ID: 1100618412

View in Genome Browser
Species Human (GRCh38)
Location 12:96249384-96249406
Sequence ACTGCGGAGGGGGAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618412 3 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415
1100618399_1100618412 26 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415
1100618398_1100618412 27 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618412 Original CRISPR ACTGCGGAGGGGGAGGGCCA GGG Intronic
900513143 1:3069610-3069632 GGGGCGGAGGGGGAGGGCCGGGG + Intronic
900530394 1:3150153-3150175 ACTGCGTAGGGGGATGGCTTTGG + Intronic
901751631 1:11413658-11413680 TCTGCTGAGAGGGAGGGACATGG + Intergenic
902724415 1:18325365-18325387 TCTGCGGTGGGGCAGGGCAAGGG + Intronic
903259041 1:22121379-22121401 GCTGCGGTGAGTGAGGGCCAGGG + Intronic
903467001 1:23558722-23558744 ACTGCGGGAGGGCAGGGCCCAGG + Intronic
903560812 1:24225560-24225582 ACTGTGGAGGCGGAGGGCTTTGG + Intergenic
903971669 1:27122850-27122872 ACAGGGGAGAGGGAGGGACAGGG + Intronic
904261345 1:29289553-29289575 GCTGGGGAGGGGGCTGGCCAGGG - Intronic
904289863 1:29478235-29478257 ACAGCGGAGGGGGAGGGGAGAGG - Intergenic
904964354 1:34360324-34360346 ACTCCGGAGAGGGAGGGTCTGGG + Intergenic
905111189 1:35595655-35595677 ACTGGGGAGAGGCAGGGCCTGGG + Intergenic
905126511 1:35719217-35719239 ACTGCGGAGAGGGAGGGTAGAGG - Exonic
905512029 1:38529460-38529482 GGTGGGGAGGGGGAGTGCCAGGG + Intergenic
905979637 1:42211889-42211911 ACTGGGGGTGAGGAGGGCCAGGG + Intronic
906066730 1:42986181-42986203 ACTCCAGAGTGGGAGGGACAGGG - Intergenic
907331073 1:53672061-53672083 ACTGCAGGGTAGGAGGGCCAAGG + Intronic
907889037 1:58620509-58620531 GCTGGGGAGGGGCAGGGCAATGG - Intergenic
908257310 1:62313693-62313715 CCTGCTGAGGGTGAGGGGCAAGG + Intronic
909001479 1:70222004-70222026 AATGCAGAGAGGCAGGGCCAGGG + Intronic
910447269 1:87311449-87311471 AGTGCCGAGGATGAGGGCCAGGG - Intergenic
911789571 1:101996530-101996552 ACTGCGCGGGGGGAGGGACTAGG - Intronic
912272364 1:108224172-108224194 AGGGAGGAGCGGGAGGGCCATGG + Intronic
912295857 1:108470149-108470171 AGGGAGGAGCGGGAGGGCCATGG - Intronic
912756085 1:112325821-112325843 ACTTGGGAGGGAGGGGGCCAAGG + Intergenic
913222057 1:116667623-116667645 CGCGCGGAGGGAGAGGGCCAGGG - Exonic
913995724 1:143650834-143650856 ACTGGGGAGCGGGAGAGCAAGGG - Intergenic
914492046 1:148158273-148158295 ACTGGGGAGCGGGAGAGCAAGGG - Intergenic
914887020 1:151593844-151593866 TTTGGGGAGGGGGCGGGCCAGGG + Intergenic
915215816 1:154340249-154340271 ACTCCAGAGGGAGAGGGCCCTGG - Intronic
915348074 1:155208121-155208143 ACTGCGGAGAGGGAGGCACCTGG - Intronic
918297879 1:183174624-183174646 ATGGCTGAGGAGGAGGGCCATGG + Intergenic
919770490 1:201155185-201155207 GCTGCTTAGGGGGAGCGCCAGGG - Intronic
919854187 1:201694443-201694465 CCTGGGGAGGGTGAGGGCCGGGG + Intronic
919876935 1:201876164-201876186 ACTGCCGAGGCCAAGGGCCAAGG - Exonic
919920172 1:202162651-202162673 GCTGGGGAGGGGGAGGTGCAGGG - Intergenic
920173118 1:204083859-204083881 ACTGAGGGGAGGGAGGGACAGGG + Intronic
920311736 1:205052657-205052679 ACAGCTGAGGGGAAGGGGCAGGG + Intronic
922675151 1:227544997-227545019 ACTGGGCAGGGGGAGGGTCTGGG + Intergenic
922724862 1:227918106-227918128 CCTGGGGAGGAGGAGGGCCCTGG - Intergenic
923031890 1:230255665-230255687 ACTGCAGAGGGGCAGCACCAGGG + Intronic
924772033 1:247087544-247087566 TCTGGGCAGGGGGAGGGCCCAGG - Intergenic
1062878969 10:963155-963177 CCTGGGGTGGGGGAGGACCAAGG - Intergenic
1063231263 10:4067718-4067740 ACTGGTAAAGGGGAGGGCCAGGG - Intergenic
1063707601 10:8446160-8446182 ACTGCGGTGGGGGATGATCATGG + Intergenic
1064143110 10:12806673-12806695 ACTGAGCAGGTGGAGGGCCAGGG + Intronic
1065020858 10:21500711-21500733 ACGGGGGAGGGGCAGAGCCACGG - Intergenic
1065101346 10:22335597-22335619 GCCGCGGAGGAGGAAGGCCAGGG - Intergenic
1065169274 10:23010730-23010752 AGTGGGGAGGGGGAGGGAAAGGG - Intronic
1067160514 10:43821333-43821355 ACAGATGAGGGGGATGGCCATGG - Intergenic
