ID: 1100618408

View in Genome Browser
Species Human (GRCh38)
Location 12:96249377-96249399
Sequence GCGCGCCACTGCGGAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618408 -4 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1100618398_1100618408 20 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1100618399_1100618408 19 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618408 Original CRISPR GCGCGCCACTGCGGAGGGGG AGG Intronic
901068173 1:6504461-6504483 GCCCCCCACTGTGGAGGAGGGGG - Intronic
901526170 1:9824373-9824395 GCGCTCCTCGGCGGAGCGGGTGG - Exonic
903013023 1:20343816-20343838 GCGGGGCTGTGCGGAGGGGGCGG - Intronic
905518316 1:38578404-38578426 GCGAGCCAGAGAGGAGGGGGCGG + Intergenic
905847127 1:41242262-41242284 GCGCGCCACCTCGCAGCGGGAGG - Intergenic
906140600 1:43531547-43531569 GGGCGCCTGTGCGGCGGGGGCGG - Intronic
906680025 1:47720110-47720132 GCGGGCCACAGGGGAGGGTGAGG + Intergenic
907880660 1:58546612-58546634 GTGCGGCAGTGGGGAGGGGGCGG - Intronic
910981241 1:92961544-92961566 GCGCGCCGCGGCGGGGGCGGGGG - Intergenic
911725408 1:101236957-101236979 GTGCTCCGCTGCGGAGGGAGGGG + Exonic
912576258 1:110674997-110675019 GCGCCCCGCAGGGGAGGGGGCGG - Exonic
918993935 1:191732098-191732120 GCGCGCCGTTGAGCAGGGGGCGG - Intergenic
920704847 1:208243577-208243599 GCGCGCCTGTGGGGAGAGGGCGG + Intronic
921207075 1:212858320-212858342 GCGCGCCACCGGGGAAGGAGCGG + Exonic
921934856 1:220786955-220786977 GCGCGCCAGCGCGGAGGAGCCGG - Exonic
923171678 1:231422333-231422355 GCGCGCGAGGGCGGAGGGGGCGG + Exonic
1066323124 10:34325529-34325551 GTGTGACACTGGGGAGGGGGTGG - Intronic
1071618209 10:87095075-87095097 GCGCGCCAGTGGGGAAGGGAGGG + Intronic
1072283781 10:93894108-93894130 GGGCGCCACTGAGGAGCCGGCGG + Exonic
1073498044 10:103911996-103912018 GCGTGCCTCTGTGGAGGGAGAGG - Intronic
1077332461 11:1989528-1989550 GCGGGCCACTGGTGAGAGGGTGG - Intergenic
1079126019 11:17719381-17719403 GCACGCCAGTGTGGAGGGGCGGG + Intergenic
1080606636 11:33869628-33869650 GCGCGCCGCGGCCGAGGCGGGGG + Intronic
1084964289 11:72736356-72736378 CCCCGCTACTGGGGAGGGGGAGG - Intronic
1087682297 11:101231368-101231390 GGGCGCCACAGAGCAGGGGGCGG + Intergenic
1089520043 11:119057245-119057267 GCGCGCCGGGGCGGCGGGGGCGG - Intergenic
1202815442 11_KI270721v1_random:44704-44726 GCGGGCCACTGGTGAGAGGGTGG - Intergenic
1095977903 12:47952228-47952250 GAGCGACCCTGGGGAGGGGGAGG + Intergenic
1096837388 12:54359406-54359428 GCGGGCGACTGGGGAGGGGGCGG + Intergenic
1100618408 12:96249377-96249399 GCGCGCCACTGCGGAGGGGGAGG + Intronic
1104754989 12:131263757-131263779 GCGGGCCACTCGGGAGGGGCAGG + Intergenic
1104843175 12:131834302-131834324 GAAGGCCACTGGGGAGGGGGAGG - Intronic
1105353051 13:19633417-19633439 GCGCGACGCTGGGGAGGAGGAGG - Intergenic
1106422370 13:29595065-29595087 GCGCGCCGCTACGCACGGGGTGG - Intronic
1113820371 13:113209027-113209049 GCGCGCGCCCGAGGAGGGGGAGG + Intronic
1118887636 14:69879798-69879820 GCGCCCACCTGCGGAGGGAGGGG + Intronic
