ID: 1100618415

View in Genome Browser
Species Human (GRCh38)
Location 12:96249398-96249420
Sequence GGGCCAGGGGATCAGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100618402_1100618415 17 Left 1100618402 12:96249358-96249380 CCTGTGAGCTGGTGGTGACGCGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1100618415 12:96249398-96249420 GGGCCAGGGGATCAGGATATAGG 0: 1
1: 0
2: 0
3: 13
4: 182
1100618410_1100618415 -7 Left 1100618410 12:96249382-96249404 CCACTGCGGAGGGGGAGGGCCAG 0: 1
1: 0
2: 3
3: 29
4: 323
Right 1100618415 12:96249398-96249420 GGGCCAGGGGATCAGGATATAGG 0: 1
1: 0
2: 0
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100618415 Original CRISPR GGGCCAGGGGATCAGGATAT AGG Intronic
902675317 1:18004757-18004779 GGGGCTGTGGATCAGGATAGGGG - Intergenic
903056467 1:20639611-20639633 TGCCAAGGTGATCAGGATATGGG - Intronic
903261875 1:22136003-22136025 GGGCTAGGGTACCAGGATACTGG - Intronic
904615500 1:31747325-31747347 GGGCCTGGGGATGATGATTTGGG - Intronic
904948272 1:34215097-34215119 AGGCCAGGTCCTCAGGATATGGG + Intronic
906006025 1:42471242-42471264 GGAAAAGGGGATCAGGATATTGG - Intronic
906545589 1:46617216-46617238 GTGCCAGGAGCTGAGGATATGGG - Intergenic
908497997 1:64714306-64714328 GAGACAGGGTATCAGCATATTGG + Intergenic
908539285 1:65107352-65107374 GGGTCAGTAGATCAGGATTTTGG + Intergenic
908968385 1:69795149-69795171 GGGCCAGGGGATCGTGAGGTCGG + Intronic
913590434 1:120319647-120319669 GGGCCAGGGTCTCAGTGTATTGG - Intergenic
913617751 1:120578716-120578738 GGGCCAGGGTCTCAGTGTATTGG + Intergenic
914572521 1:148932256-148932278 GGGCCAGGGCCTCAGTGTATTGG - Exonic
914600320 1:149198006-149198028 GGGCCAGGGCCTCAGTGTATTGG + Intergenic
914676575 1:149911015-149911037 GGGGCAGGGGATCAGGACTATGG - Intronic
917540764 1:175911796-175911818 AAACCAAGGGATCAGGATATAGG + Intergenic
917858829 1:179124996-179125018 TAGCCAGGGGATGAGGATGTGGG - Intronic
918915289 1:190628283-190628305 GGGTCAGGGGATGTGGACATGGG - Intergenic
920558205 1:206919696-206919718 GGGCCAAGGGATCCTGCTATGGG - Intronic
923197443 1:231682104-231682126 GGGGAAGGGGAGGAGGATATAGG + Intronic
923339720 1:232997079-232997101 GGGGCAGGGGATAAGGAAAAGGG - Intronic
924772625 1:247090086-247090108 GGGCCATGGGGTCAGGGAATGGG - Intergenic
1064712270 10:18140165-18140187 GGGCCATGGGAACAGGATCAAGG + Intergenic
1069856542 10:71444105-71444127 GGGCCTTGGGCTCAGGATACAGG - Intronic
1070072162 10:73100200-73100222 AGGCTAGAGGATCAGGATATAGG + Intergenic
1070629312 10:78073481-78073503 GGGTCAAGGAATCAAGATATGGG + Intergenic
1072280970 10:93865165-93865187 GGGGCAGGGGAGCAGGAAATGGG - Intergenic
1072379285 10:94850743-94850765 GAGCCACAGGAGCAGGATATTGG + Intronic