1067479975 10:46588279-46588301 ACTGTGGGGAGGGTGGGCCATGG - Intronic
1067614762 10:47753518-47753540 ACTGTGGGGAGGGTGGGCCATGG + Intergenic
1069604695 10:69731916-69731938 CCTGTGGAGGGGGCGGGCCAGGG - Intergenic
1069615379 10:69803136-69803158 GGGGTGGAGGGGGAGGGCCATGG - Intronic
1070088454 10:73259447-73259469 ACAAAGGAGGGGGAGGGGCATGG - Intronic
1071630168 10:87213481-87213503 ACTGTGGGGAGGGTGGGCCATGG + Intergenic
1073212740 10:101818156-101818178 CCTGCGGAGAGGGAGGGGGAAGG - Exonic
1073472553 10:103731857-103731879 AGTGCAGAGGGGGAGGGTCAGGG + Intronic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1074911674 10:117915759-117915781 ACTGGGGGGGGGGAGGGCGGGGG - Intergenic
1075576327 10:123580385-123580407 ACTGAGCAGGGAGAGGGTCAGGG - Intergenic
1076209223 10:128627160-128627182 AGTGCGGGCGGGGAGAGCCAGGG + Intergenic
1076312540 10:129518562-129518584 GCTGGGGAGGGGGAGGGGGAAGG - Intronic
1076542621 10:131223835-131223857 AGTGGGCAGGGGGAGGGCCAGGG - Intronic
1076686196 10:132199504-132199526 ACTGGGGCTGGAGAGGGCCAAGG + Intronic
1076895675 10:133310109-133310131 ATGGCGGTGGGGGAGGGCCAGGG + Intronic
1077217739 11:1402079-1402101 ACAGGGGAGAGGGAGGGCCAGGG + Intronic
1077264576 11:1642415-1642437 CCAGTGGAGGGGGCGGGCCAGGG - Intergenic
1077405329 11:2379998-2380020 ACTGCAGACGGGGAAGGCCGAGG - Intronic
1077532796 11:3105123-3105145 TCTGTGGAGGGGGAGGACCAGGG - Intronic
1077543689 11:3159677-3159699 CCTGGGGAGGGCCAGGGCCACGG + Intronic
1077666603 11:4116059-4116081 GGTCCGCAGGGGGAGGGCCAGGG + Intronic
1079023317 11:16925907-16925929 GCTGAGGAGGGGGAGGGAAAAGG + Intronic
1079690145 11:23406812-23406834 AAGGGGGAGGGGGAGGGGCAGGG - Intergenic
1080453774 11:32400202-32400224 TCTGCGGAGGGCGAGGCCCCTGG + Intronic
1082871176 11:57944630-57944652 ACCGGGGAGGGGGAGGGGGAGGG + Intergenic
1083823550 11:65185898-65185920 ACAGCTGTGGGGGAGGGGCACGG - Exonic
1084196239 11:67524683-67524705 ACTGCGGGGGAGGAGGCCAAAGG - Intergenic
1084238817 11:67805367-67805389 ACTGAAGAGGGGGCGGGCCCAGG + Intergenic
1084542711 11:69797465-69797487 GCTGCGGATGGGGTGGGGCATGG + Intergenic
1084598052 11:70128918-70128940 ACTGGGGACAGGCAGGGCCAAGG - Intronic
1084833602 11:71787461-71787483 ACTGAAGAGGGGGCGGGCCCAGG - Intergenic
1084892927 11:72245219-72245241 GCTGCGGAGAGGGAGGGTCGTGG + Intronic
1085289607 11:75388478-75388500 AGTGGGGAGGGGAAGAGCCAAGG - Intergenic
1086015537 11:82161721-82161743 ACTGCGGTGGGGTAGGGGGAGGG + Intergenic
1087138093 11:94740426-94740448 TCTGCGGAGCGTGACGGCCACGG + Intronic
1088802295 11:113317304-113317326 ATTTGGGAGGGGGAGGGCAAAGG - Intronic
1089314609 11:117583127-117583149 CATGCGGAGGGGAAAGGCCATGG - Intronic
1091118431 11:133036973-133036995 ACTGTGGGGAGGGAGGACCAAGG - Intronic
1091387064 12:102394-102416 ACTGCAGAGGAGGATGGCCAGGG - Intronic
1092178814 12:6430414-6430436 ATTGCTGTGGGGGAGAGCCAAGG + Intergenic
1092243024 12:6847101-6847123 ACTGTGGGGAGGGAAGGCCATGG - Exonic
1092696631 12:11178358-11178380 AGTGGGGATGGGGAGGGTCAAGG + Intergenic
1093208987 12:16284940-16284962 ACTGGGGAGTGGGAGGGAGAAGG - Intergenic
1093656262 12:21697701-21697723 ACTGTGAAGGAGGAGTGCCATGG + Intronic
1094555680 12:31497780-31497802 AGGGTGGAGGGGGAGGGGCATGG + Intronic
1094832497 12:34306788-34306810 ACTGCAGAGGAGGGGGGCCTGGG + Intergenic
1096113522 12:49042214-49042236 ACCACGGAGGGTGAGGGCGACGG - Exonic
1096117512 12:49063858-49063880 ACTGGGGACATGGAGGGCCAGGG + Intergenic
1096785004 12:54011939-54011961 CCTGGGGAGGGGGAGGGGGAGGG - Exonic
1096843885 12:54394946-54394968 AATGCAAAGGGGGAGGTCCAAGG - Intergenic
1097054267 12:56240476-56240498 AGGGGGGAGGGGGAGGGCAAAGG + Exonic
1097058958 12:56268040-56268062 GCTGGGGAGGGGGATGGCTAGGG - Intronic
1098379708 12:69854329-69854351 ACCGTGGAGGGGGAGGGGGAGGG + Intronic
1098888249 12:75982156-75982178 ACGGGGGAGGGGGAGGGGGAGGG + Intergenic
1098941246 12:76539047-76539069 ACTGGGGGGGGGGAGGGGGAGGG + Intronic
1099055440 12:77834095-77834117 AATGGGGAGGTGGTGGGCCAGGG + Intronic
