ID: 1100618399

View in Genome Browser
Species Human (GRCh38)
Location 12:96249335-96249357
Sequence CTTGAGCTGTCATGAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618399_1100618407 16 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1100618399_1100618409 20 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618409 12:96249378-96249400 CGCGCCACTGCGGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1100618399_1100618413 27 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616
1100618399_1100618412 26 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415
1100618399_1100618406 15 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1100618399_1100618401 -8 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618401 12:96249350-96249372 AGCTCAAGCCTGTGAGCTGGTGG 0: 1
1: 0
2: 2
3: 35
4: 642
1100618399_1100618408 19 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1100618399_1100618404 13 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1100618399_1100618403 10 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618403 12:96249368-96249390 GGTGGTGACGCGCGCCACTGCGG 0: 1
1: 0
2: 0
3: 4
4: 52
1100618399_1100618405 14 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618405 12:96249372-96249394 GTGACGCGCGCCACTGCGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 27
1100618399_1100618411 25 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618399 Original CRISPR CTTGAGCTGTCATGAAATCC TGG (reversed) Intronic
904352166 1:29915547-29915569 TTTGAGGTTTCATGAAATCCTGG - Intergenic
911490998 1:98565843-98565865 CTACATCTGTCATGAAATTCTGG - Intergenic
913487200 1:119342392-119342414 CTTAAGCTGTCATTCATTCCTGG - Intergenic
916666117 1:166969145-166969167 CCTAAGCTGGCATCAAATCCAGG + Intronic
918685986 1:187416253-187416275 CTGGATCTGTGATGAAATGCAGG - Intergenic
920556133 1:206906150-206906172 CTTGAGCTGTTCTGGGATCCAGG - Intronic
922339894 1:224647015-224647037 CTTGCTCTGTCATGCAAGCCAGG + Intronic
1064229235 10:13515170-13515192 CTTGAGCTGAAATGTAATGCAGG - Intronic
1068755859 10:60652197-60652219 CTTGCTCTGTCTTGAACTCCTGG - Intronic
1069799355 10:71072617-71072639 CTTGGGCTGTCAAGGAGTCCAGG + Intergenic
1070362557 10:75705156-75705178 CTTGAGCTTTTATGAAAGCAAGG - Intronic
1071858406 10:89648410-89648432 CGTGAGCTGTCATGTCCTCCAGG + Intergenic
1074468474 10:113705705-113705727 CTTGAGTTGTCAGGAAAAGCAGG + Intronic
1075508692 10:123050698-123050720 ATTGAGCTTAAATGAAATCCTGG - Intronic
1076327023 10:129632269-129632291 ATTGTGCTGTCATGCCATCCTGG + Intronic
1077731299 11:4732920-4732942 ATTGAGCTGTCTTGACACCCTGG + Intronic
1080834808 11:35930156-35930178 CCTGGGCTGCCTTGAAATCCTGG - Intergenic
1081724152 11:45315228-45315250 ATTGAGCTGGCATGAAAGTCAGG - Intergenic
1082672320 11:56049766-56049788 CTTTAACCATCATGAAATCCTGG + Intergenic
1084532690 11:69738092-69738114 CTGGAGCTGACAGGAGATCCAGG - Intergenic