1123500788 15:20878740-20878762 GCGCGCCGCTGCGGACGCGGCGG + Intergenic
1123558038 15:21452433-21452455 GCGCGCCGCTGCGGACGCGGCGG + Intergenic
1123594266 15:21889714-21889736 GCGCGCCGCTGCGGACGCGGCGG + Intergenic
1124641158 15:31397415-31397437 GCGCGTCACTGAGGAGGAGAGGG - Intronic
1126849038 15:52786640-52786662 GGACGGCACTGTGGAGGGGGAGG - Intronic
1126849870 15:52790370-52790392 GCGGGCCGCTGCGGCGGCGGCGG - Intronic
1127439098 15:58988113-58988135 GCGCGCAACGGGGGAGGGGCCGG + Intronic
1127674631 15:61228264-61228286 GCGCGCCAACGCGCAGAGGGCGG - Intronic
1128743962 15:70100828-70100850 GCCCGGCTCTGCGGAGGAGGCGG - Intergenic
1129082564 15:73052982-73053004 GGGCGCCACCGGGGAAGGGGCGG + Intronic
1129165544 15:73775214-73775236 GGGCGGCACTGTGGAGGAGGTGG + Intergenic
1130335185 15:82952347-82952369 GCGTGCCCCGGCGGAGGGCGCGG + Intronic
1130912805 15:88282621-88282643 AGACGCCACTGGGGAGGGGGAGG - Intergenic
1132055539 15:98648452-98648474 GCGCGCCGCTGCTGCGGCGGTGG + Intergenic
1202966389 15_KI270727v1_random:179605-179627 GCGCGCTGCTGCGGACGCGGCGG + Intergenic
1132683324 16:1152684-1152706 GCGCGGCAGCGCGAAGGGGGAGG + Intergenic
1132684485 16:1156610-1156632 GCGGGGCCCTGCGGAGGGAGGGG - Intronic
1133024170 16:2980490-2980512 GGGCTGCACTGGGGAGGGGGAGG - Exonic
1135821720 16:25691882-25691904 GCGCGCGCCTGCGAAGGGGGCGG - Intergenic
1135976114 16:27109844-27109866 GCGCGGCACTGCAGAGGCGGCGG + Intergenic
1137687061 16:50393560-50393582 GCACACCACTGGGGAGGGGCAGG - Intergenic
1142309760 16:89305667-89305689 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309765 16:89305692-89305714 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309770 16:89305717-89305739 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309776 16:89305746-89305768 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309781 16:89305771-89305793 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309810 16:89305908-89305930 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309817 16:89305937-89305959 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309824 16:89305966-89305988 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309831 16:89305995-89306017 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309838 16:89306024-89306046 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309845 16:89306053-89306075 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309850 16:89306082-89306104 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309865 16:89306159-89306181 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309871 16:89306188-89306210 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309877 16:89306217-89306239 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309882 16:89306242-89306264 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309887 16:89306271-89306293 GCGTGTGTCTGCGGAGGGGGAGG - Intronic
1142309895 16:89306300-89306322 GCACGTGTCTGCGGAGGGGGAGG - Intronic