1100618412 12:96249384-96249406 ACTGCGGAGGGGGAGGGCCAGGG + Intronic
1101479576 12:105084314-105084336 ACTCCGGGGCGGGAGGGCCGGGG - Intronic
1102518111 12:113463557-113463579 TCTGCGGAGGGGGAGCGGGAAGG + Exonic
1102542849 12:113634940-113634962 ACTGAGGAGGGGGTGGGCTGGGG + Intergenic
1103606287 12:122088174-122088196 ACAGCAGAGGGGGAGGGGCAGGG - Intronic
1103708023 12:122889827-122889849 GCTGGTGAGGGGGAGTGCCAGGG - Intronic
1103978959 12:124723589-124723611 CCTGCGGGGGGGGGGGGGCAAGG + Intergenic
1104947615 12:132423590-132423612 TCCGCGGAGGGAGAGGGGCAGGG + Intergenic
1105250728 13:18697214-18697236 GGAGCGGAGGCGGAGGGCCACGG + Intergenic
1105441052 13:20415525-20415547 ACCGGCGAGGGCGAGGGCCAGGG + Intronic
1108492365 13:50994216-50994238 AAGGCGGAGGGGGAGGGGGAGGG - Intergenic
1111491259 13:88978718-88978740 AGTGCTGAGTGGGAGGGCAAGGG - Intergenic
1112435466 13:99388698-99388720 AGTGGGGAAGGGGAGAGCCAGGG + Intergenic
1113735917 13:112679023-112679045 ACTGTGGAGGGAGAGGGAGAGGG + Intronic
1114265155 14:21069475-21069497 GATGCGGAAGGGAAGGGCCACGG + Intronic
1118607563 14:67514989-67515011 ACCGCGGAGGGCGCGGGCGATGG - Intronic
1119405532 14:74396381-74396403 ACTGGGCAGGGTGAGGGTCATGG - Intergenic
1121220016 14:92278050-92278072 GGTGGGGAGGGGCAGGGCCAGGG + Intergenic
1121882927 14:97516483-97516505 ACTGAGGAGGGGGAGGGTTGTGG - Intergenic
1122121407 14:99555412-99555434 ACAGCTGTGGGGCAGGGCCAGGG - Intronic
1122125247 14:99575256-99575278 ACTGCGCCAGGGGAGTGCCAAGG + Intronic
1122873077 14:104650443-104650465 ACGGGGGAGGAGGAGGGGCAGGG - Intergenic
1122997541 14:105273445-105273467 CCTGCCCAGAGGGAGGGCCATGG + Intronic
1125723281 15:41855355-41855377 GCTGCGGAGGGCGGAGGCCAGGG - Exonic
1126137863 15:45409762-45409784 ACTCCGGAGGGTGAGGTGCAAGG + Intronic
1126448608 15:48780059-48780081 ACTGCAGAGGGCTAGGGCAAGGG - Intronic
1127980757 15:64033251-64033273 CCTGGGGAGGGGGAGGGGGAGGG + Intronic
1128509319 15:68303759-68303781 ACTGTGGAAGGTGAGGGCCCTGG - Exonic
1128648279 15:69392838-69392860 ACTACAGAGAGGGTGGGCCAGGG + Intronic
1128743033 15:70096466-70096488 ACTGGGGAGAGGGAGGCCCTTGG - Intronic
1129116504 15:73368089-73368111 GCCGCCGAGGGGGAGGGCGAGGG + Exonic
1129182669 15:73886961-73886983 TCTGGGGAAGGGGAAGGCCAGGG - Intronic
1129521995 15:76191946-76191968 ACTGCGGAGGGAGACGGGCAAGG - Exonic
1129589949 15:76905986-76906008 ACTGCGGGTGGGGAGGGAGAGGG - Intergenic
1129663304 15:77565309-77565331 ACTGGGGATTGGGAGGCCCAAGG - Intergenic
1129686082 15:77686816-77686838 GCTGAGGTGGGGGAGGCCCAGGG - Intronic
1129705816 15:77793470-77793492 TCTGGGGAGTGGCAGGGCCAGGG - Intronic
1130912799 15:88282614-88282636 ACTGGGGAGGGGGAGGGGAGGGG - Intergenic
1130957630 15:88638771-88638793 TCTGAGGAGGGGGAGGGCCGGGG + Exonic
1132106360 15:99065661-99065683 GATGCAGAGGTGGAGGGCCAGGG - Intergenic
1132898067 16:2238246-2238268 CCTGCGGTGGGGCAGGGGCAGGG - Intronic
1133055787 16:3144838-3144860 ACGCTGGAGGGGGAGGCCCAGGG + Intronic
1133234772 16:4382671-4382693 TGTGCGGCGGGGGCGGGCCATGG + Exonic
1133350481 16:5097793-5097815 ACTGAAGAGGGGGCGGGCCCAGG + Exonic
1133937092 16:10278022-10278044 TGTCCGCAGGGGGAGGGCCAGGG - Intergenic
1134418058 16:14061734-14061756 TCAAAGGAGGGGGAGGGCCAAGG + Intergenic
1136171773 16:28494382-28494404 ACTGGGGAGGGGGAGAGGGAGGG - Intronic
1136239911 16:28937392-28937414 ACCGCAGAGGTGGGGGGCCACGG - Intronic
1136284671 16:29233863-29233885 ACGGTGGTGGGGGAGGGCCCTGG - Intergenic
1138186475 16:54981576-54981598 ACTTGGGAGGGAGAGGGCCTGGG - Intergenic
1138529762 16:57628612-57628634 AGTGCGGAGAGGGAGGGACCGGG - Intronic
1138554325 16:57763030-57763052 ACTGACTAGGGGGAGGGACAGGG - Intronic
1138725723 16:59136788-59136810 ACTGCAGGGGGGATGGGCCAAGG - Intergenic
1139364865 16:66427124-66427146 GCTGCGGCAGGGCAGGGCCAGGG + Intergenic
1142089687 16:88203331-88203353 ACGGTGGTGGGGGAGGGCCCTGG - Intergenic
1142194304 16:88732535-88732557 TCTGCGGAGGGCAAGGGTCAGGG + Exonic
1142381079 16:89732616-89732638 ACAGCGGAGGGCGAGGGCACAGG - Intronic
1142501197 17:334403-334425 ACTGCGGGGGGACAGGGACAAGG + Intronic
1142501218 17:334486-334508 ACTGCGGAGGGACAGGAACAAGG + Intronic
1142501248 17:334581-334603 ACTGTGGAGGGACAGGGACAAGG + Intronic
1142501278 17:334676-334698 ACTGTGGAGGGACAGGGACAAGG + Intronic
1142501308 17:334772-334794 ACTGTGGAGGGACAGGGACAAGG + Intronic
1142501339 17:334868-334890 ACTGCGGAGGGACAGGGACAGGG + Intronic
1142507705 17:375564-375586 ACTGCGGGGGGAGTGGGACAGGG + Intronic
1142507747 17:375723-375745 ACTGCGGGGGGAGTGGGACAGGG + Intronic
1142507776 17:375829-375851 ACTGCGGGGGGAGTGGGACAGGG + Intronic
1142669787 17:1482809-1482831 AGTGCGGGAGGGGAGGGGCAGGG - Intronic
1143796839 17:9343761-9343783 CCGGCAGATGGGGAGGGCCAAGG - Intronic
1143904685 17:10198902-10198924 ACTGGCGAGGGGGCGGGCCGGGG + Intergenic
1144659140 17:17057158-17057180 ACTGCTGGGTGGGAGGGCTATGG + Intronic
1144788929 17:17846937-17846959 CCTGGGCAGGGAGAGGGCCAAGG - Exonic
1145265495 17:21377855-21377877 AATGGGGAGGGGGAGGTCCCAGG - Intronic
1145891336 17:28418296-28418318 ACTCTGGAGGGAGAGGGACAAGG - Intergenic
1146277798 17:31526037-31526059 ACTGCACAGGGGCAGGGACACGG - Intronic
1146910650 17:36646426-36646448 CCTGGGGAGGGGGATGGACATGG + Intergenic
1147308280 17:39578545-39578567 TCTAGGGAGGAGGAGGGCCATGG + Intergenic
1147420401 17:40319569-40319591 ACTGAGGAGGGGGAGTGTCAGGG - Intronic
1147702018 17:42402314-42402336 CCTGGGGTGGGGGAAGGCCAGGG - Intergenic
1147973106 17:44230498-44230520 ACTGCAGGGGGAGAGGGTCAGGG - Intergenic
1148021476 17:44556759-44556781 TGTGTGGAGGGGGAGGGCGAGGG + Intergenic
1148127114 17:45242571-45242593 GATGAGGAGGGGGAGGCCCAGGG + Intronic
1148221408 17:45864975-45864997 ACTGCAGAGGGCGAGGGGCAGGG + Intergenic
1148225259 17:45894749-45894771 TCTGCGGAGAGGGAGGGCGAGGG - Intronic
1148646840 17:49224191-49224213 ACGGCGGAGGGGGCGGGGAAGGG - Exonic
1149549892 17:57532360-57532382 ATTGCAGAGTGGGAGGGCCCTGG - Intronic
1149995884 17:61405709-61405731 ACGGCGGAGGTGGCGGGCCTGGG + Exonic
1150596972 17:66614958-66614980 AGTAGGGAGGGGGTGGGCCAGGG + Intronic
1151208964 17:72529460-72529482 ACTGGGGAAAGGGAGGCCCAGGG + Intergenic
1152586814 17:81192963-81192985 ACTGCCGAGGGGGAGGGGCAGGG - Intronic
1152699229 17:81810952-81810974 ACTGTGGGGGGGGCGGGCCCAGG + Intronic
1152779012 17:82218259-82218281 ACTGGGGGGGTGGACGGCCAAGG + Intergenic
1152779041 17:82218338-82218360 ACTGGGGGGGTGGACGGCCAAGG + Intergenic
1152779057 17:82218378-82218400 ACTGGGGGGGTGGACGGCCAAGG + Intergenic
1153119965 18:1710106-1710128 ACAAGGGAGGGGGAGAGCCAGGG - Intergenic
1154438119 18:14361712-14361734 GGAGCGGAGGCGGAGGGCCACGG - Intergenic
1155712241 18:28897132-28897154 ACTGGGGAGGGGAAGGGAAATGG + Intergenic
1156452384 18:37274197-37274219 ACTCTGGAGGGAGAGGGCAAGGG + Intronic
1156497293 18:37534285-37534307 GCTGGGGAGGGGGAAGGGCAGGG + Intronic
1157595165 18:48859813-48859835 AGTGAGGAAGGGGAGGGCCAGGG - Exonic
1158372652 18:56827070-56827092 ATTGCGGAGGTGGAGAGACATGG + Intronic
1160228172 18:77027445-77027467 CCTGGGCAGGGGCAGGGCCAGGG + Intronic
1160347887 18:78149854-78149876 ACTGAGGAGAGGGAGGGAGATGG + Intergenic
1160628815 18:80231205-80231227 AGTGCTGAGAGGTAGGGCCAGGG + Intronic
1161588270 19:5117267-5117289 GCTGCAGCAGGGGAGGGCCATGG + Intronic
1161854255 19:6754425-6754447 CCTGCAGAGGTGGAGGGCAAGGG + Exonic
1162110389 19:8396774-8396796 CCTGCGGAAGGTGGGGGCCACGG + Intronic
1162553929 19:11374825-11374847 GAGGCGGCGGGGGAGGGCCAAGG + Exonic
1162760891 19:12887553-12887575 ACTGGGGAGGGGGAGGGCTGTGG - Intergenic
1163018412 19:14470553-14470575 ACTGGGGAGAGGGAGGCCCGGGG - Exonic
1163091510 19:15023190-15023212 TCAGGGGAGAGGGAGGGCCATGG - Exonic
1163249540 19:16118345-16118367 ACGGTGGAGGGAGAAGGCCAAGG - Intronic
1163297527 19:16421875-16421897 GCTGAGGAGTGGGAGGACCAGGG - Intronic
1163739698 19:19003884-19003906 ACTGTGGAGGGGATGGGCCTGGG - Intronic
1164578254 19:29418610-29418632 ACTGTGGAGGGGAGGGGCCCGGG + Intergenic
