ID: 1100618402

View in Genome Browser
Species Human (GRCh38)
Location 12:96249358-96249380
Sequence GCGCGTCACCACCAGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618413 4 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616
1100618402_1100618414 10 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618414 12:96249391-96249413 AGGGGGAGGGCCAGGGGATCAGG 0: 1
1: 0
2: 4
3: 76
4: 846
1100618402_1100618406 -8 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1100618402_1100618409 -3 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618409 12:96249378-96249400 CGCGCCACTGCGGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1100618402_1100618404 -10 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1100618402_1100618412 3 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415
1100618402_1100618415 17 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618415 12:96249398-96249420 GGGCCAGGGGATCAGGATATAGG 0: 1
1: 0
2: 0
3: 13
4: 182
1100618402_1100618405 -9 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618405 12:96249372-96249394 GTGACGCGCGCCACTGCGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 27
1100618402_1100618411 2 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510
1100618402_1100618407 -7 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1100618402_1100618408 -4 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618402 Original CRISPR GCGCGTCACCACCAGCTCAC AGG (reversed) Intronic
904410533 1:30322232-30322254 GAGCCTCCCCACCAGCTCACAGG - Intergenic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
917535673 1:175872803-175872825 GCCCGCTACCACCAGATCACAGG - Intergenic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1068783155 10:60943644-60943666 GCGCGGCACCACCCCCTCCCTGG + Intronic
1069686032 10:70319344-70319366 GGGCCTCACCACGTGCTCACCGG - Intronic
1070536694 10:77384007-77384029 GTGCGTCACCATCAGCTCTCTGG + Intronic
1076207225 10:128612897-128612919 GCGCCTGACCACTGGCTCACAGG - Intergenic
1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG + Intronic
1085460080 11:76688318-76688340 GCTGCTCACCACCTGCTCACAGG - Intergenic
1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG + Intronic
1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG + Exonic
1096389502 12:51217803-51217825 GCGGGTCCCGACCAGCTCCCGGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1113025667 13:105938378-105938400 TCTCATCACCACCAGTTCACAGG + Intergenic
1123476836 15:20596794-20596816 GGGCCTCTCCACCTGCTCACAGG - Intergenic
1123641175 15:22403570-22403592 GGGCCTCTCCACCTGCTCACAGG + Intergenic
1125937546 15:43649424-43649446 GCGAGGCACCTCCAGCTCCCGGG - Intronic
1128501467 15:68229883-68229905 GCGCGTGACCACCAGCGGGCTGG + Intronic
1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG + Intergenic
1136764881 16:32768814-32768836 GCACGTGGCCATCAGCTCACAGG - Intergenic
1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG + Intergenic
1142431845 16:90032893-90032915 GTTCTTCACCACCACCTCACTGG - Exonic
1203067238 16_KI270728v1_random:1030939-1030961 GCACGTGGCCATCAGCTCACAGG - Intergenic
1143515084 17:7415471-7415493 GGGTCTCACCACCTGCTCACTGG - Intronic
1148323469 17:46770941-46770963 GCGAGTCACCTCCGGCTCCCGGG - Intronic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1165754600 19:38285248-38285270 TCTCATCACCACCAGCTCTCAGG - Intronic
942938169 2:181583614-181583636 CAGCATCACCAGCAGCTCACTGG + Intronic
1168891987 20:1300709-1300731 GCTCGTGGCCACCCGCTCACCGG - Exonic
1170324353 20:15139830-15139852 GCATGTCACCACCAGGTAACTGG - Intronic
1176201771 20:63864149-63864171 GCGCGTAACCACCAGGCAACTGG - Intergenic
1178411662 21:32368650-32368672 GCACGTCACCATGAGCTCTCAGG - Intronic
1185227260 22:49660163-49660185 ACGCGGCACCTCCAGGTCACCGG + Intergenic
1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG + Exonic
960900324 3:122548022-122548044 GCGCCTCACCCACAGCTAACTGG - Intronic
969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG + Intronic
981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG + Intergenic
982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG + Intronic
987645104 5:20660415-20660437 AAACGTCACCAGCAGCTCACAGG - Intergenic
1003429510 6:6026058-6026080 GCTGCTCACCTCCAGCTCACTGG - Intergenic
1004413724 6:15405420-15405442 GCTAGTCACCATCAGCTGACGGG - Intronic
1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG + Intergenic
1012386458 6:98688942-98688964 GCTGTTCACCACCATCTCACAGG + Intergenic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1017034624 6:150256048-150256070 GCCCATCCCCACCCGCTCACAGG + Intergenic
1034265946 7:149780692-149780714 GGGGGTCACCTCCAGCTCAGGGG + Intergenic
1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG + Intronic
1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG + Intronic
1038789709 8:30657862-30657884 GAGCGTGACCTCCACCTCACGGG - Intronic
1059405215 9:114095031-114095053 GCGGGTCACCACCCGACCACAGG - Exonic
1060409765 9:123392503-123392525 GCTCGTCAGCACCTGCCCACTGG - Intronic
1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG + Intergenic
1062635175 9:137486873-137486895 GGGGGTCACCAGCAGCTCTCAGG - Intronic
1195355983 X:104040300-104040322 GCGCGTGACCATCACCTCCCGGG + Exonic