1142309902 16:89306325-89306347 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309908 16:89306354-89306376 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309913 16:89306383-89306405 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309923 16:89306437-89306459 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309930 16:89306466-89306488 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309935 16:89306491-89306513 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309942 16:89306520-89306542 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309947 16:89306549-89306571 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309952 16:89306574-89306596 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309957 16:89306599-89306621 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309977 16:89306703-89306725 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309984 16:89306732-89306754 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309989 16:89306761-89306783 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142309995 16:89306790-89306812 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1142310005 16:89306844-89306866 GCGCGTGTCTGCGGAGTGGGAGG - Intronic
1145367667 17:22278358-22278380 GGGCGCCACTGCCCTGGGGGTGG + Intergenic
1147670542 17:42174440-42174462 GCGCACCCCTGGGGAGGGGTAGG + Intronic
1148079449 17:44959802-44959824 GCGCGCCACCCCGGAGGGAGCGG + Exonic
1148785320 17:50143512-50143534 GTGGGCCACTGAGCAGGGGGTGG - Intronic
1148863716 17:50617944-50617966 GGGGGCCTCTGGGGAGGGGGAGG + Intronic
1149626376 17:58083444-58083466 AGGCGCCAGTGCGGAGCGGGCGG + Exonic
1150283695 17:63943908-63943930 GTGCCCCACTGAGGTGGGGGTGG - Intronic
1150675702 17:67244900-67244922 GCGGGCCCCAGCGGAGGGGAAGG + Intronic
1152345326 17:79747670-79747692 CCGCGCCGCTGCGGTGGGGAGGG - Intergenic
1152454903 17:80409070-80409092 GCCCACGACTCCGGAGGGGGTGG - Intergenic
1152627612 17:81395131-81395153 GCGTGTCCCGGCGGAGGGGGAGG - Intergenic
1156099639 18:33578394-33578416 GCGCGCGACGGCGGCGGCGGCGG - Intergenic
1160157012 18:76441938-76441960 GCGCGCCCCGGCCGAGGAGGGGG - Exonic
1160992231 19:1864498-1864520 GCGCCCCACTGGGGGTGGGGAGG + Intergenic
1161272720 19:3398811-3398833 GCGCCCAGCTGGGGAGGGGGAGG + Intronic
1162485920 19:10960681-10960703 GGACGCCACTGCGGCGGCGGTGG - Intergenic
1163463796 19:17454965-17454987 GCCCCCCACTGCGGAGAGAGAGG - Intronic
1166806367 19:45489546-45489568 GTCCGCCACTGTGGAGGGGTGGG + Exonic
1166807820 19:45497364-45497386 GGGTGCCATTGAGGAGGGGGTGG + Intronic
925066327 2:931718-931740 GGGGGCCATTGCGGAGGGAGAGG + Intergenic
926675879 2:15619292-15619314 GCCCGCCACTGCTGCGGGGAGGG - Intronic
926717929 2:15939730-15939752 CCTCACCACTGCGGAGGAGGAGG - Intergenic
927887590 2:26728191-26728213 GCGGGCGGCGGCGGAGGGGGTGG + Exonic
931728170 2:65130478-65130500 GCGCCCCACGGGGGAGGGGGCGG + Intergenic