1074772827 10:116744389-116744411 AGACCAGGGCATCAGGACATTGG + Intergenic
1074849485 10:117427663-117427685 GGGCCAGGAGAGCAGGAGAGAGG - Intergenic
1075303900 10:121350533-121350555 GGGCCAGGATAACAGGAGATTGG - Intergenic
1076150387 10:128157521-128157543 GGGGCAGGGGATCAGCATCAGGG + Intergenic
1076370251 10:129948384-129948406 GTGCCAGGGGTTCAGGAAAGGGG + Intronic
1076458027 10:130617046-130617068 GGGGAAGGGGTTCAGGGTATTGG - Intergenic
1076539882 10:131207175-131207197 GGGGGAGGGGATCAGGGTAGGGG - Intronic
1077420799 11:2448999-2449021 GGGACAGGGGATCAGGAGGGTGG + Intronic
1078085410 11:8230648-8230670 GAGCCAGGGGAGGAGGTTATTGG - Intronic
1078475480 11:11625531-11625553 GGGCCAGAGTGTCAGGATTTGGG + Intergenic
1078672472 11:13377226-13377248 GGGCCAGGAGATGTGGATGTGGG - Intronic
1078775492 11:14389909-14389931 GGGACAGGGGTTCACGATGTTGG + Intergenic
1084602036 11:70151582-70151604 GGGTCAGGAGATCAGGGAATGGG - Intronic
1086032345 11:82375353-82375375 GGGTCAGTGGATGAAGATATGGG - Intergenic
1087132226 11:94678242-94678264 GGCCCAGGGCATCACGATAGAGG - Intergenic
1087542018 11:99532498-99532520 GGGCCAGGGCAGAATGATATGGG + Intronic
1088708202 11:112482607-112482629 GGACCAGGGGAACAGGTGATGGG + Intergenic
1089142456 11:116296905-116296927 AGGCCAGGGAATCAACATATGGG - Intergenic
1089306674 11:117530645-117530667 AGGCCAGGAGATCAGGAGCTGGG - Intronic
1090044326 11:123317449-123317471 GGGCTAGGGGTTGAGGATATGGG + Intergenic
1091688379 12:2579512-2579534 GGACCTGGGAATCAGGATTTAGG + Intronic
1097684851 12:62681670-62681692 GGACTAGGGGATTTGGATATAGG - Intronic
1100618415 12:96249398-96249420 GGGCCAGGGGATCAGGATATAGG + Intronic
1108244123 13:48498085-48498107 GGGCCAGGGGGTCTGCACATTGG - Intronic
1114527549 14:23376175-23376197 GGGCCAGGGTAGCAGGGGATGGG - Exonic
1115770470 14:36661044-36661066 GGGCCAGGGGCCCAGGACAGTGG + Intronic
1117782316 14:59246212-59246234 GGGACAGGGGAGCAGGAAATGGG - Intronic
1119844475 14:77818262-77818284 GGGCTAAGGGATCAGGAGAGAGG - Intronic
1120127733 14:80765842-80765864 TAGTCAGGGGATCAGGTTATGGG - Intronic
1122423885 14:101594411-101594433 TGGCCAGTTGATTAGGATATTGG + Intergenic
1122595472 14:102887370-102887392 GGGCCAGGGACTCAGGGTAGAGG + Intronic
1126778813 15:52120780-52120802 TGGGCAGGGGCTCAGGAAATGGG - Exonic
1129065601 15:72901468-72901490 CGGCCAGGAGATGAGGACATGGG + Intergenic
1129975383 15:79817092-79817114 GGGCAAAGGGATCAAGATTTTGG - Intergenic
1131877837 15:96829557-96829579 GGGCCAGAGCAAAAGGATATTGG - Intergenic
1132151747 15:99467135-99467157 GGGCCAGGGAGTCTGGATCTGGG + Intergenic
1132663588 16:1072048-1072070 GGGCCCGGGGATCAGCATCCCGG + Intergenic
1134815501 16:17202272-17202294 GGGCTGGGGGATTAGGACATCGG + Intronic