1086211109 11:84320071-84320093 CATGAGATGACATGAAATTCTGG + Intronic
1087245770 11:95834849-95834871 TTTGATCTGTCATGACATCAAGG + Exonic
1087779168 11:102285107-102285129 CTTGGGCTGTTCTGAACTCCAGG + Intergenic
1098750413 12:74285903-74285925 CATGAGCTGTGATGAAATCCAGG - Intergenic
1098992593 12:77080416-77080438 CTTGAGCTGAAATGACACCCTGG + Intergenic
1100215138 12:92439858-92439880 CATGAGCTGTTTTGAAATCTTGG + Intergenic
1100618399 12:96249335-96249357 CTTGAGCTGTCATGAAATCCTGG - Intronic
1100687818 12:97005759-97005781 TTTGAGGTGTCATGACAACCAGG - Intergenic
1107053986 13:36083190-36083212 CTTGATCTGTCAAGATAACCTGG - Intronic
1107130142 13:36886347-36886369 CCTGAGCTGTACTGAAATGCAGG + Intronic
1107197638 13:37672579-37672601 TTTGTGCTGTCATGAAATTCTGG - Intronic
1108046566 13:46389015-46389037 CTTCAGCTGACCTGAATTCCTGG - Intronic
1110627417 13:77666977-77666999 CTTGAGATGTGATCAAATTCAGG + Intergenic
1112260806 13:97876307-97876329 CTTGATCTGTGGTGAAATGCCGG - Intergenic
1112393747 13:99009471-99009493 CTCGAGGTGTCATGAAGGCCCGG - Intronic
1114137454 14:19868054-19868076 CCTCAGCTGTCATGAAGTTCTGG - Intergenic
1114435765 14:22706574-22706596 CTTGATCCCTGATGAAATCCAGG - Intergenic
1116741267 14:48758016-48758038 ATTGAACTGTAATGGAATCCCGG + Intergenic
1116782330 14:49250402-49250424 CTTGAGCTGTCAGGGAAAACTGG + Intergenic
1116864720 14:50022364-50022386 CTTGAGAAGTCATGAAGTCTAGG - Intergenic
1118410157 14:65470150-65470172 GTTGGGCTGTGATGATATCCAGG + Intronic
1118930843 14:70238922-70238944 CTTGGGCTGTCATTGTATCCAGG + Intergenic
1118954085 14:70463789-70463811 CTTGGGCTGTCATTGTATCCAGG - Intergenic
1119165406 14:72488540-72488562 TTTAAGCTGTAATGAAATACAGG - Intronic
1120979351 14:90276954-90276976 CTTGAACTGTCATGAGTTCCTGG - Exonic
1121486559 14:94320985-94321007 CTTGATCTGCCACGAAACCCAGG - Intronic
1126364478 15:47880225-47880247 CTTGAGCTCTTATGTAATCAGGG - Intergenic
1126430835 15:48582619-48582641 CTTTGGATGTCATGCAATCCTGG - Intronic
1128320808 15:66692531-66692553 CTGGAGCTGGGATCAAATCCAGG + Intergenic
1131503228 15:92990776-92990798 CTTAATGTGTCATGAAGTCCTGG + Intronic
1136276278 16:29181046-29181068 CTTGAGATGACAGGGAATCCAGG - Intergenic
1136525519 16:30827135-30827157 CTGAAGCTGGGATGAAATCCAGG + Intergenic
1138014362 16:53415312-53415334 CTTAAACTGACATAAAATCCAGG - Intergenic
1138095865 16:54210884-54210906 CATGTGCTGTCTTGAAACCCTGG - Intergenic
1139973635 16:70791825-70791847 CTTGAGCTGTGGGGAAAACCTGG + Intronic
1140612193 16:76613457-76613479 CTTGAGTTGTAAAGAGATCCAGG - Intronic
1140863775 16:79041722-79041744 CTGGACCTTTCATGGAATCCAGG + Intronic
1142080659 16:88147105-88147127 CTTGAGATGACAGGGAATCCAGG - Intergenic
1148731198 17:49837704-49837726 CATGAGCCAGCATGAAATCCTGG - Intergenic
1149541087 17:57468697-57468719 CTTGAGCTGTCATCAGTGCCGGG + Intronic
1150111627 17:62505460-62505482 CTCAAGCTGTCTTGAAGTCCTGG + Intronic
