ID: 1100618406

View in Genome Browser
Species Human (GRCh38)
Location 12:96249373-96249395
Sequence TGACGCGCGCCACTGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618399_1100618406 15 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1100618398_1100618406 16 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1100618402_1100618406 -8 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618406 Original CRISPR TGACGCGCGCCACTGCGGAG GGG Intronic
901649135 1:10733378-10733400 TGACACTCGCCACTGCCGAGAGG + Intronic
902955633 1:19922744-19922766 TGACCAGAGCCACTGCAGAGAGG + Exonic
912401642 1:109398051-109398073 CGACGCGAGCCAATGAGGAGTGG - Intergenic
922785509 1:228280564-228280586 TGCCGCGCTCCTCTGCGGACAGG - Exonic
1076716365 10:132366225-132366247 TGAGGGGCGTCACTGCAGAGAGG + Intronic
1077516466 11:3004767-3004789 TGACACGCGCCACTCAGGTGAGG + Intronic
1100618406 12:96249373-96249395 TGACGCGCGCCACTGCGGAGGGG + Intronic
1100620871 12:96271456-96271478 ACACACGCGCCACTGGGGAGTGG - Intergenic
1119759237 14:77139813-77139835 AGACGCGCGGCACGGAGGAGCGG - Intronic
1125522840 15:40357825-40357847 TGCCTCGCCCCACTGGGGAGGGG + Intergenic
1132779024 16:1612813-1612835 AGACGCGAGCCGGTGCGGAGCGG + Intronic
1133024172 16:2980494-2980516 TGACGGGCTGCACTGGGGAGGGG - Exonic
1148183172 17:45620881-45620903 GGAGGCGCCCCACTGCGGGGAGG + Intergenic
1148265678 17:46224810-46224832 GGAGGCGCCCCACTGCGGGGAGG - Intronic
1164989967 19:32676069-32676091 CGACGTGCGCCTCTGCGGACGGG - Exonic
1166043480 19:40216502-40216524 TGACGGGAGCCTCTGCGAAGAGG - Intronic
931632192 2:64311422-64311444 TGACGACAGCCACAGCGGAGAGG + Intergenic
934655933 2:96116806-96116828 GGACGCGCGCAGCTGTGGAGGGG + Intergenic
937037595 2:118794642-118794664 TGACACCTGCCACTGCAGAGTGG - Intergenic
942047494 2:172108311-172108333 AGACTCGAGCCTCTGCGGAGAGG + Intergenic
946428435 2:219612268-219612290 TGACGCACGCCACTGTGTAAGGG - Intronic
1176156724 20:63626165-63626187 TGACGCGGGCCCCTGTGGGGTGG + Intronic
1184583468 22:45432097-45432119 TGACCCTCGCCGCTGAGGAGCGG + Intronic
950576870 3:13837329-13837351 TGATGCGGGGCACTGTGGAGAGG - Intronic
961398676 3:126617423-126617445 TGAAGCCAGCCACTGGGGAGGGG - Intronic
993259326 5:85638887-85638909 GGGCGCCCGCCACTGGGGAGGGG + Intergenic
993261518 5:85663183-85663205 GGGCGCCCGCCACTGGGGAGGGG - Intergenic
1019922168 7:4169856-4169878 TGACTCGGGCCACTGCAAAGAGG - Intronic
1043414035 8:80030276-80030298 TGACCCGCGCGCTTGCGGAGGGG - Intronic
1044306467 8:90645939-90645961 TAACGGGCGCCGCGGCGGAGGGG - Exonic
1198424182 X:136497882-136497904 CCACGGGCGCCACTGCAGAGCGG + Intronic