ID: 1100618411

View in Genome Browser
Species Human (GRCh38)
Location 12:96249383-96249405
Sequence CACTGCGGAGGGGGAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618411 2 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510
1100618398_1100618411 26 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510
1100618399_1100618411 25 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG 0: 1
1: 0
2: 4
3: 50
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618411 Original CRISPR CACTGCGGAGGGGGAGGGCC AGG Intronic
900118995 1:1040708-1040730 CAACGCGGAGGGGCCGGGCCGGG + Exonic
900513142 1:3069609-3069631 GGGGGCGGAGGGGGAGGGCCGGG + Intronic
900694090 1:3999566-3999588 CACTGCCGACGGGGCGGGCATGG + Intergenic
900694106 1:3999625-3999647 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694120 1:3999684-3999706 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694151 1:3999802-3999824 CACTGCCGACGGGGCAGGCCTGG + Intergenic
900694165 1:3999861-3999883 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694178 1:3999920-3999942 CACTGCCGACGGGGCGGGCCTGG + Intergenic
900731442 1:4263906-4263928 CAGTGCAGATGGGGTGGGCCGGG + Intergenic
901631470 1:10650107-10650129 CCCTGAGGAGGGGCCGGGCCCGG - Intronic
902415611 1:16237038-16237060 GACTGCTGACGGGGAGGGCTAGG - Exonic
903504760 1:23825487-23825509 CACGGCGGAGGGGCGGGGGCGGG - Intronic
903971668 1:27122849-27122871 CACAGGGGAGAGGGAGGGACAGG + Intronic
904285286 1:29449895-29449917 CCCTGGGGTGGGGGAGGGACAGG + Intergenic
904964353 1:34360323-34360345 GACTCCGGAGAGGGAGGGTCTGG + Intergenic
905025291 1:34845549-34845571 CACTGCTCATGGGGAGAGCCTGG + Intronic
905111188 1:35595654-35595676 CACTGGGGAGAGGCAGGGCCTGG + Intergenic
905351051 1:37346679-37346701 CACTGAGAAGGTGGAGGGACAGG + Intergenic
905365874 1:37451258-37451280 AGCTGCGGAGGGGGAGGGCAGGG + Intergenic
905370412 1:37479941-37479963 CCCCACGGTGGGGGAGGGCCAGG - Intronic
905408776 1:37754171-37754193 CACTGCGGAGGGTGGGGGGTGGG - Intronic
905512028 1:38529459-38529481 CGGTGGGGAGGGGGAGTGCCAGG + Intergenic
905820035 1:40981861-40981883 CTCTGGGGAGGGGGTGGGGCGGG + Intronic
906185383 1:43858584-43858606 CACAGCTCAGGAGGAGGGCCAGG - Intronic
906273658 1:44500720-44500742 CTCTGGGGAGGGGGATGCCCAGG - Intronic
907040123 1:51251436-51251458 CAGTGCAGCGGGGGGGGGCCCGG - Intronic
907461236 1:54607045-54607067 CACTGCAGTGTGGCAGGGCCCGG + Intronic
907761696 1:57367880-57367902 CTCTGAGGAGTGGGAGGCCCAGG - Intronic
908555650 1:65254505-65254527 GACCGCGGCGGGGGAGGGCGCGG + Intronic
908703366 1:66925183-66925205 CACTGCCGTGGGGGAGGGGAAGG - Intronic
910085987 1:83403052-83403074 CATTGCAGAGGTGGAGGGCATGG + Intergenic
910277458 1:85464683-85464705 GCCGGCGGCGGGGGAGGGCCTGG + Intronic
910447270 1:87311450-87311472 CAGTGCCGAGGATGAGGGCCAGG - Intergenic
911052322 1:93681522-93681544 CACCGGGGTGGGGGAGGCCCAGG + Intronic
911233515 1:95384933-95384955 CATTGTGGTGGGGGAGGGTCTGG - Intergenic
913585555 1:120272232-120272254 CAGTGGGGGTGGGGAGGGCCAGG - Intergenic
913622629 1:120626135-120626157 CAGTGGGGGTGGGGAGGGCCAGG + Intergenic
914567561 1:148884091-148884113 CAGTGGGGGTGGGGAGGGCCAGG - Intronic
914605261 1:149246154-149246176 CAGTGGGGGTGGGGAGGGCCAGG + Intergenic
918240552 1:182616468-182616490 CACAGCGGAGGGGGAGGGCTTGG + Intergenic
919854185 1:201694442-201694464 CCCTGGGGAGGGTGAGGGCCGGG + Intronic
920362795 1:205430778-205430800 CACTGCGGAGGGAGGGCGGCTGG - Intronic
920378704 1:205523363-205523385 CAGTGGGGAGGGGGTGGGCGGGG - Intronic
920968102 1:210717995-210718017 TACTGGGGAGGCGGAGGCCCGGG + Intronic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
921646978 1:217630880-217630902 CCCTGGGGAGGGGGAGGTCAGGG - Intronic
922167672 1:223129390-223129412 CGCTGCTGAGGGCCAGGGCCTGG - Intronic
922571051 1:226634922-226634944 CAGTGGGGAGGGCGAGGCCCGGG - Intronic
922675150 1:227544996-227545018 CACTGGGCAGGGGGAGGGTCTGG + Intergenic
1062885348 10:1011820-1011842 CACTGCAGAGGGGAAGAGGCTGG - Intronic
1064143109 10:12806672-12806694 AACTGAGCAGGTGGAGGGCCAGG + Intronic
1065761477 10:28987144-28987166 TTCTGAGGAGGAGGAGGGCCTGG - Intergenic
1066101640 10:32123011-32123033 CTCTGTGGAGTGGGAGGCCCAGG + Intergenic
1067015735 10:42755296-42755318 CACTGCGGCCGGGGACGGCGTGG + Intergenic
1067363226 10:45601011-45601033 CACGGAGGAGGGGGAGGCTCAGG - Intergenic
1067757292 10:49014867-49014889 CATTGAGGAGGGGAAGGGCTGGG - Exonic
1069557527 10:69407767-69407789 CTCTGAGGAGGGGGAGGTCCAGG - Intronic
1069604697 10:69731917-69731939 GCCTGTGGAGGGGGCGGGCCAGG - Intergenic
1069886012 10:71624108-71624130 CAGTGGGCAGGGGGAAGGCCCGG - Intronic
1070162952 10:73876628-73876650 CCCTGGGGAGGGGTAGGGCATGG - Intergenic
1070796759 10:79221450-79221472 TACTGAGGAGGGAGGGGGCCTGG - Intronic
1071630795 10:87216701-87216723 AGCTGCAGAGGGGGAGGGCTTGG - Intergenic
1072190521 10:93073600-93073622 GGCGGCGGTGGGGGAGGGCCAGG - Intronic
1072637285 10:97186100-97186122 GGCTGCGGCGGGGGAGGGCGGGG - Intronic
1073118775 10:101108541-101108563 CCCTGCTGAGGGGGAGGCCAGGG - Intronic
1073137699 10:101228929-101228951 CACTGGGCAGGGCGCGGGCCGGG + Exonic
1073472552 10:103731856-103731878 AAGTGCAGAGGGGGAGGGTCAGG + Intronic
1074156893 10:110807481-110807503 CACCCCTGAGGGGAAGGGCCTGG + Intronic
1074292055 10:112145002-112145024 GACTGCAGAGGGAGGGGGCCAGG + Intergenic
1074911675 10:117915760-117915782 AACTGGGGGGGGGGAGGGCGGGG - Intergenic
1075576328 10:123580386-123580408 CACTGAGCAGGGAGAGGGTCAGG - Intergenic
1075967938 10:126628859-126628881 CACTACAGAGGGGCAGGGGCTGG + Intronic
1076230288 10:128814707-128814729 CCCTGCGTAGGGGCAGAGCCTGG - Intergenic
1076501289 10:130938210-130938232 CACTGGGGCGGCGGAGGGGCCGG - Intergenic
1076542622 10:131223836-131223858 CAGTGGGCAGGGGGAGGGCCAGG - Intronic
1076675527 10:132145742-132145764 CCCTGGGGAGGAGGATGGCCTGG + Intronic
1076895674 10:133310108-133310130 CATGGCGGTGGGGGAGGGCCAGG + Intronic
1077015357 11:396854-396876 CACGGCGGAGCGGGAGGACCAGG - Exonic
1077217738 11:1402078-1402100 TACAGGGGAGAGGGAGGGCCAGG + Intronic
1077225232 11:1436637-1436659 CAGTGGGGAGGGGGCGGCCCCGG + Intronic
1077476185 11:2791638-2791660 CACACCTGACGGGGAGGGCCCGG - Intronic
1077532797 11:3105124-3105146 CTCTGTGGAGGGGGAGGACCAGG - Intronic
1077553474 11:3214611-3214633 CAAAGGGGAGGGAGAGGGCCTGG + Intergenic
1077886277 11:6390364-6390386 CGCTGCGGAGGCGGAGGGGGCGG - Intergenic
1078455548 11:11471886-11471908 TGCTGCTGATGGGGAGGGCCAGG - Intronic
1078741856 11:14073968-14073990 CTCTGTGGAGGGGAAGGGGCAGG - Intronic
1080584092 11:33666009-33666031 CTCCGTGGAGGGGGAAGGCCAGG + Intronic
1081144267 11:39542245-39542267 CACTGGGAAGGGGGTGGGGCAGG + Intergenic
1081673762 11:44956488-44956510 CACTGGGGTGGGGGTGGTCCAGG - Intergenic
1081731028 11:45371799-45371821 CACTGCAGGGGTGGAGTGCCTGG - Intergenic
1083226066 11:61285640-61285662 CACTGAGATGAGGGAGGGCCGGG - Intronic
1083606094 11:63979656-63979678 CACTGCGGTGTGGGAGGCCGGGG + Intronic
1083922514 11:65788212-65788234 CACAGCGGAGGGCCAGGCCCGGG + Intronic
1083953104 11:65967576-65967598 CAGTGATGAGGGTGAGGGCCCGG + Exonic
1083970245 11:66070202-66070224 CAGCGCGGAGGGGCCGGGCCGGG - Intergenic
1084035768 11:66509328-66509350 GGCTGGGGAGGGGGAGGGGCAGG + Exonic
1084589130 11:70079870-70079892 CACAGTGGAGGGGGGTGGCCTGG + Intronic
1084680428 11:70663330-70663352 CCCTGGGGAGGAGGAGGGACGGG + Intronic
1085375919 11:76060834-76060856 CACGGAGGAGGGGGAGGCTCAGG - Intronic
1085574400 11:77589670-77589692 GACTGCGGAGGGTGAGTGCGCGG + Exonic
1087932840 11:103998368-103998390 CTCTGGGGAGGGAGAGGGCCTGG + Intronic
1088573994 11:111252138-111252160 CTCTGGGAAGGAGGAGGGCCTGG - Intergenic
1089402361 11:118171651-118171673 CCCTGCCGTGGGGGAGGGCAGGG + Intronic
1091042215 11:132292404-132292426 CACTGAGGTGGGGGAGGGGCCGG - Intronic
1091131386 11:133149947-133149969 CACTGGGGAGGGGAAGCGTCTGG + Intronic
1091211329 11:133864018-133864040 CACAGTGGCGGGGGAGGGGCGGG + Intergenic
1091259768 11:134224928-134224950 CACGGGGGAGGGGCACGGCCGGG - Exonic
1091387065 12:102395-102417 GACTGCAGAGGAGGATGGCCAGG - Intronic
1091388374 12:109633-109655 CACTGAGGAGGGACAGGGTCCGG - Intronic
1091688310 12:2579105-2579127 GGCTGCAGAGGGAGAGGGCCAGG - Intronic
1091917014 12:4277006-4277028 CAGTGAGGAGGGGGAGGGGCGGG - Intronic
1092123031 12:6057741-6057763 CACCGCGGAGGGCGGGGGCGGGG - Intronic
1092521852 12:9283924-9283946 CATTCCGGAAGTGGAGGGCCGGG + Intergenic
1092545429 12:9447932-9447954 CATTCCGGAGGTGGAGGGCTGGG - Intergenic
1093561785 12:20551661-20551683 CACTGCTGAGGGGCGGGTCCAGG - Intronic
1094507522 12:31074119-31074141 CATTCCGGAAGTGGAGGGCCGGG + Intronic
1094832496 12:34306787-34306809 CACTGCAGAGGAGGGGGGCCTGG + Intergenic
1094833902 12:34313344-34313366 CATGGCAGAGGAGGAGGGCCTGG - Intergenic
1094835564 12:34320499-34320521 CACGGCAGAGGAGGGGGGCCTGG - Intergenic
1096117511 12:49063857-49063879 CACTGGGGACATGGAGGGCCAGG + Intergenic
1096785006 12:54011940-54011962 CCCTGGGGAGGGGGAGGGGGAGG - Exonic
1096817285 12:54209562-54209584 TACTGGGGAGGGGGAGGACATGG + Intergenic
1097733080 12:63151267-63151289 CACTGTGGAGGGGGTGGAGCTGG + Intergenic
1100167263 12:91929882-91929904 CAGTGGGGAGGGCCAGGGCCAGG + Intergenic
1100618411 12:96249383-96249405 CACTGCGGAGGGGGAGGGCCAGG + Intronic
1100982553 12:100172949-100172971 GGCTGCTGAGGGGGAGGGGCTGG + Intergenic
1101479577 12:105084315-105084337 GACTCCGGGGCGGGAGGGCCGGG - Intronic
1101493843 12:105235790-105235812 GGCTGAGGAGGGGGCGGGCCGGG - Intronic
1101606048 12:106248150-106248172 GACCCCGGAGAGGGAGGGCCGGG + Intronic
1101753891 12:107606087-107606109 CATGGTGGAGGGAGAGGGCCAGG + Intronic
1101764088 12:107682572-107682594 CTCTGCGGAGCAGGAGGCCCAGG + Intergenic
1102038683 12:109786836-109786858 CACTGCGGGGAGGGAGGGTCAGG + Exonic
1102240959 12:111324418-111324440 CACTGGGCAGGGAGGGGGCCAGG + Intronic
1102542848 12:113634939-113634961 AACTGAGGAGGGGGTGGGCTGGG + Intergenic
1103343017 12:120231075-120231097 CAGTGCGGAGGAGGGGAGCCAGG + Intronic
1103492323 12:121331709-121331731 CACTGCTGAGGGGAAGGGCAAGG + Intronic
1103606288 12:122088175-122088197 GACAGCAGAGGGGGAGGGGCAGG - Intronic
1103856306 12:123973069-123973091 CGCTGGGGTGGGGGATGGCCGGG + Intronic
1104331945 12:127855228-127855250 CACTTTGGAGGGGAAGGGCATGG + Intergenic
1104957888 12:132475009-132475031 CACCGCGGAGGAGGGGGGCGGGG - Intergenic
1104958051 12:132475380-132475402 CACCGCGGAGGGAGGGGGCGGGG - Intergenic
1104958062 12:132475404-132475426 CACCGCGGAGGAGGGGGGCGGGG - Intergenic
1105441051 13:20415524-20415546 CACCGGCGAGGGCGAGGGCCAGG + Intronic
1106523860 13:30522523-30522545 AACTGGGGAGGGGGAGGACTGGG + Intronic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1107149091 13:37091195-37091217 CTCTGAGCAGGGGCAGGGCCAGG + Intergenic
1107814957 13:44236480-44236502 CAGTGCGGAGGAGGAGGGATGGG - Intergenic
1108691481 13:52862964-52862986 CCCTGGGGAGGGGCAAGGCCTGG + Intergenic
1109112835 13:58344922-58344944 CACTGGGGGTGGGGAGGGCAAGG - Intergenic
1111586320 13:90288531-90288553 CACTGAGGAGGGACAGAGCCTGG + Intergenic
1111625096 13:90774781-90774803 CAGTGTGGAGGGTGAGGTCCTGG - Intergenic
1112336622 13:98522138-98522160 CCCAGAGGAGGGGGAGGGCGTGG - Intronic
1112435465 13:99388697-99388719 CAGTGGGGAAGGGGAGAGCCAGG + Intergenic
1113335041 13:109369666-109369688 CACTCGGGAGGTGGAGGGCGGGG - Intergenic
1113552646 13:111205031-111205053 CACTCCAGAGGGGCAGGGGCGGG + Intronic
1113618230 13:111695877-111695899 CACAAAGGAGGGAGAGGGCCTGG - Intergenic
1113623761 13:111781138-111781160 CACAAAGGAGGGAGAGGGCCTGG - Intergenic
1113744617 13:112734912-112734934 GACTGGTGAGGGGGAGTGCCAGG + Intronic
1115027357 14:28760338-28760360 GACTCCGGAGAGTGAGGGCCAGG + Intergenic
1116938618 14:50768605-50768627 CAGTGGGGTGGGGGAGGGCATGG + Intronic
1117338643 14:54775664-54775686 CACTGGGCAGGGGTGGGGCCTGG - Intronic
1118797038 14:69153052-69153074 CGCAGCGCGGGGGGAGGGCCGGG - Exonic
1119199562 14:72742522-72742544 CACGGCAGAGGGGGAAGGCTGGG + Intronic
1119492856 14:75051475-75051497 CGCTTCGGAGGGGGCGCGCCAGG + Exonic
1119543135 14:75453429-75453451 TACTGCGGAGAGGGAGGAGCAGG - Intronic
1119939374 14:78624501-78624523 CACTGCACAGGGGCGGGGCCAGG + Intronic
1120852754 14:89186178-89186200 CACTGGGGAGGGGGCTGGCACGG + Intronic
1121243012 14:92443315-92443337 CACTGCGGGGGGAGGAGGCCTGG + Intronic
1121325976 14:93019795-93019817 CACTGTGCAGGGGGATGCCCGGG + Intronic
1122130959 14:99604342-99604364 CACCGCGCAGGGGGACGGCGGGG - Intergenic
1122389045 14:101367906-101367928 CAGTGCGGAGGGGGAGGTAGGGG - Intergenic
1122885996 14:104710681-104710703 CACTGGGCAGGGAGAGGGACAGG + Intronic
1122887089 14:104714911-104714933 CAATGGGGAAGGGGAGGGACCGG - Intronic
1122941764 14:104984721-104984743 CTCTGGGTAAGGGGAGGGCCTGG - Intergenic
1123066313 14:105621190-105621212 CACTGGGGAGAGAAAGGGCCAGG - Intergenic
1123762999 15:23446922-23446944 GACTGCTGAGGGGGTGGGGCTGG + Intronic
1124422087 15:29531399-29531421 GACTGGTGTGGGGGAGGGCCAGG + Intronic
1124650352 15:31469414-31469436 CTCTGTGGAGCAGGAGGGCCAGG + Intergenic
1124655359 15:31502816-31502838 CACAGGGAAGGGGGTGGGCCAGG + Intronic
1125603676 15:40928550-40928572 CCCTGAGGTGGGGGAGGGCGGGG - Intergenic
1126775929 15:52100533-52100555 CAGAGAGGAGAGGGAGGGCCTGG + Intergenic
1127068457 15:55264745-55264767 CACTGAGGAGGGAGAGAGCCTGG + Intronic
1127417593 15:58771998-58772020 CCCTGAGGAGGAGGAGGGCGCGG + Exonic
1127438987 15:58987524-58987546 CAGTACAAAGGGGGAGGGCCGGG + Intronic
1127634151 15:60853100-60853122 CAGGGCGGAGGGGGAGAACCAGG + Intronic
1127980755 15:64033250-64033272 CCCTGGGGAGGGGGAGGGGGAGG + Intronic
1128737863 15:70063480-70063502 GCCTGGGTAGGGGGAGGGCCAGG + Intronic
1129182670 15:73886962-73886984 CTCTGGGGAAGGGGAAGGCCAGG - Intronic
1129901474 15:79154450-79154472 AAGTGTGGAGGGGGAGGGCAAGG - Intergenic
1130912800 15:88282615-88282637 CACTGGGGAGGGGGAGGGGAGGG - Intergenic
1130957629 15:88638770-88638792 ATCTGAGGAGGGGGAGGGCCGGG + Exonic
1131051501 15:89351252-89351274 CACTGCTGAGGGGAAGGACCAGG + Intergenic
1131423455 15:92326427-92326449 CCCAGGGGAGGGGGAGGGGCCGG + Intergenic
1132390770 15:101436676-101436698 CAGTGTGGAGGGAGAGGCCCAGG - Intronic
1132833488 16:1941225-1941247 CACAGGGGTGGGGGAGGGACGGG - Intronic
1132932962 16:2468107-2468129 CTCGGCGGAGGCGAAGGGCCGGG + Intergenic
1136482117 16:30548576-30548598 CACTGCACAGGGGGAGGTCATGG - Intronic
1136556693 16:31011184-31011206 CACCGCGGCGGGAGAGGCCCAGG - Intergenic
1138186476 16:54981577-54981599 AACTTGGGAGGGAGAGGGCCTGG - Intergenic
1138529763 16:57628613-57628635 TAGTGCGGAGAGGGAGGGACCGG - Intronic
1138912102 16:61413323-61413345 CACAGCAGATGGGGAGGCCCTGG + Intergenic
1139861238 16:70023343-70023365 CACTGCGGAGGGAGTGGGTGTGG - Intergenic
1139917414 16:70437321-70437343 CACAGCCAAGGGGGAGGGCTGGG + Intronic
1139962399 16:70725492-70725514 CACTGAGGGGGTGGGGGGCCGGG - Intronic
1140477226 16:75245092-75245114 CACAGAGGAGCGGGAGGGCGGGG + Intronic
1140784418 16:78326573-78326595 CATTGCGGGGGGGGGGGGCGGGG - Intronic
1141526991 16:84618075-84618097 CACTGCGGACGGAGAGCGCGCGG + Exonic
1142057491 16:88007440-88007462 CACTGGGCAGGCCGAGGGCCAGG - Intronic
1142191907 16:88722008-88722030 GTTTGCGGAGGGGCAGGGCCGGG - Exonic
1142211908 16:88812384-88812406 CAGGGCGGAGGCGGCGGGCCTGG + Intergenic
1142232786 16:88907583-88907605 GGCTGAGGAGGGGGAGAGCCAGG + Intronic
1142312295 16:89321094-89321116 GTGTGCGGAGGGGGAGGGCGCGG - Intronic
1142381110 16:89732748-89732770 CACAGCAGAGGGCGAGGGCATGG - Intronic
1142475591 17:187223-187245 CAGTGTGGAGGGAGAGAGCCTGG - Intergenic
1142501338 17:334867-334889 CACTGCGGAGGGACAGGGACAGG + Intronic
1142669788 17:1482810-1482832 CAGTGCGGGAGGGGAGGGGCAGG - Intronic
1142763440 17:2053946-2053968 CACCGCGGAGCGCGAGGGGCTGG - Intergenic
1143025196 17:3937483-3937505 GGCTGCGGTGGAGGAGGGCCGGG - Exonic
1143479611 17:7220745-7220767 CACTGCAGAGGGTGGGGGACAGG - Exonic
1143904684 17:10198901-10198923 CACTGGCGAGGGGGCGGGCCGGG + Intergenic
1144769606 17:17752324-17752346 CACTGCGGAGGGGCGGGGCGGGG + Intronic
1145034776 17:19533549-19533571 CCCAGCGGAGGTGGAGAGCCGGG + Intronic
1145962968 17:28897965-28897987 CAGTGAGTAGGAGGAGGGCCTGG - Exonic
1146187245 17:30731901-30731923 CACGGCGGTGGGGGAGGGGGCGG + Intergenic
1146332287 17:31937262-31937284 CACGGCGGTGGGGGAGGGGGCGG + Exonic
1146379130 17:32315512-32315534 TACTGGAGAGGGGGTGGGCCAGG - Intronic
1147334062 17:39716293-39716315 CACTGCAGTGGGCGAGGGCCTGG + Exonic
1147420402 17:40319570-40319592 AACTGAGGAGGGGGAGTGTCAGG - Intronic
1148052496 17:44776014-44776036 CCCTGGGGAGCTGGAGGGCCCGG + Intronic
1148054965 17:44788480-44788502 CGCTGCTGAGGGGGATGGACAGG - Intergenic
1148142380 17:45338070-45338092 AACTGCACAGGGGGAGGGCCTGG + Intergenic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148221407 17:45864974-45864996 AACTGCAGAGGGCGAGGGGCAGG + Intergenic
1148225260 17:45894750-45894772 GTCTGCGGAGAGGGAGGGCGAGG - Intronic
1148785315 17:50143506-50143528 CACTGAGCAGGGGGTGGGGCGGG - Intronic
1148864934 17:50623588-50623610 CACTGTGGTGGTGGAGGGGCGGG - Intronic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1149995883 17:61405708-61405730 AACGGCGGAGGTGGCGGGCCTGG + Exonic
1150211975 17:63446555-63446577 GCCTGCGGGGGTGGAGGGCCGGG + Intergenic
1150283691 17:63943902-63943924 CACTGAGGTGGGGGTGGTCCTGG - Intronic
1151208963 17:72529459-72529481 CACTGGGGAAAGGGAGGCCCAGG + Intergenic
1151554412 17:74839362-74839384 CACTGCAGAGGGGCAGTGGCTGG + Exonic
1151966186 17:77433024-77433046 CACAGCGGGAGGGGAGGGGCAGG - Intronic
1152362440 17:79838982-79839004 CGCGGCGGAGGGCGGGGGCCCGG - Intronic
1152586815 17:81192964-81192986 GACTGCCGAGGGGGAGGGGCAGG - Intronic
1152679187 17:81656892-81656914 CACAGCAGCGGGTGAGGGCCAGG - Intronic
1152724827 17:81940034-81940056 CACAGTGGACGGGGAGGACCTGG - Exonic
1152753500 17:82077465-82077487 CCCTGCTGGGGGGGTGGGCCTGG - Intergenic
1152814610 17:82400037-82400059 CCTTGCCCAGGGGGAGGGCCCGG - Intronic
1152926371 17:83089591-83089613 CTCCTCGGAGGGGGAGGGCTGGG - Intronic
1153634727 18:7103874-7103896 CGCTGGGGAGGGGCAGGGGCTGG - Intronic
1155229304 18:23757442-23757464 GACTGGGGAGGAGGAGGGGCTGG - Intronic
1155428983 18:25735874-25735896 CACTGCGGAGGGTGAGGATGGGG - Intergenic
1155806268 18:30175208-30175230 CACGGCGGTGGGGGAGGCTCAGG + Intergenic
1156452383 18:37274196-37274218 CACTCTGGAGGGAGAGGGCAAGG + Intronic
1157595166 18:48859814-48859836 GAGTGAGGAAGGGGAGGGCCAGG - Exonic
1159952158 18:74492572-74492594 CAGTGCCCAAGGGGAGGGCCAGG + Intergenic
1160015840 18:75139753-75139775 CACAGCGTGGGAGGAGGGCCCGG - Intergenic
1160228170 18:77027444-77027466 CCCTGGGCAGGGGCAGGGCCAGG + Intronic
1160564658 18:79779684-79779706 CACGGCGGAGGCTGAGGCCCCGG - Intergenic
1160679993 19:408163-408185 CCCCGCGGAGGGCGAGGGACAGG - Exonic
1160808224 19:1001686-1001708 CCCTGAGGAGAGGGAGGGGCTGG - Intronic
1160904728 19:1446718-1446740 CCCTGCGCAGGGTGGGGGCCTGG + Intronic
1160947202 19:1649140-1649162 CACTGCGGAGCAGGCAGGCCCGG - Intronic
1161169546 19:2805981-2806003 CACTGCGGGGGGTGGGGGACGGG + Intronic
1161555789 19:4941890-4941912 CACTGCTGAGGGGCGGGTCCAGG - Exonic
1161644498 19:5444714-5444736 CAGGGAGGAGGGGGAGGGCAGGG - Intergenic
1161950875 19:7467193-7467215 GCCTGCGGAGGGCCAGGGCCAGG - Exonic
1163018413 19:14470554-14470576 GACTGGGGAGAGGGAGGCCCGGG - Exonic
1163320419 19:16571648-16571670 CACGGCGGGATGGGAGGGCCTGG + Intronic
1163395097 19:17055515-17055537 CTCTGCTGAGGGGGAAAGCCGGG + Intronic
1163455469 19:17403655-17403677 CAGTGAGGAGGGGGCGGCCCCGG - Intronic
1163463855 19:17455135-17455157 CACTCCGGAGGTGGAGAGCTGGG - Intronic
1163509709 19:17727357-17727379 CACTGCGGGGCGGGGAGGCCGGG + Exonic
1163672449 19:18636946-18636968 GTCTGCGGAGGGGCGGGGCCGGG - Exonic
1163739699 19:19003885-19003907 AACTGTGGAGGGGATGGGCCTGG - Intronic
1164578253 19:29418609-29418631 CACTGTGGAGGGGAGGGGCCCGG + Intergenic
1164698464 19:30264366-30264388 AACTGCGGGGGGCGGGGGCCTGG - Intronic
1165141247 19:33701192-33701214 CACTGCTAAGGGGAACGGCCTGG - Intronic
1165141603 19:33703217-33703239 CAGGGCCAAGGGGGAGGGCCTGG + Intronic
1165729663 19:38136806-38136828 CACTGGGGAAGGCGAGAGCCGGG + Intronic
1165940090 19:39410540-39410562 CAATGGGGAGTGGGAGGGCAAGG - Intergenic
1166116264 19:40656877-40656899 CTCTGAGGAGGGGGTGGGCTGGG - Intergenic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166712447 19:44945926-44945948 AACTGCGGAGGGGGTGGGTGGGG - Intronic
1167321741 19:48800865-48800887 CACTGCAGAGTGGAAGAGCCTGG + Intronic
1167386287 19:49166067-49166089 CACTGCGGGGTGGGCGGTCCGGG - Exonic
1167793105 19:51692710-51692732 CAGGGATGAGGGGGAGGGCCGGG - Intergenic
1167851830 19:52208086-52208108 CACTGCTGAGAGCAAGGGCCGGG - Intronic
1168298082 19:55387559-55387581 CACTGCTGTGGGGATGGGCCTGG + Intronic
925066330 2:931724-931746 CATTGCGGAGGGAGAGGCCTGGG + Intergenic
925117130 2:1389126-1389148 CACTCAGGAGGGGCAGGGCCTGG + Intronic
926162608 2:10499415-10499437 CACTGTGCGGGGGGAGGGCTGGG + Intergenic
926340761 2:11902737-11902759 CACTGGGGAGAAGGAGGGCCAGG - Intergenic
927055919 2:19365416-19365438 CACTGAGGAAAGGGAGGGCCGGG + Intergenic
927576099 2:24203199-24203221 CACTCAGGAGGGGAAGGGTCAGG - Exonic
928094115 2:28393560-28393582 CACCGCGGAGGGCGAGGACAGGG - Exonic
929604665 2:43226554-43226576 CTCCGCGGGGGGGGCGGGCCGGG - Exonic
929818963 2:45258348-45258370 CACTGGGGAGTGGGTGGTCCGGG - Intergenic
931376635 2:61713858-61713880 CAGTGGGGATGGGGAGGGACAGG - Intergenic
932337503 2:70939285-70939307 CAATGGAGAGGGGGTGGGCCGGG + Intronic
933712132 2:85334503-85334525 CACGGAGGTGGGGGAGGCCCAGG + Intergenic
933727598 2:85435563-85435585 CAGTGGGGAGCAGGAGGGCCAGG + Intronic
935082144 2:99808547-99808569 CTCAGAGGAGGGGGAGGGGCAGG - Intronic
935446899 2:103166611-103166633 CTCTGCGGAGGGGAAGGGCCTGG + Intergenic
935625618 2:105169955-105169977 CAATGGGGAGGGAGAGGGACAGG + Intergenic
935676737 2:105600812-105600834 CACTTCGAAGGAGGAGGGGCTGG + Intergenic
935845602 2:107162856-107162878 GACTGCTGAGGGGCAGAGCCTGG + Intergenic
937345214 2:121121161-121121183 GACTGTGGAAGGGGAGGGCAGGG + Intergenic
937436332 2:121884864-121884886 CTCTGCAGAGGCGGAGGCCCTGG + Intergenic
938128304 2:128690327-128690349 CACTGAGGGGGTGGAAGGCCAGG - Intergenic
938390277 2:130899467-130899489 GACTGGGAAGGGGGATGGCCCGG + Intronic
938725998 2:134109436-134109458 CACAGAGGAGGGGGAGGCTCAGG + Intergenic
939969822 2:148645710-148645732 CACTGCGGCGGGGGAGGGCGGGG + Intronic
941178950 2:162235185-162235207 CATGGCGGAGGGGGAGGGGCAGG - Intronic
946379447 2:219335327-219335349 CACTGTGGAGGGGGAGCCCCTGG - Intergenic
946622115 2:221572331-221572353 CATTGCCAAGGGGGCGGGCCCGG + Intronic
947027458 2:225752689-225752711 CACTGAGCAGGGGAAGGGACAGG - Intergenic
947279084 2:228428213-228428235 CACTGAGGAGGGGCAGGCCATGG - Intergenic
947294412 2:228614957-228614979 CATTGGAGAGGAGGAGGGCCAGG - Intergenic
947593034 2:231395860-231395882 CACGGAGGAGGGGGAGCCCCGGG - Intronic
947872478 2:233447121-233447143 CACCGCGGCGGGGGAGGGAACGG - Intronic
948421027 2:237859906-237859928 CACAGGGGAGGCGGAGGGCGCGG + Intronic
948870040 2:240793165-240793187 CACAGCGGAGGCTGGGGGCCTGG + Intronic
948914924 2:241029791-241029813 TAGAGCGGAGGGGGATGGCCAGG - Intronic
1169065898 20:2693909-2693931 CACTCCGGACGGGGTGGGCCGGG - Intronic
1170674544 20:18467112-18467134 CCCTGCGGAGCGGCAGGGGCCGG - Exonic
1170688110 20:18587718-18587740 CACTGGGTAGGGGCTGGGCCCGG + Intronic
1171361679 20:24590475-24590497 CAGGGCGGAGGGGGAGGCGCAGG + Intronic
1171442508 20:25176663-25176685 CTCTCCAGAGGGAGAGGGCCAGG + Intergenic
1171442667 20:25177882-25177904 CTCTCCAGAGGGAGAGGGCCAGG + Intergenic
1171972577 20:31573303-31573325 CGCAGGGGAGGGGGCGGGCCCGG + Intronic
1172294271 20:33797337-33797359 CACTGGAAAGGGGGAGGGCAAGG + Intergenic
1172620732 20:36316701-36316723 CACTGCTGAAGGGGACGGGCTGG - Intronic
1173454168 20:43190010-43190032 CACGGCCGAGGCGGAGCGCCCGG - Intergenic
1173495122 20:43513262-43513284 GACTGGGGAGGTGCAGGGCCTGG + Intronic
1173569261 20:44066179-44066201 CACTGGTGAGTGGCAGGGCCAGG - Intronic
1173606812 20:44337432-44337454 CACTGCGGGGGGTGGGGGGCAGG - Intronic
1173666350 20:44766072-44766094 CACTGTGGTGGGGGAGGGACAGG + Intronic
1175217581 20:57399711-57399733 GACTTGTGAGGGGGAGGGCCGGG - Intronic
1175390699 20:58625631-58625653 GGCTGCAGAGGGGGAGGGCAGGG - Intergenic
1175846676 20:62063438-62063460 CACGGCGGCTGGGGAGGGACGGG + Intronic
1175891846 20:62319190-62319212 CACTGCAGGAGGTGAGGGCCGGG - Intronic
1175939640 20:62532100-62532122 CACTGCAGAGAGCGAGGCCCTGG - Intergenic
1175968028 20:62669347-62669369 CACTGTGGAGGGGCAGTCCCAGG - Intronic
1176036943 20:63044159-63044181 CACTGCGGACCGGGAATGCCAGG + Intergenic
1176093944 20:63331021-63331043 CAGTGGGGAAGGGGAGGGGCTGG + Intronic
1176707239 21:10125640-10125662 CACTGCGGAGAAGCGGGGCCTGG + Intergenic
1178673664 21:34614036-34614058 CACTTTGGAGGGTGAGGGGCAGG - Intronic
1178975359 21:37216685-37216707 CACTGCGGACGCGGAGGGGGCGG - Intergenic
1179224986 21:39445456-39445478 CGCTGGGCAGGGGGACGGCCTGG - Exonic
1179289508 21:40006237-40006259 GCCTGGGGAGAGGGAGGGCCTGG + Intergenic
1179660144 21:42869083-42869105 CAGAGAGGAGGAGGAGGGCCTGG + Intronic
1179801098 21:43811806-43811828 CAGTGCGAAGGGGGAAGGCAGGG + Intergenic
1179990944 21:44947989-44948011 CACTGCGTTGGGGGAGGCTCAGG - Intronic
1180181900 21:46121793-46121815 CACTGCTGAAGAGGAGAGCCAGG - Intronic
1180188609 21:46152175-46152197 CTCTGAGGAGGGGGTGGGCAGGG - Intronic
1180939042 22:19644932-19644954 CCCTGGGGAGGGAGAGGTCCAGG - Intergenic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1181038546 22:20181425-20181447 CAGTGGGGAGGGGCAGGGCAGGG + Intergenic
1181440747 22:22934122-22934144 CTCTGCAGAGGGGCAGGGGCAGG + Intergenic
1181539471 22:23565796-23565818 GCCTGCGGAAGGGGAGGGACAGG - Intergenic
1182086005 22:27561593-27561615 CCATGAGGATGGGGAGGGCCTGG + Intergenic
1182656622 22:31895418-31895440 CACTGCGATGGGGGATGGTCAGG - Intronic
1183291148 22:37002709-37002731 CACTGCGGAGAGTGAGGGGGAGG - Intronic
1183475453 22:38033639-38033661 CCCGGCGGAGCGGGAGGGACTGG + Intronic
1183607130 22:38872362-38872384 CCCGGGGGAGGGGGAGGTCCTGG - Intergenic
1184192137 22:42901917-42901939 CACCACGGAGAGGAAGGGCCAGG - Intronic
1184465939 22:44668883-44668905 CCCTGCGGAAGGGGGGGCCCCGG + Intronic
1184593815 22:45502715-45502737 CACGGCTGGGGGCGAGGGCCTGG - Intronic
1184615945 22:45639010-45639032 CATGGCGGACGGGTAGGGCCAGG + Intergenic
1184680698 22:46071076-46071098 CAGGGCGGCGGGGGCGGGCCGGG + Intronic
1185049391 22:48545932-48545954 CCCTGGGGAAGGGGAGTGCCAGG + Intronic
1185055397 22:48576245-48576267 CGCCGCGGAGGGGGCGGGCGGGG - Intronic
1185346250 22:50312077-50312099 CACTGGGGAGTGGGAGGCTCAGG + Exonic
950715024 3:14841879-14841901 GACTGCAGAGGGCCAGGGCCTGG - Intronic
950729894 3:14947941-14947963 GGCGGCGGAGGGGGCGGGCCTGG + Intronic
950888327 3:16380433-16380455 CAGTGAGGAAGGGGAGGGCTAGG - Intronic
951652040 3:24961613-24961635 CACTGTGGGGAGGGAGGGCGGGG + Intergenic
952908970 3:38165958-38165980 CGCTGCGGAGGGGGGAGGCGCGG + Intronic
953019904 3:39106916-39106938 TAGTGGGGAGCGGGAGGGCCGGG - Intronic
953656932 3:44861767-44861789 CGCCTCGGAGGGGGCGGGCCAGG - Intronic
954200869 3:49022325-49022347 CCCTGCGGAGGGAAAGGGTCAGG - Exonic
954373807 3:50183902-50183924 AGCTGGGGAGGGGCAGGGCCAGG + Intronic
954614169 3:51961073-51961095 CAGTGGGGAGGGGCTGGGCCTGG - Intronic
954715583 3:52525168-52525190 GGCTGCAGTGGGGGAGGGCCAGG - Intronic
954753649 3:52827460-52827482 GGCTGCAGAGGGGCAGGGCCGGG + Intronic
955803558 3:62710271-62710293 AACTGGGGTGGGGGAGGGGCAGG + Intronic
958418564 3:93906409-93906431 CTCTGTGGAGTGGGAGGCCCTGG - Intronic
959988942 3:112609088-112609110 CACTGGGCAGGGGCAGGGGCAGG - Intronic
961336279 3:126181407-126181429 CACTGAGCAGAGAGAGGGCCAGG - Intronic
961430907 3:126882253-126882275 CAAGGCGGAGAGGGAGGTCCAGG - Intronic
961688836 3:128653669-128653691 CACGGAGGAGGGGGAGGCTCAGG - Intronic
961791277 3:129378457-129378479 CTCTGTGGAGTGGGAGGCCCAGG + Intergenic
962200900 3:133400308-133400330 CACTGCTGATGCCGAGGGCCCGG - Exonic
962400973 3:135058399-135058421 TCCTGGGGAGGAGGAGGGCCAGG + Intronic
962405156 3:135094292-135094314 GACTGGGAAGGGGCAGGGCCTGG - Intronic
962977162 3:140455919-140455941 CCCTGCTGAGGGGGAGCGGCAGG - Intronic
963001768 3:140688190-140688212 CACGGGGTAGGGGGAGGGCAGGG - Exonic
964811188 3:160666429-160666451 CACTGCAGTGGGGGAGGGGATGG - Intergenic
965515744 3:169619422-169619444 CACCCAGGAGGGGAAGGGCCAGG - Intronic
966413637 3:179667589-179667611 CACTGCAGCTGGGGAAGGCCAGG - Intronic
966868993 3:184277863-184277885 AACTGCTGAGGGGGAGTCCCTGG - Intronic
968221600 3:196943896-196943918 TACTGCCTAGGGGCAGGGCCTGG + Intergenic
968230193 3:197001315-197001337 TACTGAGGTGGGGGTGGGCCCGG - Intronic
968652041 4:1763981-1764003 GACTGTGGAGGTGGATGGCCCGG - Intergenic
968753310 4:2401541-2401563 GAAGGAGGAGGGGGAGGGCCTGG - Intronic
969022460 4:4147481-4147503 CACTGGGGGGGGGGGGGGGCGGG - Intergenic
969514554 4:7639087-7639109 GGCTGTGGAGGGAGAGGGCCTGG + Intronic
969623625 4:8291486-8291508 CACTGCCCAGCGGGAGGGCAGGG + Exonic
969686392 4:8676852-8676874 CACTGCGGAGCTCAAGGGCCTGG - Intergenic
971301149 4:25443249-25443271 CACTGTGGAGGGGGCGGGGGAGG + Intergenic
972278953 4:37585133-37585155 AATTGTGGAGGGGGAGGGTCAGG + Intronic
972291971 4:37697974-37697996 CAGTGGGCAGGGGGAGGGCAGGG - Intergenic
972562881 4:40244008-40244030 TAATGGGGAGAGGGAGGGCCGGG + Exonic
973374188 4:49276442-49276464 CACCGCGGAGAGGTGGGGCCTGG + Intergenic
973383224 4:49333797-49333819 CACCGCGGAGAGGTGGGGCCTGG - Intergenic
974021827 4:56698400-56698422 GAGTGAGGAGGGGGAGGGGCAGG - Intergenic
974626543 4:64433316-64433338 GGCTGGGGAGGGGGAGGGGCAGG + Intergenic
975870900 4:78776787-78776809 CAGTCCGGAGGGCGAGGACCCGG - Intronic
980115240 4:128672890-128672912 CACTGTGGCGGGGGAGGCTCAGG - Intergenic
981064254 4:140464533-140464555 TAATGAGGAGGGGGAGAGCCTGG - Intronic
981323048 4:143414975-143414997 CCCTGCGGAGGGGGAGGGGTGGG - Intronic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
985773930 5:1830759-1830781 CACTGGGGAGGAGGAGGGGGAGG - Intergenic
985791606 5:1931182-1931204 CACGGCGGAGGGAGAGGCCCGGG - Intergenic
986200189 5:5572506-5572528 CACTGGGGAGGGCGGGGGCTGGG - Intergenic
986228182 5:5836625-5836647 CACTGGGGAGCAGGAGAGCCTGG - Intergenic
986330809 5:6714614-6714636 CTCAGCGGAGGGGGCGGCCCCGG + Exonic
986608551 5:9545931-9545953 CACGGGGAAGGTGGAGGGCCGGG + Exonic
991042366 5:62189170-62189192 CTCTGTGGAGGGGCAGGGCTGGG + Intergenic
991216904 5:64166022-64166044 CACCGCGGCTGGGTAGGGCCCGG - Intronic
991994442 5:72373630-72373652 CATTGCGGAGGGGGAGGAGCTGG - Intergenic
992474000 5:77084657-77084679 CACTGGGGAAGGGGTGGGCATGG + Intronic
992993119 5:82305585-82305607 CTCTGCGGAGGTAGGGGGCCGGG + Intronic
993529158 5:89003712-89003734 CACGGAGGAGGGGGAGGCTCAGG + Intergenic
996789918 5:127281730-127281752 CACTGCTGAAGGGCAGGGCATGG + Intergenic
997584080 5:135034412-135034434 GGCTGCGGAGGGGGAGGGCGCGG - Intronic
997697322 5:135871868-135871890 GACTGAGGTGGGAGAGGGCCGGG - Intronic
997791095 5:136763097-136763119 CACTGAGGAGGGGAAGACCCAGG + Intergenic
998108084 5:139481284-139481306 CACGGCGGAGGGGGCAGCCCAGG + Exonic
998314914 5:141174230-141174252 CACTGCCGATGGGCAGGGCGGGG - Exonic
1001564033 5:172688116-172688138 CACGGCTGAGGGGGTGGGGCAGG - Exonic
1002098899 5:176847814-176847836 CACGGGGGGAGGGGAGGGCCAGG - Intronic
1002283276 5:178145919-178145941 CACTGGGGAGGTGGAGGTCCAGG - Intronic
1002474689 5:179457810-179457832 CGCTGCTGAGAGGGAGGGCCCGG + Intergenic
1002498882 5:179634485-179634507 CACCGCGGAGGAGGCGGCCCTGG - Intronic
1002502794 5:179658039-179658061 CACCGCGGAGGAGGCGGCCCTGG + Intergenic
1003099039 6:3163121-3163143 CGCGGCGCAGGGGGAGGGCGGGG + Intergenic
1003425720 6:5997141-5997163 CGCTGCGGGGAGGGTGGGCCCGG - Intergenic
1003717632 6:8665868-8665890 CACGGAGGAGGGGGAGGCTCAGG + Intergenic
1003717735 6:8666240-8666262 CACGGAGGAGGGGGAGGCTCAGG - Intergenic
1003736929 6:8887437-8887459 CACGGAGGAGGGGGAGGCTCAGG - Intergenic
1004044329 6:12011489-12011511 CACGGCGGGGGCGGAGGGGCGGG - Intronic
1004114034 6:12749548-12749570 CACGGGGGAGGGGGAGGGGAAGG - Intronic
1004241276 6:13924821-13924843 GACTGCTGAGGGGAAGGGCCGGG + Intronic
1006030390 6:31173149-31173171 CTCAGAGGAGGGGGAGGGGCAGG + Intronic
1006417779 6:33914938-33914960 CACTGTGGAGGGGCAGGGAGAGG - Intergenic
1006458774 6:34146027-34146049 CACCCCAGAGGGGGAGGGTCAGG + Exonic
1007078670 6:39083755-39083777 CACTGCAGAGGTCGAGGGCAGGG + Intronic
1007134312 6:39506910-39506932 CAGTGTGCAGAGGGAGGGCCTGG + Intronic
1007317287 6:40999652-40999674 CACTGTGGAAAGGCAGGGCCTGG + Intergenic
1008052591 6:46915341-46915363 CACTGTGCAGGAGCAGGGCCTGG + Intronic
1010161100 6:72856879-72856901 CACGGGGGAGGGGCAGGGTCTGG - Intronic
1013117751 6:107115385-107115407 CCCCGCTGAGGGGGAGGGGCGGG - Intergenic
1013350367 6:109300301-109300323 CCCTCCGGAGGAGGAGTGCCTGG - Intergenic
1015999455 6:139028780-139028802 CACTGGGGAGGGTGAGGCCAAGG - Exonic
1016335786 6:143003425-143003447 CACTGAGGAGGGGCAGGGGTGGG + Intergenic
1016978635 6:149833319-149833341 GACAGCAGAGGGGGAGGGCAGGG + Intronic
1018613829 6:165666644-165666666 GACTGCGGGGGTGGGGGGCCGGG - Intronic
1018650127 6:165986257-165986279 CTCTCCGAGGGGGGAGGGCCAGG - Intronic
1019623495 7:2003738-2003760 CACTGCCCTGGGGGAGGCCCTGG + Intronic
1019735501 7:2648087-2648109 CAAAGCGGAGGGGCAGGGCAAGG + Intronic
1019925794 7:4191192-4191214 GACTGCGGCGGGGGAGGGCCTGG - Intronic
1019925813 7:4191237-4191259 GACCGCGGCGGGGGAGGGCCTGG - Intronic
1020125714 7:5531487-5531509 CACTGCGGGGCGGGGGGGCTGGG + Intronic
1020281527 7:6652582-6652604 CACTGCGGCGGGGAACGCCCAGG - Exonic
1021486791 7:21176412-21176434 CACTGCAAAAGGGGAGGGGCTGG - Intergenic
1022389228 7:29928960-29928982 CAGTGGGGAGGAGGAGGGCCAGG + Intronic
1022855382 7:34309183-34309205 CACTGCGGAGGGGGGCGGGGTGG + Intergenic
1023039737 7:36161547-36161569 GGCTGAGGAGGGGGAGGTCCGGG + Intronic
1023252924 7:38284747-38284769 AACTGGGGGGGGGGAGGGGCTGG - Intergenic
1023992054 7:45134336-45134358 CACTGAGGTGGGAGAGGGCTGGG + Intergenic
1025653364 7:63494113-63494135 AACTGCAGAAGGGGAGGGACAGG + Intergenic
1025772800 7:64528702-64528724 CACTGGGTAGGGGCAGGGCTAGG - Intronic
1026880590 7:73904620-73904642 CAGTGGGGATGGAGAGGGCCGGG + Intergenic
1027250045 7:76393341-76393363 CACTGCGGCGTGGGAGGGGCGGG - Intronic
1031265186 7:119572418-119572440 CTCTGTGGAGTGGGAGGCCCAGG - Intergenic
1032018274 7:128393157-128393179 TACGGCGCAGGAGGAGGGCCTGG + Intronic
1032474481 7:132202835-132202857 AACTGCAGAGGGGAAGGGCAAGG + Exonic
1033477503 7:141704891-141704913 CACTGCTGAGTGAGAGGGCTAGG - Intergenic
1033597779 7:142868956-142868978 CGCTGCTGAGGGGAAGGGGCAGG - Exonic
1034601563 7:152262192-152262214 TAGTGAGGAGGTGGAGGGCCTGG - Intronic
1035519490 8:265945-265967 ACCTGAGGAGGGGGAGGCCCGGG + Intergenic
1035601159 8:897684-897706 CCGTGGGGAGGGGGAGGGGCGGG - Intergenic
1036173673 8:6515207-6515229 CTCTGTGGAGGGGCAGGGGCTGG - Intronic
1036182671 8:6598496-6598518 CTCTGCGGAGCTGGTGGGCCGGG - Intronic
1036771104 8:11578873-11578895 CCCTGGGGAGGGGCAGAGCCAGG - Intergenic
1037951064 8:23019063-23019085 CACGGAGGAGGGGCAGAGCCAGG + Intronic
1038295967 8:26291441-26291463 GAGAGCGGAGGGGGAGGGGCGGG - Intergenic
1038326657 8:26577385-26577407 AACGGCGGGGGAGGAGGGCCCGG + Intronic
1038539432 8:28379603-28379625 CACTGAGGAGGGGCAGGGCATGG - Intronic
1038644387 8:29350511-29350533 CAGAGCGGAGGGGGAGGCGCCGG + Exonic
1038716811 8:29998560-29998582 CACTGCGGAGGACGACAGCCTGG - Intergenic
1038728616 8:30105143-30105165 CACTGAAGAGGGGAAGGGGCTGG + Intronic
1039434288 8:37548994-37549016 CACTGCCAAGGGGAAGGGGCAGG - Intergenic
1039542235 8:38381989-38382011 CACTGAGGAGGGCCACGGCCGGG + Exonic
1039732212 8:40292489-40292511 CACTGCAGAGTGGGCGGGCAAGG - Intergenic
1040776025 8:51044181-51044203 CACTCAGCAGGGGGATGGCCGGG + Intergenic
1042514886 8:69648590-69648612 CACTGAGGAAGGAGAGAGCCTGG + Intronic
1042649504 8:71024032-71024054 CACTTGGGAGGGGCAGGGCCAGG + Intergenic
1043420275 8:80090439-80090461 CAGTGGGGATGGGGAGGGGCGGG + Intronic
1045484575 8:102621189-102621211 GACTACGTAGGGGAAGGGCCTGG + Intergenic
1047400033 8:124538667-124538689 CAAGGCAGAGGGGAAGGGCCGGG + Intronic
1048540935 8:135341782-135341804 GACTGAGGAGGGGAGGGGCCAGG + Intergenic
1049059437 8:140264622-140264644 GAGAGCGGAGGGGGAGGGCAGGG + Intronic
1049240722 8:141536200-141536222 CACAGAGGAGGGGTAGAGCCAGG + Intergenic
1049372151 8:142273047-142273069 CACTGCAGAGGAGGTGGGCAAGG - Intronic
1049418072 8:142504528-142504550 CACAGCGGTGGGGAAGGGTCTGG + Intronic
1049431869 8:142569096-142569118 CCCTGGGGAGTTGGAGGGCCGGG - Intergenic
1049557715 8:143291353-143291375 AAGTGCCGAGGGGGCGGGCCAGG + Intronic
1049976179 9:862508-862530 CAATGGGGAGGGGGAGGGGGAGG + Intronic
1052991777 9:34522907-34522929 CGCGGCCGAGGGGGAGGGCCGGG - Exonic
1053533484 9:38904388-38904410 CACTGCATATGGGGAGGGGCGGG - Intergenic
1054205709 9:62128817-62128839 CACTGCATATGGGGAGGGGCGGG - Intergenic
1054632652 9:67459553-67459575 CACTGCATATGGGGAGGGGCGGG + Intergenic
1054731600 9:68706340-68706362 CACTGGGGAGGGAGAATGCCCGG + Intronic
1055673486 9:78631268-78631290 GACTGCTGAGTGGGAGGGGCAGG + Intergenic
1056342408 9:85650343-85650365 GACTGAGGAGGAGGAGGGGCAGG - Intronic
1056350067 9:85741343-85741365 CACTGGGGCGGGGGAGAGCGGGG + Intronic
1056659899 9:88535792-88535814 CAGTGCAGAGGGGGAGGCCTGGG - Intronic
1056664239 9:88568429-88568451 CACTGGGGAGGGTGAGAGGCAGG + Intronic
1057858859 9:98624158-98624180 CACTGTGGAGGGGCTGGACCAGG + Intronic
1057934040 9:99221873-99221895 CATGGCGGAGGAGCAGGGCCGGG - Exonic
1058286593 9:103187163-103187185 CACGGAGGAGGGGGAGGCTCAGG - Intergenic
1058689508 9:107507491-107507513 GGCTGCGGAGGTGGAAGGCCTGG + Intergenic
1058975327 9:110120872-110120894 CAGTGGGGAGGGCGAAGGCCGGG + Intronic
1059227402 9:112684913-112684935 CACTGCAGAGGGTGAGGGAAAGG - Exonic
1059299385 9:113299937-113299959 CACTGAGTAGGGGGACGGCATGG - Intronic
1059437480 9:114285350-114285372 CAGTGGGGATGTGGAGGGCCAGG + Intronic
1060069932 9:120537370-120537392 CACTGTGGAGGGCAAGGGCAGGG - Intronic
1060547136 9:124468298-124468320 CCCTGGGGAGGAGCAGGGCCCGG + Intronic
1060968422 9:127724382-127724404 CACTGGGGAGGGGGGGTGCGGGG + Intronic
1061246831 9:129404895-129404917 CTCTGCTGCAGGGGAGGGCCCGG - Intergenic
1061455224 9:130692597-130692619 CACGGCAGAGGGCGAGGGTCTGG + Intergenic
1061640673 9:131952525-131952547 CACTGTGGAGAGGGTGGGTCTGG - Intronic
1061789454 9:133051450-133051472 CACTGCGTAAGGGAAGCGCCGGG - Intronic
1062100037 9:134723249-134723271 CCCTGCGGAGAGGAAGGACCCGG + Intronic
1062129510 9:134885032-134885054 CACTGGGAGGTGGGAGGGCCAGG + Intronic
1062367248 9:136216764-136216786 CCCCGCGGTGGGGGCGGGCCCGG - Intronic
1062540461 9:137039706-137039728 CCCCGGGGAGGGGCAGGGCCTGG - Exonic
1062595747 9:137298418-137298440 CACTGCGGAGAGGCCTGGCCTGG - Intergenic
1062658063 9:137614343-137614365 CATTGCGGAGGTGGAGGGTGCGG + Exonic
1202791987 9_KI270719v1_random:94520-94542 CACTGCGGAGAAGCGGGGCCTGG + Intergenic
1203551343 Un_KI270743v1:166633-166655 CACCGCGGAGAGGTGGGGCCTGG - Intergenic
1185468291 X:368441-368463 CACTGACGGGGGGGAAGGCCGGG + Intronic
1185552781 X:997422-997444 AACTGGGGAGGGGGTGGTCCTGG + Intergenic
1187181597 X:16947503-16947525 CACTCAGGAGAGGGAGGGGCAGG - Intronic
1188972601 X:36636140-36636162 CACTGGGGAGGGGGAATGACGGG - Intergenic
1189178177 X:38978986-38979008 AACAGCAGAGGGGAAGGGCCAGG - Intergenic
1190457963 X:50643739-50643761 AGCTGCCGAGGGGGTGGGCCAGG - Intronic
1190542972 X:51496873-51496895 CGCGGCGGAGGGCGAGGGGCGGG + Intergenic
1198694477 X:139321072-139321094 CACGGCGGAGGGGGAGGCTCAGG - Intergenic
1199987728 X:152964478-152964500 GAGTGAGGAAGGGGAGGGCCCGG + Intronic
1200057287 X:153468301-153468323 GGCTGAGGAGGGGGAGGCCCGGG + Intronic