1150722376 17:67624572-67624594 CTTGCTCTGTCATGCAATCTTGG + Intronic
1152274969 17:79350791-79350813 CGTGAGCTGGCATGAATTGCGGG + Intronic
1154962942 18:21328124-21328146 CTTTCTCTGTCATGAACTCCTGG + Intronic
1155092937 18:22528797-22528819 CTCCACCTGTCATGAAATGCAGG - Intergenic
1160002792 18:75043129-75043151 CTGGAGCTCTCATGAACTGCTGG - Intronic
1160546068 18:79656899-79656921 CATCAGCTGACCTGAAATCCAGG - Intergenic
1164023809 19:21331941-21331963 CTGAATCTGTCATTAAATCCTGG + Intergenic
1168583796 19:57576763-57576785 CTTGAGGTGTCAGGAATTTCAGG - Intronic
928447894 2:31349187-31349209 CTTGGGCTGTCATCATCTCCAGG + Intronic
929627328 2:43422792-43422814 CTTGAGCTGCCTTGACCTCCTGG + Intronic
930206994 2:48597585-48597607 CTTGAGATGTCCTGAAGGCCCGG - Exonic
932196153 2:69785834-69785856 CTTGAGCTCATAGGAAATCCAGG - Intronic
933887980 2:86738129-86738151 CATGTCCAGTCATGAAATCCTGG + Intronic
933922198 2:87058576-87058598 CATGTCCAGTCATGAAATCCTGG - Intergenic
936895964 2:117427951-117427973 CTTTAGCTGGCAGCAAATCCTGG - Intergenic
940957763 2:159748008-159748030 CTTGAACTGTAAGAAAATCCAGG - Exonic
944967700 2:204954389-204954411 GCTCAGCTGTCATGAAATGCTGG + Intronic
945544700 2:211136856-211136878 CTTGAGCTGACATTGATTCCCGG + Intergenic
946030769 2:216702966-216702988 CTTGAGCTGACTAGAACTCCAGG + Intergenic
948372047 2:237495705-237495727 CCTGGGCTATAATGAAATCCAGG - Intronic
1169764944 20:9139025-9139047 CTTGAGGTCTCATGAAGTACAGG + Intronic
1173331311 20:42078268-42078290 CTGGAGCTGTCCAGAAGTCCAGG - Exonic
1174054731 20:47790329-47790351 TTTGTGATGTGATGAAATCCAGG + Intergenic
1174142610 20:48426403-48426425 ACTGAGCTGTCATGGGATCCTGG - Intergenic
1175628300 20:60508908-60508930 CTTGAACAGTCATGAACTGCTGG - Intergenic
1179662885 21:42889302-42889324 CTTGAGATGTCCTGAAACACAGG + Intronic
1182310520 22:29402168-29402190 CTTGAGCCGTCATGGAAACTTGG + Intronic
1182690760 22:32160169-32160191 CTTGAGCCGTCATGGAAACTTGG - Intergenic
1183245563 22:36690718-36690740 TGTGAGCTGACATGAACTCCAGG + Intronic
954038980 3:47870014-47870036 CTGGAGCTGTTAAGAAATTCAGG - Intronic
958132831 3:89451170-89451192 CTGCAGCTGTAATGCAATCCTGG + Intronic
958452224 3:94287903-94287925 CTTGAGATGGCATGTACTCCTGG + Intergenic
960666664 3:120116099-120116121 CTTGACCTGCCATCCAATCCAGG - Intergenic
961556256 3:127698330-127698352 CTTAAGCTGTCAAAAAATCAAGG - Intronic
962365847 3:134780034-134780056 CAAGAGCTGTCATAAAATGCCGG - Intronic
962797927 3:138864868-138864890 CTTTACCTGTGATGAAATTCAGG - Intergenic
963291972 3:143500534-143500556 CATGAGCAGCCATGACATCCAGG - Intronic
963515116 3:146299783-146299805 CTTGAACTGATATGAAATCTAGG + Intergenic
963925037 3:150942912-150942934 CTTGAGTTGCCAAGAAGTCCAGG + Intronic
964710872 3:159670014-159670036 CTTTAGCTGTCCAGAAATCGTGG - Intronic
966459519 3:180160706-180160728 CTTGAGTTGTCTTGAACTCCTGG + Intergenic