1164698463 19:30264365-30264387 ACTGCGGGGGGCGGGGGCCTGGG - Intronic
1165065417 19:33225636-33225658 ACTGGGGAGGGCGAGGGCGCAGG + Exonic
1165783673 19:38448333-38448355 GCTGTGGAGGGTGAGAGCCAAGG - Exonic
1166233298 19:41438414-41438436 ACTGGGGAGGGGGAGAGGAAAGG + Exonic
1167698782 19:51030238-51030260 ATGGAGGAGGGGGAGGGGCAGGG - Intronic
1167924338 19:52810901-52810923 ACTGTGGAGGGAGAGGGAGAGGG - Intronic
925331140 2:3059809-3059831 CCCACGGAGCGGGAGGGCCAAGG - Intergenic
925619484 2:5777142-5777164 CCTGTGGAAGGGGTGGGCCAGGG + Intergenic
926094134 2:10070131-10070153 GGTGAGGAGGGGGAGGGCAAGGG + Intronic
929857676 2:45650608-45650630 ACGGCGGTGGGGGAGGGGGAAGG - Intergenic
930076391 2:47409072-47409094 GGAGGGGAGGGGGAGGGCCAGGG + Intronic
931376634 2:61713857-61713879 AGTGGGGATGGGGAGGGACAGGG - Intergenic
931869238 2:66441146-66441168 ACTGAGAAAGGGGAGAGCCATGG + Intronic
932252502 2:70257330-70257352 ACTGAGGATGGGGTGGCCCAAGG - Intergenic
932318311 2:70801165-70801187 ACTGGGGATGGGGAGGTCCTTGG + Intergenic
933559544 2:83874030-83874052 GGTCCGCAGGGGGAGGGCCAGGG + Intergenic
935021573 2:99237506-99237528 ACTGAGAAGGGGTAGAGCCAAGG - Intronic
937214370 2:120302019-120302041 ACTGTGCAGGGGGAGGTCCCTGG - Intergenic
937345215 2:121121162-121121184 ACTGTGGAAGGGGAGGGCAGGGG + Intergenic
937912479 2:127082217-127082239 ACGACGGAGGAGGAGGGGCAAGG - Intronic
938158549 2:128961826-128961848 TCTGCAAAGGGTGAGGGCCAGGG + Intergenic
938390278 2:130899468-130899490 ACTGGGAAGGGGGATGGCCCGGG + Intronic
939863774 2:147449893-147449915 GCTGCGTAGGGGGAGGGCTCTGG - Intergenic
939969823 2:148645711-148645733 ACTGCGGCGGGGGAGGGCGGGGG + Intronic
940195156 2:151085965-151085987 ACTGGGGAAGGGGAGGTACATGG + Intergenic
946213138 2:218163424-218163446 GCTGCAGAGGGGAAGGGCTAAGG + Exonic
948914923 2:241029790-241029812 AGAGCGGAGGGGGATGGCCAGGG - Intronic
948953901 2:241272640-241272662 GCCGCGGAGGGGGAGGGGCCCGG - Intronic
1169065897 20:2693908-2693930 ACTCCGGACGGGGTGGGCCGGGG - Intronic
1169917297 20:10696440-10696462 ACTGCGGAGGATGAAAGCCAAGG - Intergenic
1170494845 20:16914853-16914875 ACTGTGAAGGGGCATGGCCAGGG + Intergenic
1171310790 20:24143190-24143212 TCTGCCGTGGGGGAGTGCCAGGG - Intergenic
1171361680 20:24590476-24590498 AGGGCGGAGGGGGAGGCGCAGGG + Intronic
1172117987 20:32583323-32583345 GCCGCGGAGGGGGAGGGGGAGGG + Intronic
1173569260 20:44066178-44066200 ACTGGTGAGTGGCAGGGCCAGGG - Intronic
1173666351 20:44766073-44766095 ACTGTGGTGGGGGAGGGACAGGG + Intronic
1175225539 20:57441880-57441902 AATGGGCAGGGGGAGGGGCAGGG + Intergenic
1175765345 20:61588615-61588637 TCTCGGGAGGGGGAGGGCCCTGG - Intronic
1176036944 20:63044160-63044182 ACTGCGGACCGGGAATGCCAGGG + Intergenic
1178083676 21:29091946-29091968 ACTGAGCATGGGGAGGGCTAGGG + Intronic
1179289510 21:40006238-40006260 CCTGGGGAGAGGGAGGGCCTGGG + Intergenic
1179431271 21:41322847-41322869 AGGGGGGATGGGGAGGGCCAAGG + Intronic
1179994326 21:44967074-44967096 GGAGCGGAGGCGGAGGGCCACGG + Exonic
1180181899 21:46121792-46121814 ACTGCTGAAGAGGAGAGCCAGGG - Intronic
1180640097 22:17291376-17291398 ACTGGGAAGGAGGAGGGCAAAGG - Intergenic
1181034784 22:20164681-20164703 AGTGGGGAGGGGGAGGCTCAGGG + Intergenic
1181440748 22:22934123-22934145 TCTGCAGAGGGGCAGGGGCAGGG + Intergenic
1181846879 22:25717373-25717395 ACAAAGGAGAGGGAGGGCCAGGG - Intronic
1181911810 22:26244384-26244406 ACTGGGGAGAGGGAGGGCACAGG + Intronic
1182036551 22:27202980-27203002 GCCGAGGAGGGGGAGGGCCGCGG - Intergenic
1182093192 22:27609685-27609707 CCGGCGAAGGGGGAGGGGCAGGG + Intergenic
1182435344 22:30326493-30326515 ACTGCGAAGGGGGCGGGTCTAGG + Intronic
1182862668 22:33573565-33573587 ACTGAGGAGGGCGAGGGACCAGG + Intronic
1183667274 22:39253233-39253255 GCTGGGGAGGGGGATGGACAGGG - Intergenic
1183676928 22:39304363-39304385 ACAGAGGCTGGGGAGGGCCATGG + Intergenic
1184192136 22:42901916-42901938 ACCACGGAGAGGAAGGGCCAGGG - Intronic
1184349579 22:43934930-43934952 CCTGGGGAGGGAGAGGGCCCTGG - Intronic
