ID: 1100618407

View in Genome Browser
Species Human (GRCh38)
Location 12:96249374-96249396
Sequence GACGCGCGCCACTGCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618399_1100618407 16 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1100618402_1100618407 -7 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1100618398_1100618407 17 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618407 Original CRISPR GACGCGCGCCACTGCGGAGG GGG Intronic
900228009 1:1541623-1541645 GACCCTCGCCCCTGAGGAGGTGG - Intergenic
902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG + Intronic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
915128077 1:153679470-153679492 GAAGCGCCCCACTGGGGCGGCGG - Exonic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG + Exonic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG + Exonic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1119759236 14:77139812-77139834 GACGCGCGGCACGGAGGAGCGGG - Intronic
1122951544 14:105047772-105047794 GACGGGCGCAGCTGGGGAGGTGG - Intergenic
1132779025 16:1612814-1612836 GACGCGAGCCGGTGCGGAGCGGG + Intronic
1133024171 16:2980493-2980515 GACGGGCTGCACTGGGGAGGGGG - Exonic
1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG + Intergenic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1148128078 17:45247066-45247088 GAGGCGGGCCACAGCGGAGGAGG - Exonic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1161383240 19:3977522-3977544 GACGCCATCCACCGCGGAGGGGG - Exonic
1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG + Intergenic
1164989966 19:32676068-32676090 GACGTGCGCCTCTGCGGACGGGG - Exonic
1168649650 19:58085242-58085264 GTCGGGCACCACTGAGGAGGAGG - Exonic
936049347 2:109211474-109211496 GATGGGCGCAACTGCGGTGGAGG + Intronic
937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG + Intronic
938183446 2:129206321-129206343 GACACGCTCCACTGCAGAGGTGG - Intergenic
938344756 2:130559127-130559149 GACCCTCGGCACTGAGGAGGAGG - Intergenic
938345077 2:130561593-130561615 GACCCTCGGCACTGAGGAGGAGG + Intergenic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG + Intergenic
1175992192 20:62795195-62795217 AACGCGAGTCACTGCGGATGGGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG + Intronic
1185397594 22:50600785-50600807 GAGGCCCGCGACTGCGGCGGGGG - Exonic
953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG + Intronic
957138528 3:76321379-76321401 GTGGCGCGCCACTGCTCAGGAGG + Intronic
1028556784 7:92134122-92134144 GGCGCGCGCCGCAGCTGAGGCGG - Intronic
1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG + Intergenic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1057453893 9:95190282-95190304 GACGCGGGTCACTGCTGCGGAGG - Intronic
1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG + Intergenic
1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG + Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic