ID: 1100618413

View in Genome Browser
Species Human (GRCh38)
Location 12:96249385-96249407
Sequence CTGCGGAGGGGGAGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 12, 3: 74, 4: 616}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618413 4 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616
1100618398_1100618413 28 Left 1100618398 12:96249334-96249356 CCCAGGATTTCATGACAGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616
1100618399_1100618413 27 Left 1100618399 12:96249335-96249357 CCAGGATTTCATGACAGCTCAAG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG 0: 1
1: 0
2: 12
3: 74
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618413 Original CRISPR CTGCGGAGGGGGAGGGCCAG GGG Intronic
900158810 1:1213876-1213898 CTGGGGAGGGGGCGGGTGAGGGG - Intronic
900457850 1:2786093-2786115 GTGGGGTGGGGGATGGCCAGGGG - Intronic
900476368 1:2878215-2878237 CTGTTGTGGGGGTGGGCCAGGGG + Intergenic
900513144 1:3069611-3069633 GGGCGGAGGGGGAGGGCCGGGGG + Intronic
900569143 1:3349833-3349855 CTGCGGAGGCTGAGGGCTGGAGG - Intronic
901308495 1:8250757-8250779 GTGGGGAGGGGCACGGCCAGTGG + Intergenic
901630763 1:10647090-10647112 CTGGGGAGGAGGAGGGGGAGGGG + Intronic
901751632 1:11413659-11413681 CTGCTGAGAGGGAGGGACATGGG + Intergenic
901920573 1:12533728-12533750 TTGCGGGCGGGGAGGGACAGGGG - Intergenic
902717671 1:18283577-18283599 CTGTGTAGGGGGAGGGGCACAGG - Intronic
903519249 1:23934974-23934996 GTGGGGAGGGGGAGGGGGAGGGG - Intergenic
903993531 1:27290045-27290067 GTGGGGAGGGGGAGGGGGAGAGG + Intronic
904237670 1:29124889-29124911 CCGAGGAAGGGGCGGGCCAGGGG + Intergenic
904306313 1:29592454-29592476 CAGTGGAGGGGTAGGGGCAGAGG + Intergenic
904591421 1:31617636-31617658 CTGCGGGGAGGGAGGGCCGGCGG - Intergenic
904964355 1:34360325-34360347 CTCCGGAGAGGGAGGGTCTGGGG + Intergenic
905004022 1:34695944-34695966 CTTCAGAGAGGGAGGGGCAGCGG - Intergenic
905820037 1:40981863-40981885 CTGGGGAGGGGGTGGGGCGGGGG + Intronic
905979638 1:42211890-42211912 CTGGGGGTGAGGAGGGCCAGGGG + Intronic
906212003 1:44017250-44017272 GGCCGGAGGGGCAGGGCCAGGGG - Exonic
906527073 1:46500170-46500192 CTGGGGAGGGGGAGGGCATCAGG + Intergenic
906536963 1:46556385-46556407 CTGGGCAGGGTGTGGGCCAGGGG + Intergenic
907216820 1:52870873-52870895 GTGGGGAGGGGGAGGGGGAGAGG + Intronic
907307323 1:53520605-53520627 GTGCGGGGAGGCAGGGCCAGGGG - Intronic
907889036 1:58620508-58620530 CTGGGGAGGGGCAGGGCAATGGG - Intergenic
908107911 1:60864951-60864973 CTGCGGAGGGAGATCGCCACAGG - Intergenic
908257311 1:62313694-62313716 CTGCTGAGGGTGAGGGGCAAGGG + Intronic
908558057 1:65277651-65277673 CAGGGGAGGGGGTGAGCCAGTGG + Intronic
909352680 1:74673399-74673421 CTGCGGAGGGAAGGGGCGAGAGG - Intronic
910931463 1:92446583-92446605 CTGTGGAGGAGGAGATCCAGCGG + Intergenic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911154170 1:94622959-94622981 CTGCGGAAGGGTGAGGCCAGTGG + Intergenic
911602228 1:99857829-99857851 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
911820328 1:102411286-102411308 GGGGGGAGGGGGAGGGACAGGGG + Intergenic
912183347 1:107245118-107245140 ATGTGGTGGGGGAGGGACAGCGG + Intronic
912798669 1:112707336-112707358 CTGCGGAGGAGCCGGGCGAGCGG + Intronic
912935877 1:114003248-114003270 CAGGGAAGGAGGAGGGCCAGGGG + Intergenic
913222056 1:116667622-116667644 GCGCGGAGGGAGAGGGCCAGGGG - Exonic
913997342 1:143662147-143662169 AGGGGGAGGGGGAGGGGCAGAGG - Intergenic
914428563 1:147600076-147600098 GTGCGGCGGGGGAGGGCCGAAGG + Intronic
914887021 1:151593845-151593867 TTGGGGAGGGGGCGGGCCAGGGG + Intergenic
915393340 1:155563111-155563133 CGGCGGAGGAGGAGGAGCAGAGG - Intergenic
915464696 1:156089992-156090014 CTGCGGTGAGGGAGGGGGAGGGG + Intronic
916142717 1:161713166-161713188 CGGCGGAGGCAGAGGCCCAGGGG - Exonic
916314009 1:163427512-163427534 GGGAGGAGGGGGAGGGGCAGTGG - Intergenic
916323736 1:163534146-163534168 CTGTGGAGGGAGAGAGGCAGGGG + Intergenic
916412481 1:164559614-164559636 ATGAGGAGGGGGAGGGGGAGGGG - Exonic
917282416 1:173391204-173391226 CTGCATAGGGGAAGGACCAGAGG - Intergenic
918197570 1:182236401-182236423 CTGCGGAGGATGAGTGCCTGTGG - Intergenic
919823910 1:201490345-201490367 CTGTGGAGGGGAAGGGGAAGCGG + Intronic
920132662 1:203744735-203744757 CTGGGGAGGGGAAGGGGCTGAGG + Intergenic
920311737 1:205052658-205052680 CAGCTGAGGGGAAGGGGCAGGGG + Intronic
920501883 1:206490668-206490690 CAGCGGAGCAGGAGGGGCAGAGG - Intronic
921191198 1:212710244-212710266 ATGCCGAGGTGCAGGGCCAGAGG - Intergenic
922724861 1:227918105-227918127 CTGGGGAGGAGGAGGGCCCTGGG - Intergenic
922740460 1:228011369-228011391 CTGCAGAGGGAGTGGGCCAGTGG - Intronic
923098199 1:230792329-230792351 CTGCAGAGGGGGAGGGCCGATGG - Intronic
923110438 1:230885605-230885627 CTGAGGAGGGTGAGAACCAGAGG - Intergenic
923180027 1:231508758-231508780 GTGAGGAAGGGGATGGCCAGCGG + Intergenic
923672309 1:236051258-236051280 GAGGGGAGGGGGAGGGGCAGGGG - Intronic
924263027 1:242251580-242251602 CTGCACAGGGGTAGGACCAGTGG + Intronic
924772032 1:247087543-247087565 CTGGGCAGGGGGAGGGCCCAGGG - Intergenic
1062903792 10:1166248-1166270 GTGAGGAGGGAGAGGACCAGGGG + Intergenic
1064060070 10:12129763-12129785 CTGCTGCTGGGGAGGCCCAGGGG - Exonic
1064376370 10:14800160-14800182 CAGCTGAGAGGGAGGACCAGGGG + Intergenic
1064376456 10:14800897-14800919 CAGCTGAGAGGGAGGACCAGGGG - Intergenic
1065101344 10:22335596-22335618 CCGCGGAGGAGGAAGGCCAGGGG - Intergenic
1065596668 10:27319859-27319881 CTGGGGAGGCGGCGGGGCAGGGG + Intergenic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1067526068 10:47039375-47039397 CTGCTGAGGGCAGGGGCCAGGGG + Intergenic
1067842131 10:49689232-49689254 CTGTGGAGGAGCAGGGGCAGAGG + Intronic
1067943595 10:50676920-50676942 CTGCAGAGGGGGAGGGGCAGTGG - Intergenic
1068631715 10:59304834-59304856 CGGGGGAGGGGGAGGGGGAGGGG + Intronic
1069514977 10:69070204-69070226 CGGCGGAGGGTGAGTGCCAGTGG - Intergenic
1069615378 10:69803135-69803157 GGGTGGAGGGGGAGGGCCATGGG - Intronic
1069631923 10:69902462-69902484 CTGCGGGGGGGCAGAGGCAGAGG - Intronic
1069720850 10:70548556-70548578 GTGCTGAGTGGGAGGGGCAGTGG + Intronic
1070158336 10:73850416-73850438 CTGCGGTGGGGGGGGGCGGGCGG - Intronic
1070367623 10:75751352-75751374 CTGGGGAGAGGGAGGGGGAGTGG + Intronic
1070409361 10:76125242-76125264 CTGCAGGGGTGGAGGGCTAGGGG + Intronic
1070835633 10:79445475-79445497 CTGCGGAGGGGGGCCGCGAGCGG - Exonic
1070865076 10:79703787-79703809 CTGCAGAGGGGGAGGGGCAGTGG - Exonic
1070878865 10:79841918-79841940 CTGCAGAGGGGGAGGGGCAGTGG - Exonic
1071294841 10:84211920-84211942 CTGGGGAGGGGGCAGGCCATAGG + Intronic
1071568045 10:86681587-86681609 CCGCGGAGGGCCAGGGTCAGAGG - Exonic
1071631971 10:87226008-87226030 CTGCAGAGGGGGAGGGGCAGTGG - Exonic
1071645426 10:87358228-87358250 CTGCAGAGGGGGAGGGGCAGTGG - Exonic
1073007154 10:100333266-100333288 CAGAGGAGGGGGAAGGCCTGAGG + Intergenic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073325803 10:102643568-102643590 GGGCGAAGGGGGAGGGCCGGGGG + Intergenic
1073472554 10:103731858-103731880 GTGCAGAGGGGGAGGGTCAGGGG + Intronic
1075726432 10:124613103-124613125 GGGAGGAGGGGGATGGCCAGTGG + Intronic
1076124896 10:127966233-127966255 CTGCTGAGGGGGATGGACACTGG - Intronic
1076209224 10:128627161-128627183 GTGCGGGCGGGGAGAGCCAGGGG + Intergenic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076513431 10:131028521-131028543 GAGCGGAGGGGGAGAGACAGGGG - Intergenic
1076542620 10:131223834-131223856 GTGGGCAGGGGGAGGGCCAGGGG - Intronic
1076650196 10:131982080-131982102 CTGCGGTGGGCGAGGGGCAGAGG + Intergenic
1076710555 10:132331700-132331722 CTGGGGAGCCGGAGGGCCCGGGG - Intronic
1076895676 10:133310110-133310132 TGGCGGTGGGGGAGGGCCAGGGG + Intronic
1077080784 11:723888-723910 CTGGGGTGTGGGAGGGTCAGGGG - Intronic
1077264575 11:1642414-1642436 CAGTGGAGGGGGCGGGCCAGGGG - Intergenic
1077301832 11:1850960-1850982 GGGCGGAGGGGGAGGCCCACAGG - Intergenic
1077384458 11:2262437-2262459 CTTCGGAGGTGGGGGGCCTGCGG + Intergenic
1077483833 11:2829934-2829956 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
1077886275 11:6390362-6390384 CTGCGGAGGCGGAGGGGGCGGGG - Intergenic
1077917546 11:6621379-6621401 CTGGGCAGGGGCAGGGGCAGGGG + Exonic
1078141908 11:8699201-8699223 CTGTGGAGGAGGTGGGCCACCGG - Exonic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079321590 11:19455995-19456017 CTGCAGAGGGGGAGGGAAGGAGG + Intronic
1079690144 11:23406811-23406833 AGGGGGAGGGGGAGGGGCAGGGG - Intergenic
1082871178 11:57944631-57944653 CCGGGGAGGGGGAGGGGGAGGGG + Intergenic
1083316163 11:61816171-61816193 CTGGGGAGGGAGGGGGTCAGTGG - Intronic
1083377694 11:62239318-62239340 CCAAGGAGTGGGAGGGCCAGTGG - Intergenic
1083630697 11:64093717-64093739 CTACAGAGCGGGAGGCCCAGTGG - Intronic
1083659113 11:64244035-64244057 CTGGGGAGGGGCAGGGGGAGAGG + Exonic
1083689773 11:64400313-64400335 CTGCTGAGGGCCAGGGCCAGAGG + Intergenic
1084177949 11:67433230-67433252 CCGGGGAGGAGGAGGGGCAGGGG + Intronic
1084535306 11:69752988-69753010 CTGGGGAGGGGGACTGCCTGGGG - Intergenic
1084543972 11:69804708-69804730 CTGAGGCTGGGGAGGGGCAGCGG + Intergenic
1084891222 11:72238051-72238073 CTGCAGGGCGGGCGGGCCAGCGG + Exonic
1084892928 11:72245220-72245242 CTGCGGAGAGGGAGGGTCGTGGG + Intronic
1084925003 11:72503574-72503596 GTGGGGAGGGGGAGGGGGAGAGG + Intergenic
1084938000 11:72597473-72597495 CTGGGCAGGGGCAGGGGCAGGGG - Intronic
1085039714 11:73319799-73319821 CTGAGGTGGGTGAGGTCCAGAGG + Intronic
1085041669 11:73330570-73330592 CTGTGGAGGGGCAGGGGCAGAGG + Intronic
1085249752 11:75135204-75135226 ATACGCAGGGGGAGGCCCAGTGG + Intronic
1085776536 11:79371625-79371647 CTGGGGAGGGGCATGGCTAGGGG - Intronic
1086015538 11:82161722-82161744 CTGCGGTGGGGTAGGGGGAGGGG + Intergenic
1087076176 11:94128933-94128955 GCGCGGAGGGGCAGGGCCAGAGG + Exonic
1088103284 11:106177492-106177514 CCGTGGAGGGGGAGGGGGAGGGG + Intergenic
1088522268 11:110712474-110712496 GAGCGGAGGGGGCGGGCCCGAGG - Intronic
1089345970 11:117792122-117792144 GTAGAGAGGGGGAGGGCCAGAGG - Intronic
1089795741 11:120979653-120979675 GTGCTGAGGGAGAGAGCCAGTGG + Intronic
1090277795 11:125431911-125431933 CAGAGGAGTGGGAGGGCCTGAGG + Exonic
1090601874 11:128380650-128380672 CTGGGGAGGGGAAGGGGAAGAGG - Intergenic
1090664392 11:128905280-128905302 CTGCGGAGGAGGCGGGGCTGGGG - Intronic
1090673536 11:128969000-128969022 CTGTGGATGGGGAAAGCCAGGGG + Exonic
1090777158 11:129975663-129975685 CTGGGCAGAGGAAGGGCCAGTGG - Intronic
1091124669 11:133083408-133083430 CTGCGGAGAGGGCTGGCCTGAGG + Intronic
1092204417 12:6606745-6606767 CAGCGGCGCGGGGGGGCCAGGGG + Intronic
1092241051 12:6836891-6836913 CTGGAGAGCGGGAGGGCCGGAGG + Intronic
1092894692 12:13000602-13000624 CTGCGGAGGGGGACGGCCTGAGG - Intergenic
1092949639 12:13489458-13489480 CTGGGCAGGGGCAGGGGCAGTGG + Intergenic
1092999461 12:13981370-13981392 CTGCGGAGAGGGGTGGCCGGTGG + Intergenic
1094555719 12:31497855-31497877 AAGGGGAGGGGGAGGGGCAGTGG + Intronic
1094703936 12:32896842-32896864 CGGCGCGGGGGGCGGGCCAGGGG - Intergenic
1095940156 12:47721439-47721461 CAGCGGAGGGTCAGGGGCAGGGG - Intronic
1096117513 12:49063859-49063881 CTGGGGACATGGAGGGCCAGGGG + Intergenic
1096230520 12:49894365-49894387 CTGCGGTGGTGGAGGGCTGGTGG - Intronic
1096604255 12:52753632-52753654 CTGAGGTGGGGGAGAGCCTGTGG - Intergenic
1096699208 12:53371331-53371353 TTGCGGCTGGGGAGAGCCAGAGG + Intergenic
1096785003 12:54011938-54011960 CTGGGGAGGGGGAGGGGGAGGGG - Exonic
1096809299 12:54159458-54159480 CTGGGGAGGAGAAGCGCCAGGGG - Intergenic
1098206317 12:68113953-68113975 ATGCTGAGGGAGAGGGGCAGTGG + Intergenic
1098888250 12:75982157-75982179 CGGGGGAGGGGGAGGGGGAGGGG + Intergenic
1099202438 12:79691227-79691249 CTGCGGCGGGAGCGGGGCAGAGG - Intergenic
1100618413 12:96249385-96249407 CTGCGGAGGGGGAGGGCCAGGGG + Intronic
1100641888 12:96489945-96489967 CTGGGGAGGGCGCCGGCCAGAGG + Intronic
1101586591 12:106090656-106090678 ATGAGGAGGCGGAGGGTCAGAGG - Intronic
1101845844 12:108362416-108362438 CTGGGGAAGGGCAAGGCCAGAGG + Intergenic
1102555601 12:113724653-113724675 GTCAGGAAGGGGAGGGCCAGGGG + Intergenic
1103321012 12:120092977-120092999 CTGCAGAGGGGAGGGGACAGTGG - Intronic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103420060 12:120773475-120773497 CTGCGGGGAGTGAGGGTCAGAGG + Intronic
1103443624 12:120980365-120980387 CTGGGGTGGGGGAGGGCTGGTGG + Intronic
1103606286 12:122088173-122088195 CAGCAGAGGGGGAGGGGCAGGGG - Intronic
1103978960 12:124723590-124723612 CTGCGGGGGGGGGGGGGCAAGGG + Intergenic
1104553669 12:129780333-129780355 GTGGGGAGGGGGGGGGCCGGGGG + Intronic
1104630594 12:130398299-130398321 CTCTGGAGAGGTAGGGCCAGAGG - Exonic
1104717967 12:131029309-131029331 CAGAGGAGGGGGAGGCACAGAGG - Intronic
1104784083 12:131438604-131438626 CTGGGAATGGTGAGGGCCAGAGG - Intergenic
1104947617 12:132423591-132423613 CCGCGGAGGGAGAGGGGCAGGGG + Intergenic
1105533636 13:21243525-21243547 GGGAGGAGGGTGAGGGCCAGAGG + Intergenic
1106719544 13:32424437-32424459 CTGCTGTGGGTAAGGGCCAGTGG - Intronic
1108492364 13:50994215-50994237 AGGCGGAGGGGGAGGGGGAGGGG - Intergenic
1108509049 13:51138119-51138141 CTGGCGAGGAGGAGGGGCAGAGG + Intergenic
1109630154 13:65034507-65034529 CCGCGGAGGGTGGGGGCCTGGGG + Intergenic
1112306618 13:98280261-98280283 GTGTGGAGGGGGAGGGCATGGGG - Intronic
1113505437 13:110812988-110813010 CTGAGGAGCGGGAGCTCCAGGGG + Intergenic
1113768622 13:112895189-112895211 CTGCGGGAGGGCTGGGCCAGAGG + Intronic
1114484725 14:23055892-23055914 TTGCGGGGGAGGAGGGCTAGGGG - Intronic
1114664588 14:24370109-24370131 CCCCGGAGGCCGAGGGCCAGAGG + Exonic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1115243246 14:31270119-31270141 ATGGGGAAGGGGAGGGCCATAGG - Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115547259 14:34475418-34475440 GGGGGGAGGGGGAGGGCGAGAGG - Intergenic
1116928697 14:50668386-50668408 CCGCGGTGGGGGAGGGGCAGCGG - Intergenic
1118285352 14:64465638-64465660 CTGCGGGGGAGGAGGGTCGGGGG + Intronic
1118348034 14:64953932-64953954 ATGCGGAGGTGGAGTGGCAGTGG - Intronic
1118705051 14:68472460-68472482 CTAAGGAAGGGGAGGTCCAGGGG + Intronic
1118743662 14:68758892-68758914 CAGTGGAGGGGAAGGGTCAGGGG - Intergenic
1118855101 14:69614789-69614811 CAGCAGAGAGGGAAGGCCAGAGG + Intronic
1119043608 14:71297525-71297547 CAGGAGAGTGGGAGGGCCAGGGG + Intergenic
1121220017 14:92278051-92278073 GTGGGGAGGGGCAGGGCCAGGGG + Intergenic
1121486892 14:94323225-94323247 CTGGGCAGGGGGAGGGACAGAGG + Intronic
1122045051 14:99017199-99017221 GGGCGGAGGGGGAGGTCCGGAGG - Intergenic
1122296612 14:100709450-100709472 TTGCTGAGGGGGCGGGCCAGCGG + Intergenic
1122371194 14:101229937-101229959 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122371226 14:101230007-101230029 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122371267 14:101230097-101230119 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122371273 14:101230114-101230136 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122371279 14:101230131-101230153 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122371285 14:101230148-101230170 CTGCGGAGGGGGCGAGGCTGCGG - Intergenic
1122384555 14:101334981-101335003 CTGGGGGGTGGGAGGGTCAGGGG + Intergenic
1122616346 14:103020495-103020517 ACGCGGAGGCCGAGGGCCAGAGG + Intronic
1122782244 14:104148658-104148680 CCGGGGAGGGGGAGGGGGAGGGG + Intronic
1122796779 14:104210067-104210089 CTGGAGAGAGGCAGGGCCAGTGG + Intergenic
1122887228 14:104715507-104715529 CTGCGGAGAGGGAGGGGATGGGG - Intronic
1123021626 14:105400468-105400490 CCGCTCAGGAGGAGGGCCAGGGG + Intronic
1123023973 14:105415023-105415045 CTGCGGGTGGGGAGGCGCAGTGG - Intronic
1123038997 14:105482817-105482839 CTGTGGAGGGTCAGGGTCAGGGG - Intergenic
1123044216 14:105503475-105503497 CTGCTGAGGGACAGGGCCGGGGG + Intergenic
1123047571 14:105526437-105526459 CTGCGGAGGGGGCGGGGCACCGG + Intergenic
1123427856 15:20187502-20187524 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
1124696380 15:31867899-31867921 GAGCGGAGGGGGAGGGGCGGGGG + Intronic
1125685161 15:41559419-41559441 CTGCGGAGGGGCGCGGCCGGGGG + Intronic
1125712266 15:41796563-41796585 CTGTGGAAGGGGAGGAGCAGGGG - Intronic
1125723280 15:41855354-41855376 CTGCGGAGGGCGGAGGCCAGGGG - Exonic
1126645841 15:50874219-50874241 CTGCGGAGGGCGGGGGGCGGGGG - Intergenic
1126894918 15:53247737-53247759 CTTCAGAGGGAGAAGGCCAGGGG - Intergenic
1127507654 15:59611060-59611082 GAGGGGAGGGGGAGGGCGAGGGG - Intronic
1127507663 15:59611077-59611099 AAGGGGAGGGGGAGGGCGAGGGG - Intronic
1127980758 15:64033252-64033274 CTGGGGAGGGGGAGGGGGAGGGG + Intronic
1128417481 15:67459798-67459820 CTGCAAAGGAGCAGGGCCAGTGG - Intronic
1128497354 15:68206101-68206123 CTGCGGAAGGGGTGGGGCTGAGG - Intronic
1128843896 15:70872419-70872441 AGGAGGAGGGGGAGGGCGAGGGG + Intronic
1129244495 15:74271333-74271355 CTGGGGAGGGGTTGGGCTAGGGG - Intronic
1129686081 15:77686815-77686837 CTGAGGTGGGGGAGGCCCAGGGG - Intronic
1129862522 15:78873413-78873435 CGGCGGGGGGGGAGGGGCGGTGG + Intronic
1130032572 15:80328922-80328944 ATGGGGAGGTGGAGGGACAGTGG + Intergenic
1132111545 15:99105432-99105454 CTGCGCTGGCGGAGGGCGAGCGG + Exonic
1132311017 15:100858156-100858178 CTGCCCAGGAGGAGGGGCAGTGG + Intergenic
1132374605 15:101320707-101320729 CTGAAGAGATGGAGGGCCAGAGG + Intronic
1132563655 16:610646-610668 CGGCGCAGGGGCAGGGGCAGTGG - Intronic
1132594107 16:740501-740523 CTGCGCAGGGGAAGGGGAAGAGG + Intronic
1132604584 16:788425-788447 CCGCGGCGGGGGCGGGCCGGGGG - Intergenic
1132802738 16:1762328-1762350 CTGCGGAGGGAGGGGCACAGAGG - Intronic
1132898066 16:2238245-2238267 CTGCGGTGGGGCAGGGGCAGGGG - Intronic
1133036474 16:3036648-3036670 GTGCGGAAGGGGAGGGGGAGCGG - Intronic
1133229714 16:4360760-4360782 GTGAGGAGGGGCAGGGCCAGCGG - Intronic
1133801592 16:9090319-9090341 CGGCGGAGGGCGCCGGCCAGAGG - Intergenic
1134449351 16:14354087-14354109 AGGGGGAGGGGGAGGGGCAGAGG + Intergenic
1134450991 16:14363396-14363418 CTGCTGGGGGGCAGGGACAGTGG + Intergenic
1134547615 16:15122816-15122838 TTGGGGAGGGGGAGGGGAAGGGG + Intronic
1135096388 16:19568196-19568218 CTACGTAGGGTGAGGCCCAGGGG + Intronic
1135312779 16:21418985-21419007 TTGGGGAGGGGGAGGGGGAGGGG + Intronic
1135446112 16:22519897-22519919 TTGGGGAGGGGGAGGGGGAGGGG - Intronic
1135821715 16:25691874-25691896 CTGCGAAGGGGGCGGGGGAGCGG - Intergenic
1136151926 16:28356713-28356735 CAGGGGAGGGGGAGGGGAAGGGG + Intronic
1136171772 16:28494381-28494403 CTGGGGAGGGGGAGAGGGAGGGG - Intronic
1136211152 16:28758569-28758591 CAGGGGAGGGGGAGGGGAAGGGG - Intronic
1136255873 16:29038521-29038543 CAGGGGAGGGGGAGGGGAAGGGG - Intergenic
1136403638 16:30031148-30031170 GTGGGGAGGGGGAGGGGGAGGGG + Exonic
1136856439 16:33662259-33662281 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1137600376 16:49752287-49752309 GTGGGGTGGGGGAGGGCCACTGG - Intronic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1138345592 16:56318179-56318201 CTGCAGAGAGGGAGGGGCGGGGG + Intronic
1138490484 16:57373484-57373506 CTGAGGAGGGGGCTGGCTAGCGG - Intronic
1139392185 16:66612025-66612047 CTCCGGAGGGGCTGGGCCTGAGG + Intronic
1139546629 16:67652861-67652883 CGGCGGCGGGGGAGGGGCGGAGG + Intronic
1139857143 16:69990131-69990153 TTGGGGAGGGGGAGGGGAAGGGG + Intergenic
1140418621 16:74797225-74797247 CTGCAGAGGGGAATGGGCAGGGG + Intergenic
1140612791 16:76621420-76621442 CAGGGGAGGGGCAGGGTCAGAGG - Intronic
1140824060 16:78689674-78689696 CAGGGGAGTGGGAGGGTCAGTGG - Intronic
1141083752 16:81076959-81076981 CTGGGGAGGGGCGGGGCCTGAGG - Intronic
1141118236 16:81330109-81330131 TTGAGGAGGGGCAGGGCCAGTGG - Intronic
1141156773 16:81602574-81602596 CTGGGGCGGGCGAGGGGCAGGGG - Intronic
1141611083 16:85181561-85181583 TTCCGGAGGGAGAGGGTCAGAGG + Intronic
1141819015 16:86432323-86432345 CTGGGAAGGGTGAGGGTCAGAGG + Intergenic
1142138365 16:88461693-88461715 CTGAAGGAGGGGAGGGCCAGCGG - Intronic
1142153729 16:88523839-88523861 GTGCGGGTGGGGAGGGGCAGGGG - Intronic
1142194305 16:88732536-88732558 CTGCGGAGGGCAAGGGTCAGGGG + Intronic
1142250012 16:88987037-88987059 CTGGGGAGAGGGAGGGACGGAGG - Intergenic
1142314255 16:89333519-89333541 CTGGGGAGAGGGAGGGACGGAGG - Intronic
1142323376 16:89399497-89399519 CTGGGGAGAGGGAGGGACGGAGG + Intronic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1203118019 16_KI270728v1_random:1510736-1510758 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1142836885 17:2593925-2593947 CGGGGGAGGGGGAGGGAGAGGGG - Exonic
1143477639 17:7211759-7211781 TGGGGGAGGGGGAGGGGCAGAGG + Intronic
1143579821 17:7818900-7818922 CAGCCTAGGGGGAGGCCCAGAGG - Exonic
1143584372 17:7844050-7844072 CTGCGGGGGGGGGGGTCCTGAGG - Intronic
1143609307 17:8008385-8008407 ATGCTGAGGGGCAGGGCCAGAGG - Intronic
1143704613 17:8687727-8687749 GTGGGGAGGGGGAGGGGGAGAGG - Intergenic
1143783371 17:9240734-9240756 CTGGGCAGGGGCAGGGGCAGGGG - Exonic
1143796838 17:9343760-9343782 CGGCAGATGGGGAGGGCCAAGGG - Intronic
1144735635 17:17553898-17553920 CAGCGGGGAGGGAGGGCGAGTGG - Intronic
1145279605 17:21457905-21457927 CTGCTCAGCAGGAGGGCCAGAGG + Intergenic
1146449029 17:32957257-32957279 CTGAGGAGGGAGAGGAACAGGGG - Intergenic
1147335656 17:39725668-39725690 GTCAGGAGTGGGAGGGCCAGAGG - Intronic
1147386878 17:40088219-40088241 CTGTGGAGCGGCAGGGCCACAGG - Intronic
1147420400 17:40319568-40319590 CTGAGGAGGGGGAGTGTCAGGGG - Intronic
1147611373 17:41803536-41803558 CTGGGGAGGGGGAGGGGCTTTGG - Intronic
1147742919 17:42678987-42679009 GGGGGGAGGGGGAGGGGCAGGGG - Exonic
1147784882 17:42972322-42972344 ATGGGGAGGGGGAGGGGGAGGGG - Intronic
1147973105 17:44230497-44230519 CTGCAGGGGGAGAGGGTCAGGGG - Intergenic
1147987430 17:44314710-44314732 GTGGGGAGGCAGAGGGCCAGAGG - Intronic
1148052499 17:44776016-44776038 CTGGGGAGCTGGAGGGCCCGGGG + Intronic
1148225258 17:45894748-45894770 CTGCGGAGAGGGAGGGCGAGGGG - Intronic
1148996183 17:51711935-51711957 CTGCTGGGGGAGAGGGGCAGCGG + Intronic
1149314086 17:55422137-55422159 CTGGGGAGGGGCGGGGCGAGGGG + Intergenic
1149444030 17:56699743-56699765 GGGCGGAGGGGCCGGGCCAGAGG + Intergenic
1149533687 17:57415803-57415825 CTGTGGAGGGGTGGGGGCAGAGG - Intronic
1149680955 17:58506930-58506952 CTTCTGAGAGGGAGTGCCAGAGG - Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150286857 17:63959528-63959550 CTGCGGGGGCGGAGGGGAAGGGG + Intronic
1150561883 17:66302200-66302222 CTGAGGCGGAGGAGGGCGAGAGG + Intergenic
1150850756 17:68701694-68701716 ATGTGGAGGGTCAGGGCCAGAGG + Intergenic
1151208965 17:72529461-72529483 CTGGGGAAAGGGAGGCCCAGGGG + Intergenic
1151560467 17:74866931-74866953 CTGGGGAAGGGGAGGACCTGGGG - Exonic
1152241794 17:79164795-79164817 CAGCGGGCTGGGAGGGCCAGGGG + Intronic
1152361527 17:79835291-79835313 GCGCGCAGGGGAAGGGCCAGGGG - Exonic
1152362438 17:79838980-79839002 CGGCGGAGGGCGGGGGCCCGGGG - Intronic
1152461503 17:80444610-80444632 CTGCGGCAGGGGAGGGCGTGGGG + Intergenic
1152562165 17:81083988-81084010 CTGCGGGGGGGCAGCCCCAGGGG - Intronic
1152687430 17:81701515-81701537 CTGCTGGGGGGGACCGCCAGAGG - Exonic
1152854185 17:82654531-82654553 CTGCGGCAGGGTAGGGACAGTGG + Intergenic
1152924152 17:83079877-83079899 CGGCGGCGGGGGCGGGCCCGGGG - Exonic
1153650496 18:7235627-7235649 CTGGGGAGACGGAGGCCCAGAGG + Intergenic
1154000146 18:10475790-10475812 CTGAGGGGGGGGGGGGTCAGTGG + Intronic
1154009059 18:10560074-10560096 CTGGGGAGGGGCAGGGTGAGGGG - Intergenic
1154033617 18:10776680-10776702 CTGAGGAGTGGGAGCGGCAGAGG + Intronic
1155246935 18:23919720-23919742 CTGCGGGGCTGGAGAGCCAGAGG + Intronic
1155392210 18:25349908-25349930 CGGCGGAGCGCGAGGGCCGGAGG - Intronic
1155811716 18:30244584-30244606 CTGAGGTGGGGAATGGCCAGGGG - Intergenic
1156012632 18:32512454-32512476 TTGAGGAGGGGGTGGACCAGGGG - Intergenic
1156253882 18:35377106-35377128 CAGCGGAGGGGAGGGGCCTGGGG + Intronic
1157161551 18:45318386-45318408 CTGCTGAGAGGAAGGGCCACAGG + Intronic
1157556302 18:48615278-48615300 CTGTGGAGGTGGACGGGCAGAGG + Intronic
1160559803 18:79749238-79749260 GAGAGGAGGGGGAGGGCGAGAGG - Intronic
1160628816 18:80231206-80231228 GTGCTGAGAGGTAGGGCCAGGGG + Intronic
1160975524 19:1790520-1790542 CAGAGGAGGGGGAGGAGCAGAGG - Intronic
1161074502 19:2278816-2278838 TCGCGGAGGGAGAGGCCCAGTGG + Exonic
1161441250 19:4292797-4292819 CTGGAGAGGGGAAGGACCAGAGG - Exonic
1161490166 19:4557119-4557141 GAGTGGAGGGGTAGGGCCAGGGG - Intronic
1161706741 19:5825655-5825677 CTGCGGAGGGTCAGGGCCCATGG + Intronic
1163091509 19:15023189-15023211 CAGGGGAGAGGGAGGGCCATGGG - Exonic
1163179559 19:15589319-15589341 GTGGGGAGGCAGAGGGCCAGTGG + Intergenic
1163779469 19:19239053-19239075 CTCAGGAGGGAGAGGCCCAGTGG - Intronic
1163809426 19:19421346-19421368 GTGAGGAGGGGCAGGGCCATAGG - Intronic
1163817454 19:19475494-19475516 CTGGGGAGGGGCTGGGGCAGTGG - Intronic
1164698462 19:30264364-30264386 CTGCGGGGGGCGGGGGCCTGGGG - Intronic
1164839477 19:31381489-31381511 GTGCAGAGAGGGAGGGCAAGAGG - Intergenic
1164941071 19:32252580-32252602 GTGCAGGGCGGGAGGGCCAGAGG + Intergenic
1165092217 19:33393251-33393273 CTGGCGTGGGGGAGGGCCCGGGG + Intronic
1165145704 19:33728710-33728732 CTTAGGAGGGGGAGGTGCAGGGG + Intronic
1165307832 19:35013167-35013189 CTGCGGAGGCCGAGGGCTGGTGG + Intronic
1165783672 19:38448332-38448354 CTGTGGAGGGTGAGAGCCAAGGG - Intronic
1166112926 19:40634090-40634112 CTGCGGTGGGGGAAGATCAGAGG + Intergenic
1166732729 19:45067992-45068014 CTGGGTGGGGGCAGGGCCAGAGG - Intronic
1167040663 19:47020983-47021005 CTGCAGCGGGAGGGGGCCAGGGG - Intronic
1167077936 19:47260450-47260472 CTGAGGATGGGGAGGGGCAGAGG + Intronic
1167505517 19:49869184-49869206 CTGTGGAGGTGGGGGGCGAGGGG + Exonic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167594820 19:50422108-50422130 CTCCGGAGGTGAAGGGCAAGGGG - Intronic
1167643827 19:50695391-50695413 CGGCGGAGGGGGCCGGGCAGGGG + Intronic
1168357885 19:55713684-55713706 GTGGGGAGGGGGAGGGAGAGGGG - Intronic
1168650025 19:58086854-58086876 CTGCGGAAGGGGATGGGGAGTGG + Intronic
925581123 2:5412183-5412205 CGGCAGAGGGGGAGGGGTAGAGG + Intergenic
927148254 2:20180745-20180767 CTGAGGAGGGGGAGTGGGAGTGG - Intergenic
927297330 2:21469731-21469753 CTAAGGAGGTGGAGGGCTAGAGG - Intergenic
927920790 2:26970763-26970785 CGGCGGAGGCGGAGGGGGAGGGG - Exonic
928132793 2:28665298-28665320 CAGAGGAAGGGGAGGGCCTGTGG - Intergenic
931376633 2:61713856-61713878 GTGGGGATGGGGAGGGACAGGGG - Intergenic
931576215 2:63721703-63721725 AGGAGGAGGGGGAGGGGCAGGGG - Intronic
931696343 2:64873567-64873589 CTGCGGCGGGAGAGAGGCAGGGG - Intergenic
932131285 2:69189627-69189649 CTGTGGAGGTGGTGGGTCAGGGG + Intronic
932398954 2:71466584-71466606 CGGCGGGCGGGGAGGGACAGGGG - Intronic
932438471 2:71717044-71717066 CTGCTGAGGGGGAGGGGTGGCGG - Intergenic
932490157 2:72115222-72115244 GTGTGGGGTGGGAGGGCCAGGGG + Intergenic
932506798 2:72241606-72241628 TTGGGGAGGGGGAGCGTCAGGGG + Intronic
932702946 2:74003292-74003314 CAGCTGAGGGGGAGGGGCGGCGG + Intronic
932812429 2:74835625-74835647 CCGGGGACGGGCAGGGCCAGGGG + Intronic
933675182 2:85049420-85049442 CTGAGAAGCGGAAGGGCCAGAGG - Exonic
933937757 2:87219968-87219990 CGGTGGAGGGGCAGGGGCAGGGG + Intergenic
933977045 2:87520082-87520104 ATGGGGAGCGGCAGGGCCAGTGG + Intergenic
934567906 2:95350702-95350724 CAGTGGAGGTGGGGGGCCAGTGG + Intronic
934614779 2:95764266-95764288 CAGAGGAGGGGCAGAGCCAGTGG - Intergenic
934646124 2:96060228-96060250 CTGAGGAGGGGCAGAGCCAGTGG + Intergenic
934839527 2:97616311-97616333 CTGAGGCGGGGCAGAGCCAGTGG + Intergenic
935296092 2:101650935-101650957 CTCTGGAGAGGCAGGGCCAGAGG + Intergenic
936316772 2:111430723-111430745 ATGGGGAGCGGCAGGGCCAGTGG - Intergenic
936355382 2:111745805-111745827 CGGTGGAGGGGCAGGGGCAGGGG - Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937876904 2:126832769-126832791 CCTGGTAGGGGGAGGGCCAGGGG + Intergenic
937968666 2:127533772-127533794 CTGCAGAGGTGGAGACCCAGTGG - Intergenic
938834801 2:135089933-135089955 TTGCGGGAGGGGAGGGCTAGGGG + Intronic
939990306 2:148872092-148872114 TTGGGGGGGGGCAGGGCCAGAGG - Intergenic
941929871 2:170929083-170929105 GGGCGGAGAGGGAGGGCCGGAGG - Exonic
943890263 2:193277289-193277311 AGGCGGAGGGGGAGGGAGAGGGG - Intergenic
946213139 2:218163425-218163447 CTGCAGAGGGGAAGGGCTAAGGG + Exonic
946411872 2:219519432-219519454 CAGAGGAGGGTGTGGGCCAGAGG - Intronic
947651128 2:231786868-231786890 TTCTGGAGTGGGAGGGCCAGAGG - Intronic
948273032 2:236688378-236688400 CTGCAGGATGGGAGGGCCAGGGG + Intergenic
948468341 2:238162752-238162774 CTGGGGACCGGGAGGCCCAGGGG - Exonic
948625469 2:239265575-239265597 CTGCGGAGCAGGAGAGTCAGGGG - Intronic
948725159 2:239929932-239929954 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948725184 2:239930034-239930056 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948725209 2:239930136-239930158 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948794150 2:240393592-240393614 GTGTGGTGGGGGATGGCCAGGGG - Intergenic
948914922 2:241029789-241029811 GAGCGGAGGGGGATGGCCAGGGG - Intronic
948953899 2:241272639-241272661 CCGCGGAGGGGGAGGGGCCCGGG - Intronic
949005033 2:241641030-241641052 CTGCAGAGGGGCAAGGGCAGAGG + Intronic
949024937 2:241763037-241763059 GTGGGGAGGGTGAGGGCCTGGGG + Intronic
1168760839 20:348270-348292 CGTCGGAGGAGGAGGGCGAGAGG - Intronic
1170494846 20:16914854-16914876 CTGTGAAGGGGCATGGCCAGGGG + Intergenic
1170597903 20:17819253-17819275 GTGGGGAGGGGCAAGGCCAGAGG + Intergenic
1170858800 20:20083335-20083357 CTGGGGAGGGGGAGGTTCGGAGG + Intronic
1171387446 20:24779864-24779886 CTGAGGAAGGGGAGGAACAGAGG - Intergenic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1172083183 20:32358573-32358595 CGGCGGTGGGGGAGGGGCGGCGG - Exonic
1172117989 20:32583324-32583346 CCGCGGAGGGGGAGGGGGAGGGG + Intronic
1172993436 20:39052400-39052422 CGGCAGAGGGGCAGGGGCAGGGG + Intergenic
1173418529 20:42880096-42880118 CTGAGGAGGGGCAGGCCCGGGGG + Intronic
1173649309 20:44652855-44652877 GTGGGGAGGAGGCGGGCCAGAGG - Intergenic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1174058999 20:47819244-47819266 CTGCTGGGAGGGAGGGGCAGAGG - Intergenic
1174572161 20:51509502-51509524 CTGGGGAGGGGAAGGGAAAGAGG - Intronic
1175225540 20:57441881-57441903 ATGGGCAGGGGGAGGGGCAGGGG + Intergenic
1175464264 20:59179316-59179338 GTGCGGAGGAGGAAGGCAAGTGG - Intergenic
1175561343 20:59933416-59933438 CTGCCGAGGGGGAGGGGGTGCGG - Intronic
1175765344 20:61588614-61588636 CTCGGGAGGGGGAGGGCCCTGGG - Intronic
1175892308 20:62321237-62321259 CTGTGGAGGGGTGGGGCCAGTGG + Intronic
1175892427 20:62321575-62321597 CTGTGGAGGGGTGGGGCCAGTGG + Intronic
1175892485 20:62321727-62321749 CAGTGGAGGGGTGGGGCCAGTGG + Intronic
1175996739 20:62815354-62815376 CTGAGGAGGGGGCTGGCCACAGG + Intergenic
1176020646 20:62960935-62960957 CTGTCGAGGGTGGGGGCCAGCGG - Intronic
1176029538 20:63005294-63005316 CGGCGGGGGGGGGAGGCCAGGGG + Intergenic
1176036945 20:63044161-63044183 CTGCGGACCGGGAATGCCAGGGG + Intergenic
1176061693 20:63175460-63175482 CTGCGGGGCGGGCGGGGCAGAGG + Intergenic
1176308383 21:5136261-5136283 CTGCGGAGGGGGATGGACTGAGG + Intronic
1176415858 21:6474445-6474467 CTGTTGAGGGGGAGTCCCAGGGG + Intergenic
1178083677 21:29091947-29091969 CTGAGCATGGGGAGGGCTAGGGG + Intronic
1178117194 21:29429463-29429485 CTGCAGGGGGTGAGGGGCAGGGG - Intronic
1178914150 21:36697737-36697759 CTGGCGCAGGGGAGGGCCAGGGG + Intergenic
1179289511 21:40006239-40006261 CTGGGGAGAGGGAGGGCCTGGGG + Intergenic
1179457257 21:41508108-41508130 AGGCGGAGGCGGAGGGCGAGGGG - Intronic
1179612165 21:42559455-42559477 CTGGGGAGGGGCCGGGCCACAGG - Intronic
1179691358 21:43082779-43082801 CTGTTGAGGGGGAGTCCCAGGGG + Intergenic
1179714610 21:43280594-43280616 CAGGGGAGGTGGAGGGGCAGTGG + Intergenic
1179793087 21:43766864-43766886 CTGTGAAAGGGGAGGGCCTGGGG + Intergenic
1179848677 21:44125771-44125793 CTGCGGAGGGGGATGGACTGAGG - Intronic
1179986897 21:44927227-44927249 CTAAGGATGGAGAGGGCCAGTGG + Intronic
1180181898 21:46121791-46121813 CTGCTGAAGAGGAGAGCCAGGGG - Intronic
1180745722 22:18087677-18087699 CTGCTGAGGGTCAGGGCCACTGG - Intronic
1180859301 22:19068156-19068178 CCGCGGCAGGGGCGGGCCAGAGG - Exonic
1181037126 22:20175094-20175116 CCACGGAGCGGGAGGGCCTGTGG + Intergenic
1181361761 22:22343236-22343258 CTGAGGAGGGTGAGGAGCAGAGG - Intergenic
1181477878 22:23180036-23180058 CTGCGGCGTGGTAGGGGCAGAGG + Intronic
1182036549 22:27202979-27203001 CCGAGGAGGGGGAGGGCCGCGGG - Intergenic
1182142933 22:27978239-27978261 CTGAGGAGGGGCAGGGCCACAGG + Exonic
1183187277 22:36299430-36299452 CTGAAGAGGGGGAGGGGCCGTGG - Intronic
1183361856 22:37386958-37386980 CCGTGGAGGGGGATGGCCACAGG + Intronic
1183406429 22:37632722-37632744 CTGGGGAGAGGAAGGGGCAGAGG + Exonic
1183706071 22:39475588-39475610 GTGATGAAGGGGAGGGCCAGGGG - Intronic
1183706844 22:39479471-39479493 CTGCTGTGGGGAGGGGCCAGGGG - Intronic
1184136799 22:42554456-42554478 CTGTGGAGGGAGAGTGACAGTGG + Intronic
1184192134 22:42901915-42901937 CCACGGAGAGGAAGGGCCAGGGG - Intronic
1184272685 22:43393544-43393566 CTGTGGTGGGGGAGGGGCTGTGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184465942 22:44668885-44668907 CTGCGGAAGGGGGGGCCCCGGGG + Intronic
1184523209 22:45007743-45007765 GCGCGGCGGGGGAGGGGCAGCGG + Intronic
1184561794 22:45268201-45268223 GAGCGGAGGGGCAGGGGCAGCGG - Intergenic
1184582945 22:45429496-45429518 CTGGGGAGGAGGAGGGACAGTGG + Intronic
1184677919 22:46053690-46053712 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
1184766688 22:46576155-46576177 CTGGGGAGGGGGAGGCAGAGAGG + Intronic
950052501 3:10003116-10003138 CTGGGGAGGTGGTGAGCCAGAGG - Intronic
951555433 3:23916747-23916769 CTCCGCAGGGGGAGAGCCCGCGG + Exonic
951881351 3:27484018-27484040 CTCCGCAGGGGGAGGGCGCGGGG - Intronic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
953044088 3:39280216-39280238 CTGCGGAGCTGGAGGGAGAGAGG + Intronic
953165025 3:40457404-40457426 CAGCGGAGGTGGAGGTCGAGCGG - Exonic
953801089 3:46023137-46023159 CGGCGCAGGGGGCGGGCCCGTGG + Intronic
954089122 3:48270838-48270860 CTGCTTAGGGGAAGGGCTAGGGG + Exonic
954200866 3:49022323-49022345 CTGCGGAGGGAAAGGGTCAGGGG - Intronic
954412997 3:50379282-50379304 CTGTGGGGGAGGAGGGCCAGAGG - Intronic
954632470 3:52055045-52055067 CTGCAGCGGGGGAGGGCCACTGG + Intronic
954744749 3:52780858-52780880 CTGGGGTGGGGGTGAGCCAGGGG - Intronic
955173215 3:56585104-56585126 ATGGGGAGGGGGAGGGGGAGAGG + Intronic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955687817 3:61563072-61563094 CAGCGGAGGGAAAGGGCCACGGG - Intronic
955961233 3:64343247-64343269 CTGGGGTGGTGGAGGGGCAGGGG - Intronic
957794383 3:84984553-84984575 CTGTGGAGGGTGAGAGGCAGTGG - Intronic
959988940 3:112609086-112609108 CTGGGCAGGGGCAGGGGCAGGGG - Intronic
960829846 3:121834922-121834944 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
961003305 3:123388535-123388557 CTCCGGAGAGGCTGGGCCAGAGG + Intronic
961435483 3:126913613-126913635 CTGAGGTGGGGCAGGGCCCGTGG - Intronic
961495253 3:127286942-127286964 GGGCGGTGGGGGAGGGGCAGAGG + Intergenic
961520161 3:127462660-127462682 CTCCGAAGAGGGAAGGCCAGTGG - Intergenic
961692664 3:128681161-128681183 CTGCGGAGGCGGCGGCCCCGAGG + Intergenic
961716814 3:128863538-128863560 ATGTGTAGGGGGAGGGGCAGTGG + Intergenic
961742386 3:129040822-129040844 GTGGGGAGGGGCAGGGGCAGAGG + Intergenic
961940959 3:130636936-130636958 CAGGGGAGGGGGAGGGGGAGGGG - Intronic
962009698 3:131381530-131381552 CTGCGGTGGGGCGGGGCTAGAGG - Intergenic
962770842 3:138608990-138609012 GTGCGGAGCGGGCGGGCCCGAGG - Intronic
963742958 3:149097926-149097948 GTGGGGAGGGGGAGGGGGAGGGG + Intergenic
966413635 3:179667587-179667609 CTGCAGCTGGGGAAGGCCAGGGG - Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
968085770 3:195873264-195873286 CTGGGCAGGGGCAGGGGCAGGGG + Intronic
968457122 4:705626-705648 CCGCGGGGCGCGAGGGCCAGGGG - Intergenic
968613143 4:1566062-1566084 CTGCAGAGGGGGAGGCTCGGCGG + Intergenic
968651859 4:1763331-1763353 CTGGGGAGGGGCCGGGCCATGGG + Intergenic
968753308 4:2401539-2401561 AGGAGGAGGGGGAGGGCCTGGGG - Intronic
968900559 4:3429729-3429751 CTGGGCAGTGGGAGGCCCAGGGG + Intronic
968936421 4:3612702-3612724 CTGGGGAGGGGCTGGTCCAGTGG + Intergenic
969327817 4:6453860-6453882 CTGTGGAGGCAGACGGCCAGAGG + Intronic
969514556 4:7639089-7639111 CTGTGGAGGGAGAGGGCCTGGGG + Intronic
969565022 4:7972233-7972255 CTGTGGAGGGGCAGGGCCCTGGG - Intronic
970360411 4:15303588-15303610 CTGAGGAGGCAGGGGGCCAGGGG + Intergenic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
972322852 4:37988768-37988790 CTGAGGAGGGGGCGGTCCATCGG - Intronic
972821400 4:42705940-42705962 CTTTGGAGGTGGAGGGGCAGTGG - Intergenic
974944423 4:68509952-68509974 CTGTGGTGGGGTAGGGGCAGGGG - Intergenic
975793871 4:77984776-77984798 GTGGGGAGGGGGAGAGGCAGAGG + Intergenic
975877984 4:78867061-78867083 CTGGGGAGGCTGAGGGGCAGAGG + Intronic
976702322 4:87984673-87984695 CTGGGGAGGGTGAGGGTAAGGGG + Intergenic
977219942 4:94327046-94327068 CTGGGGAGGGGGATGCCAAGTGG + Intronic
980999649 4:139816522-139816544 CAGCGGTGGGGGAGGGAGAGAGG + Intronic
982336878 4:154249887-154249909 CTGCTGAGGGGGAGGGAGGGAGG + Intronic
985445455 4:190019000-190019022 CTCCGGAGCTGGAGAGCCAGGGG + Intergenic
985877998 5:2614791-2614813 GTGCGGGAGGGGAGGCCCAGTGG - Intergenic
986330811 5:6714616-6714638 CAGCGGAGGGGGCGGCCCCGGGG + Exonic
986608621 5:9546171-9546193 CGGCGGCGGGGGCGGGGCAGGGG - Intergenic
986685539 5:10272708-10272730 CCGCAGAGGGGGACGGCCAGAGG - Intergenic
988439282 5:31213762-31213784 CTGGGGAGGGTGAGGGGAAGAGG - Intronic
988846836 5:35135869-35135891 CTGTGGTGTGGGAAGGCCAGGGG + Intronic
989637982 5:43556765-43556787 CCGCGGAGGGGGCGGGCCTGAGG - Exonic
990446235 5:55896684-55896706 CTGGGGAGGGGGAAGGGGAGTGG - Intronic
990743700 5:58937232-58937254 CAGGGGAGGGGGAGGGGCGGGGG + Intergenic
990909994 5:60843740-60843762 GAGCGGAGCGGGAGGGGCAGAGG - Intronic
991045393 5:62217820-62217842 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
992627424 5:78648447-78648469 CTGCGGGAGGGGAGAGCCGGTGG - Intronic
992861600 5:80916552-80916574 ATGGGGAGGGGGTGGGGCAGGGG - Intergenic
992993121 5:82305587-82305609 CTGCGGAGGTAGGGGGCCGGGGG + Intronic
995106229 5:108380992-108381014 CGGTGGCGGGGGAGGGCCTGCGG - Exonic
995236412 5:109833688-109833710 GTGGGGAGGGGGAGGGGGAGGGG + Intronic
996057552 5:118998488-118998510 AGGCGGAGGGGGAGGGGGAGGGG - Intergenic
996398383 5:123035511-123035533 CTGAGGACGGGGAGGACTAGGGG - Intronic
997193623 5:131962898-131962920 CTGCTGAGGGGAAAGGACAGTGG - Intronic
997445264 5:133935662-133935684 CTGAAGATGGGGAGGGCGAGGGG - Intergenic
997660841 5:135588466-135588488 CTGCGGGGGCTGCGGGCCAGAGG + Intergenic
998251856 5:140558685-140558707 TTGAGCAGGGGGAGGGGCAGGGG + Exonic
999204458 5:149837962-149837984 CTGGGGTGGGGCAGGGGCAGGGG + Intronic
999308969 5:150539205-150539227 CTGAGGAGGGGGTGGGGGAGAGG - Intronic
999727162 5:154446415-154446437 TTCCGGAGGCGGAGGGCCGGGGG + Exonic
1001654972 5:173342336-173342358 CTGCGGAGGAGGAGGCTGAGTGG + Intergenic
1001758683 5:174190153-174190175 CTGCGGAGGGGGCGCGGCGGCGG - Intronic
1002012887 5:176298191-176298213 CTGGGGAGGGAGAGGGACATGGG - Intronic
1002098897 5:176847812-176847834 CGGGGGGAGGGGAGGGCCAGGGG - Intronic
1002306494 5:178286773-178286795 CTGCCCCGGGGGAGGGGCAGGGG - Intronic
1002575056 5:180169839-180169861 CTGCACAGGGGGAGGGCGAGGGG - Intronic
1002591453 5:180293502-180293524 CTGCAGATGGGGAGGGTAAGGGG + Intergenic
1002706122 5:181161635-181161657 CAGCAGAGGGGGAGGCCCACAGG + Intergenic
1002898855 6:1394096-1394118 CTGCGGAGGGGCAGGAGAAGAGG + Intronic
1002924845 6:1599364-1599386 CTGGGGAGGAGAAGGGACAGAGG - Intergenic
1003238808 6:4323468-4323490 TGGTTGAGGGGGAGGGCCAGAGG - Intergenic
1003325093 6:5085205-5085227 CCGCGACGGGGGAGGGCCGGGGG - Exonic
1003377450 6:5593018-5593040 GGGAGGAGGGTGAGGGCCAGAGG - Intronic
1004046076 6:12024910-12024932 CTGCAGATGGGAAGGCCCAGTGG + Intronic
1004114032 6:12749546-12749568 CGGGGGAGGGGGAGGGGAAGGGG - Intronic
1004241278 6:13924823-13924845 CTGCTGAGGGGAAGGGCCGGGGG + Intronic
1006136212 6:31897613-31897635 GTGCGGAAGGGGAGGGGGAGAGG - Intronic
1006150472 6:31984198-31984220 CTGGGGAGGGGAAGGGGCAAGGG + Intronic
1006156773 6:32016936-32016958 CTGGGGAGGGGAAGGGGCAAGGG + Intronic
1006176355 6:32124475-32124497 TTGCAGAGGGGCAGGGCCAGAGG - Intronic
1006388847 6:33747012-33747034 CTGCTCTGGGGCAGGGCCAGAGG + Intergenic
1006389472 6:33750019-33750041 CTGGGGAGGGAGAGGCCAAGGGG - Intergenic
1006467937 6:34207096-34207118 CTGGGCAGGGGGATGGCCTGTGG + Intergenic
1006505402 6:34485860-34485882 CAGTGGCTGGGGAGGGCCAGAGG + Intronic
1007177936 6:39909251-39909273 CAGGGGAGGGGGAGGGGGAGAGG + Intronic
1007177950 6:39909284-39909306 CAGGGGAGGGGGAGGGGGAGAGG + Intronic
1007414660 6:41684540-41684562 CTGGGGGCTGGGAGGGCCAGGGG - Exonic
1007829491 6:44627619-44627641 CTGGGGAGGGGGAGGGGGAGCGG - Intergenic
1009217726 6:60944306-60944328 CGGAGGAGGGGGAGGGGGAGGGG - Intergenic
1010169062 6:72953536-72953558 GTGGGGAGGGAGAGGGACAGAGG - Intronic
1010732710 6:79408046-79408068 CTGATCAGGGGGATGGCCAGGGG - Intergenic
1012562186 6:100596893-100596915 TTGGGGATGTGGAGGGCCAGTGG - Intronic
1013236429 6:108200883-108200905 CTGCTGCTGGGGAGGGCCTGCGG - Intergenic
1014144163 6:117978287-117978309 CTGGAGAGGGTGGGGGCCAGGGG - Intronic
1014806319 6:125833595-125833617 GGGGGGAGGGGGAGGGACAGGGG + Intronic
1015944540 6:138486599-138486621 TTGGGGATGGAGAGGGCCAGTGG - Intronic
1016820712 6:148343306-148343328 CTGCGGAGTGGGTTGCCCAGTGG - Intronic
1016844106 6:148554136-148554158 CTGGGGACAGAGAGGGCCAGAGG + Intergenic
1016916385 6:149247904-149247926 CTGTTGAGGGGTAGGGGCAGCGG + Intronic
1016936977 6:149454896-149454918 CCGTGGAGGTGGAGGGCCAGAGG - Intronic
1017054760 6:150426691-150426713 CTGAGGGGAGGGAGGCCCAGAGG + Intergenic
1017767192 6:157616410-157616432 CTGCGGAAGGGGAGGGCCCGTGG + Intronic
1018602780 6:165563169-165563191 GAGGGGAGGGGGAGGGGCAGGGG + Intronic
1018650125 6:165986255-165986277 CTCCGAGGGGGGAGGGCCAGGGG - Intronic
1018705404 6:166460480-166460502 GTGTGGAGGGGGAGGGGCACTGG + Intronic
1018705684 6:166461854-166461876 CTGTGGTGGGGCAGGGGCAGGGG - Intronic
1018973603 6:168546603-168546625 GTGGAGAGAGGGAGGGCCAGAGG + Intronic
1019179162 6:170176332-170176354 CTGCGGAGGGGGCAGGCCTCAGG - Intergenic
1019417819 7:935352-935374 GTACGGAGGGGGAGGGGCGGGGG - Intronic
1019925792 7:4191190-4191212 CTGCGGCGGGGGAGGGCCTGGGG - Intronic
1019925810 7:4191235-4191257 CCGCGGCGGGGGAGGGCCTGGGG - Intronic
1020079043 7:5276704-5276726 CTGCGGAGGCAGAGGGAGAGGGG - Intronic
1020083319 7:5297788-5297810 AGGCGGAGAGGGAGGGCCAGGGG + Intronic
1023252922 7:38284745-38284767 CTGGGGGGGGGGAGGGGCTGGGG - Intergenic
1023860106 7:44213396-44213418 CTGCAGAGGGGGGAGGCCAAGGG + Exonic
1025113773 7:56240615-56240637 CTGCTGAAGGGCAGGGCCCGTGG - Intergenic
1025210958 7:57019411-57019433 AGGCGGAGAGGGAGGGCCAGGGG - Intergenic
1025235913 7:57234784-57234806 CTGCTGGGAGGGAGGGGCAGAGG + Intergenic
1025660997 7:63557436-63557458 AGGCGGAGAGGGAGGGCCAGGGG + Intergenic
1025739726 7:64184586-64184608 CAGCGCAGTGGGTGGGCCAGCGG + Intronic
1026915171 7:74115732-74115754 CTGGGGAGGGGCAGGCCAAGCGG + Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1029477161 7:100791974-100791996 CAGCGGAGGAGGAGGGACAAGGG + Exonic
1030176643 7:106661018-106661040 CCTCGGAGGGGGAGGGGCGGCGG - Intergenic
1030715087 7:112800407-112800429 CTACAAAGAGGGAGGGCCAGTGG + Intergenic
1032539672 7:132692794-132692816 ATGGGGAGGGCGAGGGGCAGAGG - Intronic
1033482854 7:141759429-141759451 CTGTGGATACGGAGGGCCAGTGG - Intronic
1033597777 7:142868954-142868976 CTGCTGAGGGGAAGGGGCAGGGG - Exonic
1033607705 7:142939628-142939650 CTGCAGAGCTGGGGGGCCAGGGG - Exonic