950654068 3:14425774-14425796 ACTGATGAGGGGAAGGACCATGG - Intronic
952377698 3:32781068-32781090 GCTGGGGTGGGGGAGGGCCGAGG - Intergenic
954200867 3:49022324-49022346 CCTGCGGAGGGAAAGGGTCAGGG - Exonic
954434679 3:50489779-50489801 ACTGGGGAGGCCCAGGGCCATGG + Intronic
954541445 3:51395451-51395473 ACTGCGGACAGTGTGGGCCAGGG + Exonic
954749565 3:52805966-52805988 ATTGCGGGGTGGGAGGGCAATGG + Intronic
954917789 3:54163751-54163773 AGTGAGGAGGGAGATGGCCATGG + Intronic
955687818 3:61563073-61563095 GCAGCGGAGGGAAAGGGCCACGG - Intronic
957054770 3:75435164-75435186 ACTGAAGAGGGGGTGGGCCCAGG + Intergenic
958980241 3:100710752-100710774 ACTTCAGAGGGGGCGGGGCAAGG + Intronic
959988941 3:112609087-112609109 ACTGGGCAGGGGCAGGGGCAGGG - Intronic
961448476 3:126991993-126992015 GCTGGGGAGAGGCAGGGCCAAGG - Intronic
961538103 3:127582189-127582211 ACTCTGAAGGGGGCGGGCCATGG + Intronic
961932288 3:130547155-130547177 ACTGCGGAGGGGCTCGGGCATGG + Intergenic
963922993 3:150923940-150923962 ACTGCAGAGGAGTAGGGCAAAGG + Intronic
966413636 3:179667588-179667610 ACTGCAGCTGGGGAAGGCCAGGG - Intronic
968651858 4:1763330-1763352 GCTGGGGAGGGGCCGGGCCATGG + Intergenic
968753309 4:2401540-2401562 AAGGAGGAGGGGGAGGGCCTGGG - Intronic
968850304 4:3074054-3074076 GGCGCGGAGGGGCAGGGCCATGG - Intergenic
968997579 4:3955473-3955495 ACTGAAGAGGGGGCGGGCCCAGG + Intergenic
969514555 4:7639088-7639110 GCTGTGGAGGGAGAGGGCCTGGG + Intronic
969565023 4:7972234-7972256 GCTGTGGAGGGGCAGGGCCCTGG - Intronic
969682900 4:8653045-8653067 TCGGAGGAGGGAGAGGGCCAGGG - Intergenic
969698125 4:8747509-8747531 GCTGCGGAGGTGCTGGGCCACGG - Intergenic
969756437 4:9153220-9153242 ACTGAAGAGGGGGCGGGCCGAGG - Intergenic
971321133 4:25606899-25606921 GCTGGGGAGGGGGAAGGTCAGGG + Intergenic
971421601 4:26478295-26478317 CTTGCGGAGGTGGAGGGGCATGG - Intergenic
972596411 4:40533757-40533779 ACTGGGGAGAGGGAGTGGCAAGG - Intronic
974944424 4:68509953-68509975 ACTGTGGTGGGGTAGGGGCAGGG - Intergenic
975685410 4:76916078-76916100 ACTGTGGAGGGAGAGGGAGAGGG - Intergenic
976431524 4:84966999-84967021 ACTGAGGAGGGTGAGCGCCGCGG - Intergenic
978427128 4:108594339-108594361 GGTCCGCAGGGGGAGGGCCAGGG + Intergenic
981064253 4:140464532-140464554 AATGAGGAGGGGGAGAGCCTGGG - Intronic
982017162 4:151166119-151166141 ACTGGGTAGGGTGAGGGCCCTGG - Intronic
984461085 4:180037693-180037715 CCTGAGGAGAGGGAGAGCCAGGG - Intergenic
984582231 4:181523647-181523669 GCTGTAGAAGGGGAGGGCCAGGG - Intergenic
985784053 5:1885094-1885116 CCGGCTGAGGGGGAGAGCCAGGG + Intronic
985791605 5:1931181-1931203 ACGGCGGAGGGAGAGGCCCGGGG - Intergenic
986708102 5:10468063-10468085 ACTGTGCTGGGGGAGGGACAGGG - Intronic
986797481 5:11226075-11226097 ATTGAGAAGGGGCAGGGCCATGG - Intronic
991957898 5:72014189-72014211 ACTGGGGAGGGAGAGGACCCTGG - Intergenic
993308185 5:86295820-86295842 AGGGAGGAGTGGGAGGGCCATGG - Intergenic
995454303 5:112335602-112335624 ACTGTGGAGGTGGAGAGCCATGG - Intronic
997445265 5:133935663-133935685 ACTGAAGATGGGGAGGGCGAGGG - Intergenic
997584079 5:135034411-135034433 GCTGCGGAGGGGGAGGGCGCGGG - Intronic
997697321 5:135871867-135871889 ACTGAGGTGGGAGAGGGCCGGGG - Intronic
997709530 5:135992102-135992124 ACTGAAGAGCAGGAGGGCCAAGG - Intergenic
998767761 5:145507218-145507240 AATGCGGGGTGGGAGGGTCAGGG + Intronic
1001403671 5:171461210-171461232 AGTGGGGAGGGGGAGGGCAGTGG + Intergenic
1001403680 5:171461228-171461250 AGTGGGGAGGGGGAGGGCAGTGG + Intergenic
1001564032 5:172688115-172688137 ACGGCTGAGGGGGTGGGGCAGGG - Exonic
1001767257 5:174260207-174260229 ACTGAGATGGGGGAGGGACAAGG + Intergenic
1002012888 5:176298192-176298214 GCTGGGGAGGGAGAGGGACATGG - Intronic
1002098898 5:176847813-176847835 ACGGGGGGAGGGGAGGGCCAGGG - Intronic
1002188935 5:177468967-177468989 TCTGGGGAGGGAGAGGGACATGG + Intronic
1002474690 5:179457811-179457833 GCTGCTGAGAGGGAGGGCCCGGG + Intergenic
1002575057 5:180169840-180169862 CCTGCACAGGGGGAGGGCGAGGG - Intronic