933139864 2:78779324-78779346 GCGAGCCCCTGAGCAGGGGGTGG - Intergenic
934655934 2:96116810-96116832 GCGCGCAGCTGTGGAGGGGTCGG + Intergenic
934680019 2:96276978-96277000 GCCCGCCACTGCAGGGGGAGAGG + Exonic
934709213 2:96504030-96504052 GGTCCCCACTGCTGAGGGGGTGG + Intronic
934967006 2:98731563-98731585 GCGCGCCGCTGGGAAGGGGCCGG - Intergenic
935131461 2:100264343-100264365 GCGGGCCTCTGAGGAGGTGGAGG - Intergenic
936049350 2:109211477-109211499 GGGCGCAACTGCGGTGGAGGGGG + Intronic
938312492 2:130302163-130302185 GGGCACCACTGTGGTGGGGGTGG + Intergenic
939969818 2:148645704-148645726 GTGCAGCACTGCGGCGGGGGAGG + Intronic
942047496 2:172108315-172108337 TCGAGCCTCTGCGGAGAGGGCGG + Intergenic
947353637 2:229271311-229271333 GCGCGCGGCGGCGGCGGGGGCGG + Intergenic
947500214 2:230666056-230666078 GCGGCCCACTGCAGTGGGGGCGG + Intergenic
947718119 2:232351964-232351986 GCGCGCCGGTGAGGAAGGGGCGG - Intergenic
1168853561 20:993192-993214 ATGTGCCATTGCGGAGGGGGTGG - Intronic
1169119120 20:3084790-3084812 GGGAGCCACTGGGGAGGGGGTGG - Intergenic
1171123455 20:22583883-22583905 GCGCGCGGCTGGGGAGGGGTGGG - Intronic
1171307135 20:24116344-24116366 GCAGCCCACTGCAGAGGGGGAGG + Intergenic
1171973376 20:31578604-31578626 GGGCGCCATGGAGGAGGGGGCGG + Intergenic
1172212382 20:33209938-33209960 TCACGCCAGTGCGGAGGGGGAGG + Intergenic
1176233065 20:64041811-64041833 GCGCCCCACCGCTGAAGGGGTGG - Intronic
1178531556 21:33380685-33380707 GCGAGTCACAGCGGAGGGCGTGG - Intergenic
1180093068 21:45542462-45542484 GCGCGCGGCTGCGGGGTGGGCGG + Exonic
1180713650 22:17857149-17857171 CCGGGCCACAGCGCAGGGGGTGG - Intronic
1181500612 22:23313649-23313671 GGGCTCCTCTGGGGAGGGGGTGG + Intronic
1184041542 22:41946901-41946923 GCGCGCTACCGTGGCGGGGGCGG - Intronic
1184247043 22:43241002-43241024 CCGGGTCTCTGCGGAGGGGGAGG + Intronic
1184465937 22:44668877-44668899 GCGCGACCCTGCGGAAGGGGGGG + Intronic
951185012 3:19702855-19702877 GGGCGCCACGGAGCAGGGGGCGG - Intergenic
953447355 3:42979548-42979570 GCGAGCCACGGCGCCGGGGGCGG + Exonic
953748713 3:45594079-45594101 CCGCGCCGGGGCGGAGGGGGCGG - Intronic
955325834 3:58008912-58008934 GTGCACCCCTGCGGAGGGCGAGG + Intronic
956678006 3:71753619-71753641 GCGCGCTCCGGCGGAGGGGAGGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968611292 4:1558280-1558302 GAGCCACACTGCGGAGGGGGAGG + Intergenic
968756387 4:2418357-2418379 GCGCAGCGCTGCGGAGGGCGAGG - Exonic
971294591 4:25377235-25377257 GCGCGCGACAGCGGCGGGGCGGG + Intronic
977206575 4:94170173-94170195 GGGCGCCATTGAGCAGGGGGCGG - Intergenic
977972331 4:103227012-103227034 GCCCACCACTCTGGAGGGGGTGG - Intergenic
978997995 4:115179463-115179485 GGGCGCCACGGAGCAGGGGGTGG + Intergenic
980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG + Intronic
988823953 5:34915834-34915856 GCACGCCACAGCAGAGGAGGTGG + Exonic
991371617 5:65925719-65925741 CCGCGACTCTGCGGCGGGGGCGG - Intergenic
994367109 5:98928812-98928834 GCGCGCGACGGCGGCGGCGGCGG - Exonic
1000320278 5:160129182-160129204 AGGCACCACTGTGGAGGGGGTGG + Intergenic