1134824597 16:17274457-17274479 GGGGCAGGGGAAAAGGATATAGG + Intronic
1135075949 16:19393677-19393699 GGTTCAGGGGACCAGAATATCGG + Intergenic
1135968740 16:27056662-27056684 GAGTCAGGGGAGCAGGATCTTGG - Intergenic
1136776458 16:32874321-32874343 GGGTCAGGGGAGCAGGTTAGAGG + Intergenic
1136894157 16:33987191-33987213 GGGTCAGGGGAGCAGGTTAGAGG - Intergenic
1138405804 16:56793001-56793023 GGGGCAGGGGATGGGGATAGGGG + Intronic
1138893459 16:61174218-61174240 GCCCCAGGAGATCAGGAGATGGG + Intergenic
1203078873 16_KI270728v1_random:1136430-1136452 GGGTCAGGGGAGCAGGTTAGAGG + Intergenic
1143702722 17:8673377-8673399 GAGCCAGGAGATCAGGGAATGGG + Intergenic
1146843435 17:36169487-36169509 GGGCCAGGGGAACAGGGGATGGG + Intronic
1147159663 17:38562759-38562781 GGTCCAGGGGAGCAGGGTCTGGG - Intronic
1147178672 17:38672117-38672139 GGGCCAGGGGATTAGGTTTGGGG - Exonic
1147341604 17:39755899-39755921 GGGCCAGGGGGCCAGGGTACTGG + Intergenic
1149639179 17:58192147-58192169 GGGCTAGGGGATAAGGAGAGGGG + Intergenic
1153808664 18:8732898-8732920 GGACAAGGGGAGCAGGAAATGGG + Intronic
1158383859 18:56966778-56966800 AGGCCAGGGGATTAAGATATTGG + Intronic
1160523140 18:79520393-79520415 GCGCCAGCGGAGCAGGATGTCGG - Intronic
1161306863 19:3573399-3573421 GGGTCAGGGGTTCAGGAGCTAGG - Intronic
1161430846 19:4231421-4231443 AGGCCTGGGGTTCAGGATGTCGG - Intronic
1161815639 19:6498344-6498366 GAGCCAGGGGACCAGGACAGAGG - Intronic
1163190176 19:15671677-15671699 GGGCCAGGGACTCAAGATACAGG + Intergenic
1163682304 19:18690119-18690141 TTGCCAGGGGTTCAGGACATTGG + Intronic
1166957863 19:46477540-46477562 GGGCCAGGGTATCACTATGTTGG + Intergenic
1168706395 19:58472660-58472682 GGGACTGGGGATCAGGGTCTGGG + Exonic
927106419 2:19831359-19831381 GGGACAGGGTTTCAGCATATTGG - Intergenic
929047310 2:37802581-37802603 GAGCCAGGGGAGCAGGAGAGAGG - Intergenic
929175734 2:38973713-38973735 GGTCCAGTGGATCAGAATACAGG + Exonic
929190626 2:39136183-39136205 GGGCTAGGGCAGCAGGATTTGGG - Intergenic
931447209 2:62336626-62336648 AGGCCAGGGTAGCAGGAGATGGG - Intergenic
931632401 2:64312765-64312787 GGGAAAGGGGATCAAGAAATGGG - Intergenic
934559526 2:95305661-95305683 GGGCCAGGGGTTAAGGATGGGGG - Intronic
938098082 2:128476059-128476081 TGGCCAGGGGACCAGGGGATGGG + Intergenic
938591633 2:132742982-132743004 AGACCAGGGGATATGGATATGGG + Intronic
939124737 2:138164656-138164678 GACCCTGGGGAGCAGGATATGGG + Intergenic
939871055 2:147526374-147526396 GGGTCAGGGGATCAGGATGATGG - Intergenic
943260026 2:185647746-185647768 GAGCCAAGGCATCAGGAAATGGG + Intergenic
943905647 2:193498031-193498053 GTGCCAGGTGATGAAGATATAGG - Intergenic
944312036 2:198244319-198244341 GGTTCTGGGGATCAGGACATGGG - Intronic
948257597 2:236579172-236579194 GGGTCAGGGGATCAGGGTCCGGG - Intronic