1003141338 6:3473942-3473964 AATGTGGAGGGGGAGGGGAAAGG + Intergenic
1004114033 6:12749547-12749569 ACGGGGGAGGGGGAGGGGAAGGG - Intronic
1004241277 6:13924822-13924844 ACTGCTGAGGGGAAGGGCCGGGG + Intronic
1005288171 6:24351231-24351253 ACTTCGGAGGGTGAAGGTCATGG + Intronic
1005690866 6:28304183-28304205 TTTGGGGAGGGGGAGGGTCAAGG - Intergenic
1006141775 6:31933723-31933745 TCTTCGGAGCGGGAGTGCCAGGG + Exonic
1006150471 6:31984197-31984219 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006156772 6:32016935-32016957 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006952651 6:37837060-37837082 ACGGGGGAGGGGGAGAGACATGG - Intronic
1007141121 6:39575697-39575719 ACTGCAGAGGAGGAGGGCTCAGG + Intronic
1010732711 6:79408047-79408069 ACTGATCAGGGGGATGGCCAGGG - Intergenic
1010743589 6:79536738-79536760 AGAGAGGAGGGGCAGGGCCAAGG - Intronic
1013530959 6:111018197-111018219 ACCGGGGAGGGGGAGGGGGAGGG + Intronic
1014144164 6:117978288-117978310 ACTGGAGAGGGTGGGGGCCAGGG - Intronic
1015491680 6:133833969-133833991 GCTGGGGTGGGGGAGGGCTAAGG + Intergenic
1016040738 6:139429648-139429670 CCTGCGGACGGGGAGGTTCAAGG - Intergenic
1016083288 6:139881464-139881486 GGTGTGGAGGGGGAGGGGCAAGG + Intergenic
1018447893 6:163874823-163874845 AGTGGCGAGGGAGAGGGCCAAGG - Intergenic
1018602779 6:165563168-165563190 AGAGGGGAGGGGGAGGGGCAGGG + Intronic
1018650126 6:165986256-165986278 TCTCCGAGGGGGGAGGGCCAGGG - Intronic
1019275266 7:172758-172780 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275278 7:172788-172810 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275290 7:172818-172840 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275315 7:172878-172900 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275327 7:172908-172930 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275339 7:172938-172960 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275351 7:172968-172990 AGTGCGGGGGGAGAGGGCCCAGG + Intergenic
1019275411 7:173118-173140 AGTGCGGAGGGAGAGGGCCCAGG + Intergenic
1019275421 7:173148-173170 AGTGCGGAGGGAGAGGGCCCAGG + Intergenic
1019447526 7:1079099-1079121 CCTTTGGAGAGGGAGGGCCAGGG + Intronic
1019925793 7:4191191-4191213 ACTGCGGCGGGGGAGGGCCTGGG - Intronic
1019925812 7:4191236-4191258 ACCGCGGCGGGGGAGGGCCTGGG - Intronic
1020083318 7:5297787-5297809 TAGGCGGAGAGGGAGGGCCAGGG + Intronic
1020281526 7:6652581-6652603 ACTGCGGCGGGGAACGCCCAGGG - Exonic
1020820186 7:12957639-12957661 AGTGCCTAGAGGGAGGGCCAGGG + Intergenic
1021167878 7:17362477-17362499 GGTCCGCAGGGGGAGGGCCAGGG + Intergenic
1022191362 7:28019519-28019541 AAAGCAGAGGGGAAGGGCCACGG - Intronic
1022529171 7:31056527-31056549 CCTGTGGTGGGGGTGGGCCAAGG + Intronic
1023252923 7:38284746-38284768 ACTGGGGGGGGGGAGGGGCTGGG - Intergenic
1023860105 7:44213395-44213417 GCTGCAGAGGGGGGAGGCCAAGG + Exonic
1023864579 7:44232693-44232715 ACTGCGGGGAGGGGCGGCCAGGG + Intronic
1024733105 7:52274293-52274315 GCTGGGGTGGGGCAGGGCCAGGG - Intergenic
1025210959 7:57019412-57019434 CAGGCGGAGAGGGAGGGCCAGGG - Intergenic
1025660996 7:63557435-63557457 CAGGCGGAGAGGGAGGGCCAGGG + Intergenic
1026583117 7:71634229-71634251 ACTGAAGATGGGGAGTGCCATGG + Intronic
1026767567 7:73170123-73170145 AGTTCGGAGTGGGGGGGCCAAGG - Intergenic
1026899604 7:74029529-74029551 AGTGGGGGGCGGGAGGGCCACGG + Intronic
1027044035 7:74979831-74979853 AGTTCGGAGTGGGGGGGCCAAGG - Intronic
1027079611 7:75222527-75222549 AGTTCGGAGTGGGGGGGCCAAGG + Intergenic
1027217910 7:76196039-76196061 ACTGGGGAGGGGGAGGACACAGG + Intergenic
1027250044 7:76393340-76393362 ACTGCGGCGTGGGAGGGGCGGGG - Intronic
1028809621 7:95069266-95069288 AATGTGGAGGGGGAGGGCAGAGG + Intronic
1029280842 7:99434622-99434644 ACTGCGGTGGAGGATGGCAAAGG + Intronic
1029388833 7:100261119-100261141 AGTTCGGAGTGGGGGGGCCAAGG + Intronic
1029477160 7:100791973-100791995 CCAGCGGAGGAGGAGGGACAAGG + Exonic
1032471589 7:132182824-132182846 ACTGCTGAGAGGGAGGGCACAGG + Intronic