967399121 3:189041057-189041079 CTAGAGCTGTGATGTTATCCAGG - Intronic
971726027 4:30313165-30313187 CTTGATTTGTCATGGAATACTGG - Intergenic
975330056 4:73102210-73102232 CTTGACCTGCCATAAAATGCTGG + Intronic
978093392 4:104745497-104745519 CTTAATCTGTCATGGAATACTGG - Intergenic
978391886 4:108235792-108235814 CTACATCTGTAATGAAATCCAGG + Intergenic
979540642 4:121877323-121877345 CTCAAGCTGAGATGAAATCCTGG - Intergenic
980074646 4:128282183-128282205 CTTTTACTGTAATGAAATCCAGG + Intronic
984400828 4:179261744-179261766 CTAGACCTGTAACGAAATCCCGG + Intergenic
985814492 5:2116494-2116516 GTTGAGATGTCAGGAAATCTGGG + Intergenic
989017254 5:36952960-36952982 TTTGAGGTTTCATGAAATCGTGG + Intronic
992021643 5:72630589-72630611 CTGGGGCTGTCATGATAACCAGG - Intergenic
992308851 5:75473293-75473315 CTCAAGCTGTCTTGAAGTCCTGG + Intronic
994026745 5:95093324-95093346 CCTTAGCAGTCATGAAATGCAGG - Intronic
998325042 5:141272711-141272733 CTTGATCTGCCATTAAATGCAGG - Intergenic
998481463 5:142466634-142466656 CTGGACCTGTCATTCAATCCTGG - Intergenic
1003849954 6:10211372-10211394 ACTGACCTGTCATGAAATCTCGG + Intronic
1007423334 6:41732920-41732942 CCACAGCTGTCATGAAAACCAGG - Intronic
1011455070 6:87539882-87539904 CTTAATCTTTCATGAGATCCAGG - Intronic
1018618290 6:165708456-165708478 CCTGAGCGGACATGAAATGCAGG - Intronic
1022330252 7:29371906-29371928 CTTTACCTGCAATGAAATCCAGG - Intronic
1031794481 7:126154270-126154292 ATTGATCTGTCATGAGCTCCTGG + Intergenic
1032040834 7:128559391-128559413 CTCAAGCTGTCTTGAAGTCCTGG + Intergenic
1036092096 8:5677670-5677692 CATGACCTGTCGTGAAATTCTGG - Intergenic
1036735322 8:11309224-11309246 CCTGACCTGTCATGAAACGCAGG + Intronic
1039906969 8:41793666-41793688 CATGAGCTGTCAAGAAAGCTCGG - Intronic
1041730056 8:61053776-61053798 CTGGAGCTGTCAGGAAATATTGG + Intergenic
1042664394 8:71190166-71190188 CTTGAGCCATCAGGAAAACCAGG + Intergenic
1046710988 8:117511390-117511412 CTCAAGGTGCCATGAAATCCTGG - Intergenic
1046855385 8:119025818-119025840 TTTGAGCTTTCTTGAAAGCCAGG + Intronic
1053351138 9:37414128-37414150 CTTGAGCTGGACTCAAATCCAGG - Intergenic
1057955361 9:99403115-99403137 CTTCAGCTGTGATGGGATCCTGG + Intergenic
1062021676 9:134322477-134322499 CTGGAGCTGCACTGAAATCCTGG + Intronic
1187290812 X:17951476-17951498 CTTGACCAGTCATTGAATCCAGG - Intergenic
1187838392 X:23459072-23459094 CTTGAGCTATCATGGGCTCCAGG + Intergenic
1188542016 X:31261528-31261550 CTTAAGCTGAAATGAAATACAGG - Intronic
1189103212 X:38212061-38212083 CTTTAGCTGTCAAGAAAACCAGG - Intronic
1190115932 X:47626436-47626458 CATCAGCTGTCAAGAAATCCCGG - Exonic
1193868818 X:86771103-86771125 CTTGTGCTGACATAATATCCAGG + Intronic
1197043646 X:121970302-121970324 CTTGTGCAGTCCTGAAACCCAGG - Intergenic
1197474078 X:126898216-126898238 CTTGAGATGTCATCTACTCCTGG + Intergenic
1197867851 X:131037527-131037549 CCTGAACAGTCCTGAAATCCTGG + Intergenic
1201686920 Y:16715049-16715071 ATTGAGCTGTCAGGAGACCCAGG - Intergenic