949036452 2:241817708-241817730 GGGTCAGGGGAGCAGGACACTGG - Intergenic
1169997138 20:11571114-11571136 GGTCCAGGGGATTAAGACATAGG + Intergenic
1172693629 20:36807126-36807148 GGGCCAGGGCAGCAGGGTGTGGG + Intronic
1173268559 20:41510132-41510154 GGGCCCCGGGAGAAGGATATAGG + Intronic
1173358538 20:42318637-42318659 GGTCCTGGGGATGAGGCTATTGG - Intronic
1173565177 20:44033414-44033436 GGCCCCAGGGATCAGGACATGGG - Intronic
1174292938 20:49521788-49521810 GGGCTTGGGGATCAGGAGAGAGG + Intronic
1180658891 22:17448638-17448660 GGGCCAGAGGATCACTATTTAGG - Intronic
1181173891 22:21025396-21025418 AGGTCAGGGGAACAGGATGTGGG - Intronic
1181477462 22:23177622-23177644 GGCCCAGAGGCTCAGGATAGGGG + Intergenic
1182468521 22:30532758-30532780 GGGCCCAGGGATCAGGGTATGGG + Intronic
1183353378 22:37345732-37345754 GGGACAGGGTTTCACGATATTGG + Intergenic
1183493450 22:38128627-38128649 AGGCCAGGGAAGGAGGATATGGG + Intronic
1184300122 22:43553774-43553796 GGCCCAGGGGAGCAGGTTGTCGG + Intronic
1184381172 22:44145645-44145667 GGGCCAGGGGCTCTGAAAATGGG - Intronic
1184387151 22:44182705-44182727 GGGCCAGGGGAACAGGAAGGAGG + Intronic
1184458476 22:44624463-44624485 GGTTCAGGGGATTAGGATGTGGG - Intergenic
950940048 3:16883932-16883954 GGTCCCGGGGCTCAGGATCTCGG - Intronic
953413348 3:42702213-42702235 GGCCCTGGGGATCAGGTTAATGG + Intronic
954674518 3:52308476-52308498 GGACCAGGGGATGGGAATATAGG + Intergenic
958628425 3:96656670-96656692 CGGGCAGGGGATTAGGGTATGGG - Intergenic
959010668 3:101071859-101071881 GAGTGAGGGGATCAGGTTATTGG - Intergenic
962385537 3:134929553-134929575 GGGCCAGGGGCTGAGGATGCTGG + Intronic
963303830 3:143627702-143627724 GGGCCTGGGGATCAGCCAATGGG - Intronic
965815261 3:172629606-172629628 GGGCCAGGGGATGGGGACAGTGG + Intergenic
966585589 3:181620693-181620715 GGGACAGGGGATACGGATGTTGG - Intergenic
967075319 3:185996592-185996614 GGGCTAGGGGCTCAGGACCTAGG + Intergenic
967995612 3:195164268-195164290 GGGAAAGGGGATCTGGATGTGGG - Intronic
968649164 4:1753609-1753631 GGGTCAGGGGCTCAGCATGTGGG + Intergenic
968741398 4:2333303-2333325 GGGCTGGGGGATCAGGGTAGGGG - Intronic
971296270 4:25395776-25395798 GGGCCAGGGACTCAGCATAAAGG - Intronic
973531544 4:51841894-51841916 GGCCCAGGGCCTTAGGATATGGG + Intergenic
976097556 4:81525788-81525810 GGTCCAGGGGATTAGGAGAGAGG + Intronic
979111318 4:116761458-116761480 GGGCCAGGGGACATGGACATAGG + Intergenic
981452220 4:144911632-144911654 AGGCCAGCGGATCACGAGATCGG - Intergenic
983749244 4:171244311-171244333 GGGACAGGGTTTCAGCATATTGG - Intergenic
984585190 4:181555741-181555763 TGGCCAGAGGTACAGGATATAGG - Intergenic
995241374 5:109888274-109888296 GGACCACGGGCCCAGGATATTGG - Intergenic