1032471594 7:132182847-132182869 ACTGCTGACAGGGAGGGCCTAGG + Intronic
1032510895 7:132471537-132471559 ACTGATGAGGAGCAGGGCCAAGG - Intronic
1033597778 7:142868955-142868977 GCTGCTGAGGGGAAGGGGCAGGG - Exonic
1034527727 7:151676236-151676258 TCTGAGGAGGGGGAGGGGGAGGG + Intronic
1034601562 7:152262191-152262213 AGTGAGGAGGTGGAGGGCCTGGG - Intronic
1034734302 7:153413905-153413927 GGTCCGCAGGGGGAGGGCCAGGG + Intergenic
1035830573 8:2690299-2690321 TCTGCAGAGGGAGAGGGCCCTGG + Intergenic
1036849892 8:12194125-12194147 ACTGAAGAGGGGGCGGGCCGAGG + Intronic
1036871256 8:12436398-12436420 ACTGAAGAGGGGGCGGGCCGAGG + Intergenic
1037104727 8:15093080-15093102 ACTACTAAGGAGGAGGGCCAGGG - Intronic
1037920417 8:22801782-22801804 AGTTTGGTGGGGGAGGGCCACGG - Intronic
1038082232 8:24151743-24151765 ACTGTGGAGGGGAAGGATCAAGG - Intergenic
1038295966 8:26291440-26291462 AGAGCGGAGGGGGAGGGGCGGGG - Intergenic
1038326658 8:26577386-26577408 ACGGCGGGGGAGGAGGGCCCGGG + Intronic
1039428621 8:37507143-37507165 ACTCCCCAGCGGGAGGGCCAAGG + Intergenic
1039434287 8:37548993-37549015 ACTGCCAAGGGGAAGGGGCAGGG - Intergenic
1039549540 8:38432904-38432926 ACTGGGGAGGGGGGGGGGCGCGG - Intronic
1039645551 8:39278277-39278299 AATGGGGAGGGGCAGGGCCATGG + Intronic
1039900945 8:41752149-41752171 ACTGGGGAGGAGGAAGGTCAAGG - Intronic
1040543810 8:48381575-48381597 ACTGGGGAGGGGGAGGACAGAGG - Intergenic
1041791085 8:61697013-61697035 ACTGGTGGGGAGGAGGGCCATGG - Intronic
1042169460 8:65977886-65977908 ACTGCGGGGGGGGTTGGGCATGG + Intergenic
1043508852 8:80930394-80930416 ACTGGGGAGGGGATGGGGCAAGG + Intergenic
1045009357 8:97944090-97944112 ACTGACCAGGGGGAGGGGCAGGG + Intronic
1045484576 8:102621190-102621212 ACTACGTAGGGGAAGGGCCTGGG + Intergenic
1046471417 8:114680156-114680178 ACTTCGGCGGGGAAAGGCCAAGG - Intergenic
1048885332 8:138904877-138904899 ACAGCACAGCGGGAGGGCCATGG + Intronic
1048978707 8:139691194-139691216 AATGAGGAGGGGGAGGGGAAGGG - Intronic
1049059438 8:140264623-140264645 AGAGCGGAGGGGGAGGGCAGGGG + Intronic
1049240723 8:141536201-141536223 ACAGAGGAGGGGTAGAGCCAGGG + Intergenic
1049557716 8:143291354-143291376 AGTGCCGAGGGGGCGGGCCAGGG + Intronic
1049579382 8:143404503-143404525 ACTGAGGTGGGGGATGGGCATGG - Intergenic
1049629963 8:143648485-143648507 GCTGCGGAGGAGGAGAGTCATGG + Intronic
1049976180 9:862509-862531 AATGGGGAGGGGGAGGGGGAGGG + Intronic
1052991776 9:34522906-34522928 GCGGCCGAGGGGGAGGGCCGGGG - Exonic
1053175318 9:35918158-35918180 ACTGTGGAGGAGGAGGGCAGAGG + Intergenic
1055187497 9:73474272-73474294 GCTGGGGAGGGGGAGGGGGAGGG - Intergenic
1055673487 9:78631269-78631291 ACTGCTGAGTGGGAGGGGCAGGG + Intergenic
1056599050 9:88031787-88031809 AGTGAGCAGGGAGAGGGCCACGG + Intergenic
1057070822 9:92098369-92098391 GGTCCGCAGGGGGAGGGCCAGGG - Intronic
1058689509 9:107507492-107507514 GCTGCGGAGGTGGAAGGCCTGGG + Intergenic
1059227401 9:112684912-112684934 ACTGCAGAGGGTGAGGGAAAGGG - Exonic
1059313013 9:113401319-113401341 ACTGTGGAGGGGGCGGACCGTGG - Exonic
1059505969 9:114800126-114800148 AGTGGGGAGGGGGAGGGGGAGGG + Intronic
1059589445 9:115642347-115642369 AAGGAGGTGGGGGAGGGCCAGGG - Intergenic
1060204765 9:121675958-121675980 ATTGTGGAGGAGGAGGTCCAAGG + Intronic
1060897201 9:127225406-127225428 ACTGCGGACGGGGAGGGGTGCGG + Intronic
1061313157 9:129777193-129777215 AGTGGTGAGAGGGAGGGCCACGG - Intergenic
1061519951 9:131112016-131112038 GCTGGGGAGGGGGAGAGGCAAGG - Intronic
1061994621 9:134177265-134177287 ACGGGGGAGGAGGAGGGACACGG - Intergenic
1203768186 EBV:37241-37263 ACAGAGCAGGGGGAGGGGCAGGG + Intergenic
1187825824 X:23333351-23333373 TCTCCGGAGGGGGAGTGCGAGGG + Intergenic
1190457962 X:50643738-50643760 GCTGCCGAGGGGGTGGGCCAGGG - Intronic
1195599199 X:106726895-106726917 ACTGCGGAGCGCGCGCGCCATGG + Exonic
1197708803 X:129652154-129652176 CCTGCGGAGGGGGAGGAGAAGGG + Intronic
1200073224 X:153539052-153539074 TCTGCGGAGGGAGAGGAGCAGGG - Intronic
1200129007 X:153830925-153830947 ACGGCGGCGGGGGAGGGGCGCGG + Intergenic