1034395897 7:150824811-150824833 GTGGGGTGGGGGAGGGCCACTGG - Intronic
1034435217 7:151060039-151060061 CCGGGGAGTGGGAGGGCCGGCGG - Intronic
1034496672 7:151427448-151427470 CTGGGTAGGGGCAGGGGCAGGGG - Intergenic
1034527728 7:151676237-151676259 CTGAGGAGGGGGAGGGGGAGGGG + Intronic
1034977846 7:155458412-155458434 CGGCGGCGGTGGAGGGACAGCGG + Exonic
1035166881 7:156996033-156996055 GAGGGGAGGGGGAGGGGCAGGGG - Intronic
1035530133 8:344832-344854 CTGAGCTGGGGGAAGGCCAGTGG - Intergenic
1037829765 8:22180500-22180522 CAGGGGAGGGGGAGGCTCAGAGG - Intronic
1038295965 8:26291439-26291461 GAGCGGAGGGGGAGGGGCGGGGG - Intergenic
1038440407 8:27567442-27567464 CTGCGGAAGGGGAAGGACTGAGG + Intergenic
1039645552 8:39278278-39278300 ATGGGGAGGGGCAGGGCCATGGG + Intronic
1040056701 8:43064704-43064726 CTGCGGAGTGGGACTGGCAGTGG - Intronic
1040998656 8:53427350-53427372 CTGTGGAGTGTGAGGGTCAGCGG + Intergenic
1042416518 8:68526890-68526912 GTCAGGAGGAGGAGGGCCAGTGG + Intronic
1042912670 8:73844157-73844179 GTGCAGAGGGGGAGGGGGAGGGG - Intronic
1043847273 8:85177464-85177486 CAGGGCAGGGGCAGGGCCAGCGG + Exonic
1044248971 8:89984457-89984479 CTGCCTCGGGGGAGGGCCTGCGG - Intronic
1046943838 8:119956537-119956559 CAGGGAATGGGGAGGGCCAGTGG - Intronic
1048317276 8:133371536-133371558 ATGCTGAGGGAGAGGGGCAGGGG + Intergenic
1048480085 8:134781749-134781771 CTGAGGAGGGGGAGGAAGAGGGG - Intergenic
1049000243 8:139821330-139821352 CTGAGAAGGGCGAGGCCCAGGGG + Intronic
1049003865 8:139842667-139842689 GTGGGGAGGGGGCGGGCCTGTGG + Intronic
1049502465 8:142974759-142974781 CTGCGAAGGGAGAAGGGCAGAGG - Intergenic
1049557717 8:143291355-143291377 GTGCCGAGGGGGCGGGCCAGGGG + Intronic
1049598148 8:143494081-143494103 CTGGGGAGTGGGAGGGGAAGGGG + Intronic
1049629964 8:143648486-143648508 CTGCGGAGGAGGAGAGTCATGGG + Intronic
1049701720 8:144017581-144017603 GTGCAGAAGGGCAGGGCCAGGGG + Intronic
1049976181 9:862510-862532 ATGGGGAGGGGGAGGGGGAGGGG + Intronic
1051911225 9:22155072-22155094 CAGCGCAGTGGGTGGGCCAGTGG + Intergenic
1052531195 9:29686319-29686341 AGGAGGAGGGGGAGGGGCAGGGG + Intergenic
1052790829 9:32874137-32874159 CTGGGGAGGGGGAAGGAGAGTGG - Intergenic
1052855990 9:33406916-33406938 CTGGGGAGGGGCAAGGGCAGAGG + Intergenic
1052991775 9:34522905-34522927 CGGCCGAGGGGGAGGGCCGGGGG - Exonic
1053575841 9:39357141-39357163 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1053840357 9:42185078-42185100 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1054097409 9:60915832-60915854 GGGCGGAGGCGGAGGCCCAGAGG + Intergenic
1054118814 9:61191462-61191484 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1054588940 9:66991100-66991122 GGGCGGAGGCGGAGGCCCAGAGG - Intergenic
1055187496 9:73474271-73474293 CTGGGGAGGGGGAGGGGGAGGGG - Intergenic
1055986947 9:82062262-82062284 GGGCAGAGGGGGAGGCCCAGAGG - Intergenic
1056584446 9:87919300-87919322 GGGCGGAGGGGGAGGCCCAGAGG + Intergenic
1056612420 9:88133620-88133642 GGGCGGAGGGGGAGGCCCAGAGG - Intergenic
1056958463 9:91101418-91101440 CTCTGGAAGGGGAGGGCAAGGGG + Intergenic
1057305664 9:93910712-93910734 CTGGGGAGGGGCAGGGGCATTGG + Intergenic
1057355635 9:94328788-94328810 CTGCAGAGGGGGAGGGGCAGTGG + Intergenic
1057652124 9:96928838-96928860 CTGCAGAGGGGGAGGGGCAGTGG - Intronic
1058013040 9:99999174-99999196 GAGCGGAGGGGGAGGGGCGGGGG - Intronic
1058690296 9:107514675-107514697 CTGCGGATGTGGAGGGCCAGAGG + Intergenic
1059061488 9:111038501-111038523 GGGCGCAGAGGGAGGGCCAGAGG + Intergenic
1059766571 9:117389188-117389210 CTGCAAAGGGGGTGGGCAAGAGG + Intronic
1060153956 9:121306081-121306103 CTGCGGAGTGGGAGGAGGAGGGG - Intronic
1060547139 9:124468300-124468322 CTGGGGAGGAGCAGGGCCCGGGG + Intronic
1060667990 9:125444407-125444429 CTGCGGAGTGGGTGGGGCTGCGG + Intronic
1060977074 9:127771150-127771172 CTGGGCCTGGGGAGGGCCAGCGG - Intronic
1061163889 9:128911477-128911499 CTGTGGAGGGGGAGACCCTGTGG + Intronic
1061178665 9:129011766-129011788 CTGGGGGGCGGGAGGGCCTGAGG - Intronic
1061245507 9:129399452-129399474 CTGCGGAGTGGAGGGACCAGGGG - Intergenic
1061305278 9:129729052-129729074 CTGCGGAGGGGGAGGCCGCCAGG + Intergenic
1061737400 9:132670654-132670676 CTGGGGAGGAGGAGGGAGAGGGG + Exonic
1061798984 9:133104033-133104055 GTGGGGCTGGGGAGGGCCAGGGG - Intronic
1061893190 9:133633459-133633481 CTGAGGAGGGTGAGGGCAGGAGG + Intergenic
1061970367 9:134041647-134041669 CTGCTGAGGGACAGGGGCAGAGG + Intronic
1062040031 9:134400307-134400329 CTGGGGAGGGGTGGAGCCAGGGG + Intronic
1062070572 9:134553108-134553130 CAGTGGAAGGGGCGGGCCAGAGG + Intergenic
1062451074 9:136616080-136616102 CACCGGAGGGGCAGGGGCAGAGG - Intergenic
1062502680 9:136858117-136858139 CGGGGGAGGGGGAGGGGGAGGGG - Intronic
1062545732 9:137063083-137063105 CAGCGCAGTGGGTGGGCCAGTGG - Exonic
1062588823 9:137263817-137263839 CTGGGGAAGGGGAGGGCCACAGG - Intronic
1062589456 9:137266845-137266867 TGGGGGAGTGGGAGGGCCAGGGG + Intronic
1203768187 EBV:37242-37264 CAGAGCAGGGGGAGGGGCAGGGG + Intergenic
1203771323 EBV:51344-51366 CTGTGGGCTGGGAGGGCCAGAGG + Intergenic
1187693453 X:21894814-21894836 TTGGGGATGGGGAGGGTCAGAGG - Intergenic
1187825825 X:23333352-23333374 CTCCGGAGGGGGAGTGCGAGGGG + Intergenic
1190154255 X:47974973-47974995 CTTGGGAGGGGAAGGGGCAGTGG - Exonic
1190379913 X:49829472-49829494 ATGCGGCGGGGCAGGGACAGGGG + Intronic
1190542974 X:51496875-51496897 CGGCGGAGGGCGAGGGGCGGGGG + Intergenic
1192168588 X:68840951-68840973 CGAGGGAGGGGCAGGGCCAGGGG - Exonic
1192418898 X:71010825-71010847 CTGGGCAGGGGAAAGGCCAGAGG - Intergenic
1192491582 X:71580166-71580188 GTAGGGAGGTGGAGGGCCAGTGG + Intronic
1196060450 X:111402819-111402841 GTGCGGAGGGGGAGGGTAAGTGG + Intronic
1197708804 X:129652155-129652177 CTGCGGAGGGGGAGGAGAAGGGG + Intronic
1197749120 X:129953031-129953053 CTGGAGGGGTGGAGGGCCAGAGG - Intergenic
1198157301 X:133973837-133973859 CTGCCCTGGGGGAGGGACAGAGG + Intronic
1200052520 X:153442551-153442573 CTCAGGAGGCTGAGGGCCAGAGG - Intergenic
1200060994 X:153483729-153483751 CTGCTGGGTGGGAGGGACAGAGG - Intronic
1200073223 X:153539051-153539073 CTGCGGAGGGAGAGGAGCAGGGG - Intronic
1200143562 X:153913880-153913902 CTGCAGAGGGCGGCGGCCAGGGG + Intronic
1200430336 Y:3072666-3072688 GTGTGGAGGGGGAGGCGCAGCGG + Intergenic