGTCATGAATTCTTTGG + Intergenic
952855766 3:37769603-37769625 TTGACCTGTGTTGAACTCCTTGG + Intronic
953847268 3:46437695-46437717 TGGCACTGTCATGAAATCTTTGG - Intronic
957482683 3:80818620-80818642 GTGACTTGTCATGAAATCTTTGG - Intergenic
958748998 3:98172695-98172717 TCGATCTGTCATGAATGCCTTGG + Intronic
960692775 3:120364349-120364371 TAGAGCTGTCATTCAATGCTAGG - Intergenic
962080599 3:132135590-132135612 TTGAGCTTTTATTAAATACTAGG - Intronic
962857049 3:139356471-139356493 ATGACCTGTGATGACATCCTAGG + Intronic
963580309 3:147117895-147117917 TTTAGCTGCCATTAAATCTTAGG + Intergenic
963845223 3:150148563-150148585 TTGAGCTCTTATGATATGCTAGG + Intergenic
964008060 3:151854821-151854843 TTGATTTGTGATGAAAACCTGGG - Intergenic
964034226 3:152176656-152176678 TTGAGCTGTAATGGAGACCTGGG + Intergenic
965427769 3:168548498-168548520 TTAAGATGACATGAAATCTTTGG + Intergenic
965829043 3:172762115-172762137 TTTAGATTTCATGAAAGCCTTGG + Intronic
966459520 3:180160707-180160729 TTGAGTTGTCTTGAACTCCTGGG + Intergenic
966764933 3:183452418-183452440 TAGATCTGTCATGAACTTCTTGG - Intergenic
967206147 3:187123867-187123889 TTGAGCTTTCAGGAAATACCTGG - Intronic
967231340 3:187340114-187340136 TTGGGATGTCTTGAAAACCTGGG - Intergenic
969994881 4:11301863-11301885 TTGAGCTCTCCTGAAATGGTGGG - Intergenic
971285830 4:25289363-25289385 TTGGGCAGACATGAAATTCTGGG + Intergenic
973995754 4:56456867-56456889 TTCAGCTGTCTGGTAATCCTTGG + Intronic
974193974 4:58546366-58546388 ATCAGCAGTCATGAAATTCTAGG - Intergenic
975330057 4:73102211-73102233 TTGACCTGCCATAAAATGCTGGG + Intronic
976045850 4:80946280-80946302 TGGAGCTGTCATTTAAACCTTGG - Intronic
978912464 4:114080567-114080589 TTGTTCTGACATGAAATCTTTGG + Intergenic
980189105 4:129500740-129500762 TTAAGCTCTCATGAGATACTAGG + Intergenic
980794822 4:137667460-137667482 TTGACTTGACATGAAATGCTTGG + Intergenic
983858404 4:172674230-172674252 TTGACCAGACATGAAATTCTGGG + Intronic
984030834 4:174602109-174602131 TTTAGCTATCCTGAAATCCAAGG - Intergenic
984365060 4:178787991-178788013 CTGATCTGTCTTGAAATACTTGG + Intergenic
988274501 5:29063601-29063623 TTTACCTGTCAGGAAATCCTAGG + Intergenic
989017255 5:36952961-36952983 TTGAGGTTTCATGAAATCGTGGG + Intronic
990147880 5:52783373-52783395 TTAAGCTGTTATGCAATTCTAGG - Intergenic
994528843 5:100940306-100940328 TACAGCTGTCATGAAAAACTTGG + Intergenic
997042648 5:130277005-130277027 AGGAGGTGTCATGAGATCCTTGG + Intergenic
998481462 5:142466633-142466655 TGGACCTGTCATTCAATCCTGGG - Intergenic
1000409255 5:160920650-160920672 GTGAGCTTTCATAAACTCCTAGG + Intergenic
1002786185 6:402322-402344 CTGAATTGTCATGAAATCCAAGG - Intronic
1003849955 6:10211373-10211395 CTGACCTGTCATGAAATCTCGGG + Intronic
1007145578 6:39626493-39626515 CTTAGCAGACATGAAATCCTGGG + Intronic
1015231181 6:130916622-130916644 TTGAAATGTCATGAAAGCCACGG - Intronic
1022790647 7:33685607-33685629 TTTAGCTGTCCTGTCATCCTGGG - Intergenic
1023988021 7:45109226-45109248 GTGAGCTGCCATGATGTCCTGGG + Exonic
1024786427 7:52912171-52912193 TGGTGGTGTCATGGAATCCTTGG - Intergenic
1027347314 7:77274630-77274652 CTGAGCTTTCAGGAAATCCTTGG - Exonic
1031794482 7:126154271-126154293 TTGATCTGTCATGAGCTCCTGGG + Intergenic
1032646650 7:133832284-133832306 TTGGGATATCATGGAATCCTAGG - Intronic
1032700494 7:134374546-134374568 CTAAGCTGTCATGTGATCCTGGG - Intergenic
1033324349 7:140365054-140365076 TTGGGATGTCATGAAACCCAAGG - Intronic
1041923976 8:63216506-63216528 TTGATCTATCCTGGAATCCTAGG + Intergenic
1045517565 8:102873760-102873782 GTGAGCTGTCATCATAACCTGGG + Intronic
1047641555 8:126826568-126826590 TTGAGCTTTCATGGAATTATGGG + Intergenic
1051854369 9:21546386-21546408 ATGAGCTTTCATTAAATCTTTGG - Intergenic
1053760803 9:41349025-41349047 TTGAGGTGTCATGACCACCTGGG - Intergenic
1055343128 9:75307228-75307250 TTGACCTGATATGAAATTCTGGG + Intergenic
1057955362 9:99403116-99403138 TTCAGCTGTGATGGGATCCTGGG + Intergenic
1059799574 9:117736717-117736739 CTGAGCTTTCATGAACTTCTGGG + Intergenic
1202792726 9_KI270719v1_random:97971-97993 TTGAGGTGTCATGACCACCTGGG + Intergenic
1186138496 X:6545859-6545881 TTGATCTGGGATGAAATCATAGG + Intergenic
1186223483 X:7374278-7374300 TTCAAGTGTCATGGAATCCTTGG + Intergenic
1187725097 X:22194151-22194173 ATGAGCTTTCATGAAACCATTGG - Intronic
1188461792 X:30435589-30435611 TTGTGCTGTTATGACTTCCTTGG - Intergenic
1190115931 X:47626435-47626457 ATCAGCTGTCAAGAAATCCCGGG - Exonic
1197700645 X:129597062-129597084 TCTAGCTGACATGAAATCTTGGG - Intergenic
1199827334 X:151513694-151513716 TTGAGCTCCCATTTAATCCTAGG + Intergenic
1201150550 Y:11093403-11093425 TTGAGGTGTCATGACCACCTGGG - Intergenic
1201536937 Y:15059787-15059809 TTCAGTTCTCATGAAATCCTTGG - Intergenic