1001065105 5:168529664-168529686 GCGCGCGGCTTCGGCGGGGGCGG + Exonic
1001296715 5:170503963-170503985 GCGGGCAACTACGGAGGGGCGGG - Intronic
1004044579 6:12012108-12012130 GCGCGCCGCGGCGGGGCGGGCGG - Intronic
1004196536 6:13511067-13511089 GGGCGCCACGGAGCAGGGGGCGG + Intergenic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1010044157 6:71420775-71420797 GCGAGCCGCTGCGGAGGGAAGGG - Intergenic
1014088328 6:117373322-117373344 GGGCGCCACGGAGCAGGGGGCGG + Intronic
1025907438 7:65798676-65798698 GTGTGCCTCTGTGGAGGGGGTGG + Intergenic
1032262427 7:130347877-130347899 GTGAGCCACTGAGGAGGGGGTGG - Intronic
1034306380 7:150048059-150048081 GCGAGCCGCCGGGGAGGGGGCGG - Intergenic
1034800466 7:154052583-154052605 GCGAGCCGCCGGGGAGGGGGCGG + Intronic
1035125764 7:156607194-156607216 GCGGTCCCCTGCTGAGGGGGGGG - Intergenic
1035519488 8:265939-265961 GTGCGCACCTGAGGAGGGGGAGG + Intergenic
1035519729 8:266601-266623 GTGCCCACCTGCGGAGGGGGTGG + Intergenic
1035519739 8:266634-266656 GTGCGCAACTGCAGAGGGTGCGG + Intergenic
1043640208 8:82441706-82441728 GGGCGCCACGGAGCAGGGGGCGG - Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1045222574 8:100213253-100213275 GCGGGCCTCTGCGGCGGCGGCGG + Exonic
1045583116 8:103500431-103500453 GCGCGCCGCCTCGGAGGGGAAGG - Intergenic
1045933781 8:107655927-107655949 GGGCGCCACGGAGCAGGGGGTGG - Intergenic
1046031463 8:108787609-108787631 GCCCGCCACGGCGGGCGGGGTGG + Exonic
1050204391 9:3181677-3181699 GCGCTCCTGTGCGGAGGGTGGGG - Intergenic
1050373377 9:4945700-4945722 GTGTGCCACTGTGGAGGAGGTGG - Intergenic
1050472542 9:6008034-6008056 GCGCGCCGCCGCCGGGGGGGAGG - Intergenic
1056659904 9:88535798-88535820 GCTCCCCAGTGCAGAGGGGGAGG - Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1058467519 9:105244498-105244520 GCGCGGCGCTGAGGAGGCGGCGG + Intergenic
1060981116 9:127792784-127792806 GAGCTCCACTGGGGTGGGGGCGG - Intergenic
1061570862 9:131476736-131476758 GAGCACCACTGGGGTGGGGGTGG - Intronic
1062466390 9:136683481-136683503 GCGAGCCCCAGCAGAGGGGGAGG - Intronic
1186768056 X:12791452-12791474 GCGCGCGGCGGCGGAGGAGGTGG - Exonic
1190203525 X:48383603-48383625 GTGCACCACGGCGGAGGGGAGGG - Intronic
1190207011 X:48411801-48411823 GTGCACCACGGCGGAGGGGAGGG + Intronic
1195668357 X:107449935-107449957 CCGCGCCGCTGAGGAGGCGGAGG + Intergenic
1196339979 X:114584502-114584524 TCGCGCCTCGGCGGAGGGAGAGG - Exonic
1197753414 X:129980428-129980450 GTGCGGCCCTGCGGCGGGGGCGG + Intergenic
1198005624 X:132489822-132489844 GCGCGCCGCTGCGGGACGGGCGG + Intronic
1199793937 X:151177842-151177864 GCTAGCCACTGCCGAGCGGGAGG + Intronic
1200003194 X:153072527-153072549 GCGCGCCGCTGCGGCGGCGGCGG - Exonic
1200004529 X:153077482-153077504 GCGCGCCGCTGCGGCGGCGGCGG + Intergenic
1200125939 X:153814984-153815006 GCGCCACACTGAGGAGGCGGAGG + Intronic
1200141870 X:153906508-153906530 GGGCGCCCCTGTGGAGGTGGAGG - Exonic
1201489449 Y:14524786-14524808 GAGCGCCACCGCGGAGTGGAAGG - Intronic