ID: 1100618404

View in Genome Browser
Species Human (GRCh38)
Location 12:96249371-96249393
Sequence GGTGACGCGCGCCACTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618404 -10 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1100618399_1100618404 13 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44
1100618398_1100618404 14 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618404 Original CRISPR GGTGACGCGCGCCACTGCGG AGG Intronic
900309446 1:2026363-2026385 GGTGTGGCGCGCCCCTGCCGTGG - Intronic
900572558 1:3365700-3365722 GGTGACGGGAGCCACTTAGGCGG - Intronic
901783691 1:11610692-11610714 GGTGACGGGCACCACTGTGAGGG + Intergenic
901880581 1:12191520-12191542 GGGGACGAGCGCGACTGCGGGGG + Intronic
905066845 1:35192092-35192114 GCTTGCGCGCGCCGCTGCGGGGG - Intronic
915128078 1:153679473-153679495 GGTGAAGCGCCCCACTGGGGCGG - Exonic
920362803 1:205430790-205430812 GGCGGGGCGCCCCACTGCGGAGG - Intronic
924853994 1:247857666-247857688 GGTGAGGCGCCCCCCGGCGGGGG + Exonic
1065188918 10:23193212-23193234 GGTGGCGCGGGCGGCTGCGGGGG + Exonic
1067059320 10:43069838-43069860 GGAGACGGGCGGCACTGCAGGGG - Intergenic
1073048882 10:100655332-100655354 GGTGCCGCGCTGCAGTGCGGTGG - Intergenic
1076908203 10:133373577-133373599 GGGGGCGCGGGCGACTGCGGCGG - Exonic
1077031768 11:471678-471700 GGTGACGCGCGCCTGTCGGGCGG + Intronic
1085785062 11:79441125-79441147 GGTGATGGGCGCCTCTCCGGGGG + Intergenic
1100618404 12:96249371-96249393 GGTGACGCGCGCCACTGCGGAGG + Intronic
1122275034 14:100586950-100586972 TGACACGCGCGCCCCTGCGGCGG - Intronic
1132498657 16:275380-275402 GGTGAGGCGCGCCGGGGCGGGGG - Exonic
1132568495 16:634058-634080 GGTGGCGCAGGCCCCTGCGGGGG - Exonic
1135976112 16:27109838-27109860 GGCGATGCGCGGCACTGCAGAGG + Intergenic
1143512632 17:7404871-7404893 GGTGACGCGCGGGGCTGCTGCGG + Intronic
1150283699 17:63943914-63943936 GGTGAGGTGCCCCACTGAGGTGG - Intronic
1159588570 18:70306337-70306359 GGTGGCGCACGCTACTGGGGAGG + Intronic
1160411150 18:78676292-78676314 GGAGAAGCGCGGCATTGCGGTGG - Intergenic
1160442277 18:78901979-78902001 GGTGACGGGTGCCCCTGCAGGGG - Intergenic
924999626 2:394556-394578 GGAGACGCGGGCCCCAGCGGGGG - Intergenic
929539813 2:42810925-42810947 GGCGAGGCGCTCCACTGTGGCGG + Intergenic
935220887 2:101011391-101011413 GGTGCCTCCCGCCACTGCAGTGG + Intronic
946247394 2:218395586-218395608 GGTGGCGCGCGCCACTCCCGGGG - Exonic
948393204 2:237627229-237627251 AGCGACGCGCGCCAGGGCGGTGG - Intergenic
948786788 2:240356867-240356889 GGGGACGGGCGCTGCTGCGGTGG + Intergenic
1179822007 21:43942503-43942525 GGAGACGCCCGCCCCTGCGGTGG + Intronic
1181112500 22:20610267-20610289 GGTGAACCGGGCCACTGCAGAGG + Intergenic
1185397597 22:50600788-50600810 GGAGAGGCCCGCGACTGCGGCGG - Exonic
949318467 3:2782989-2783011 GGTGAGGAGTGCCAGTGCGGTGG + Intronic
954107344 3:48416396-48416418 GGTGGCCGGCGCCACAGCGGTGG - Exonic
958785482 3:98593165-98593187 GGGGACGCGGGCCACTTCGCTGG - Exonic
960914346 3:122681152-122681174 GGTGACCCGCCCGACTTCGGCGG + Intronic
968085524 3:195872297-195872319 AGTGACCCCCGCCACTGCTGGGG - Exonic
968372878 4:11600-11622 GGAGACGCACGCCAGCGCGGGGG + Intergenic
985462518 4:190120967-190120989 GGAGACGCACGCCAGCGCGGGGG - Intergenic
1001026179 5:168226115-168226137 CGTGACGCGCCCCACGGGGGTGG + Exonic
1004999265 6:21224390-21224412 GGTGACACGCGCTACTCGGGAGG + Intronic
1008006489 6:46415144-46415166 GGTGACCCTGGCAACTGCGGAGG + Intronic
1033235828 7:139637130-139637152 GGTGACCAGCGCCACTGCTGCGG - Intronic
1046704443 8:117434755-117434777 AGTGGCGCCCGCCATTGCGGAGG + Intergenic
1061890658 9:133617430-133617452 GGTGCCGCCCGCCTCTGCAGGGG + Intergenic
1062372132 9:136245454-136245476 GGTGAGGCGCGCCCCCGCGCGGG - Exonic
1190307161 X:49090953-49090975 GGTGGCGGGCGCCACTTGGGAGG - Intronic
1200003196 X:153072533-153072555 GGGGCTGCGCGCCGCTGCGGCGG - Exonic
1200004527 X:153077476-153077498 GGGGCTGCGCGCCGCTGCGGCGG + Intergenic