997158690 5:131584746-131584768 GGGCCAGGGAATCTGGATTCTGG - Intronic
997732546 5:136191969-136191991 TGGCCAGGGGATCAGAATCACGG + Intergenic
999526404 5:152410820-152410842 GGGCCAAGGGATTATGATTTGGG + Intronic
999684723 5:154091945-154091967 GGGTCTGGGGATTAGGATGTGGG - Intronic
1001954922 5:175842633-175842655 GGGCCAGGGGAGGAGGATTAGGG - Intronic
1002043965 5:176531970-176531992 GGGCCAGGGGCACAGGGGATGGG + Intronic
1002087410 5:176784808-176784830 GGGCCTGGGGAGCAGGTTATGGG + Intergenic
1004752986 6:18582983-18583005 GAGCCAGGGGAAGAGGAGATTGG + Intergenic
1007904762 6:45448489-45448511 GGGCCAGGAGACCACGATCTGGG + Intronic
1008634522 6:53396499-53396521 GAGCCAGGGGATGAGGACAAGGG - Intergenic
1014334319 6:120113435-120113457 GGGCCAGGGGGAGAGGAGATTGG + Intergenic
1014372832 6:120633932-120633954 GGGCCAGCGGGTGAGGACATGGG + Intergenic
1016942602 6:149495664-149495686 GGGACAGGGGTTCACGATGTTGG + Intergenic
1019193865 6:170269768-170269790 GTGACAGCGGATCAGGAAATGGG + Intergenic
1019396617 7:823438-823460 GCGGAAGGGGATCAGGAAATAGG + Intronic
1027044315 7:74981502-74981524 GGGTCAGGGGATCAGGAGTCGGG - Intronic
1027079326 7:75220856-75220878 GGGTCAGGGGATCAGGAGTCGGG + Intergenic
1029458917 7:100684494-100684516 GGGCGAGGTGATCAAGATGTGGG - Exonic
1029620546 7:101687850-101687872 AGGACAGGGGGTCAGGATATGGG + Intergenic
1031421803 7:121562033-121562055 GGGACAGGGGATGAAGAGATGGG - Intergenic
1034547535 7:151798921-151798943 GGGCCAGGGGAGGAGCAGATGGG - Intronic
1034938146 7:155212833-155212855 GGGCCAGGGGAGCCGGAGAGGGG + Intergenic
1035063112 7:156084089-156084111 GGGCCAGGGGATGGGGGAATGGG - Intergenic
1036182434 8:6597034-6597056 GGGCCAGGTGGGCAGGAGATGGG + Intronic
1036938310 8:13026502-13026524 GGGACAGGGGACCAGGAGAAGGG - Exonic
1037201449 8:16257890-16257912 GGGCCAGTGGAGCAAGGTATGGG + Intronic
1037764454 8:21763720-21763742 GGGTCAGGGGGTCAGGGTCTGGG - Intronic
1037767766 8:21782499-21782521 GGGCCAGGGGTTCAGGAGGGAGG - Intronic
1037951203 8:23019598-23019620 GGGCAAGGGGAACGGGAAATAGG + Intronic
1037959264 8:23084134-23084156 GGGCAAGGGGAGCGGGATATGGG - Intergenic
1037960343 8:23092940-23092962 GGGCAAGGGGAGCGGGAAATGGG - Intronic
1038044465 8:23754424-23754446 GTGTCAGGGCAGCAGGATATGGG - Intergenic
1038966637 8:32580275-32580297 GGTTCTGGGGATCAGGATTTAGG + Intronic
1041085319 8:54251308-54251330 GGGAGAGGGGATCAGAGTATGGG + Intergenic
1041096779 8:54358063-54358085 AGGACAGGAGATCAGGATAGGGG - Intergenic
1042321015 8:67475602-67475624 GAGGCAGGGGATCAGTATTTGGG + Intronic
1042578239 8:70246712-70246734 GGGCTAGGGGAGGAGGAAATAGG - Intronic
1047914540 8:129567965-129567987 TGGCCAGGAGATCAGGGTAGCGG - Intergenic
1047928644 8:129704665-129704687 GGGCCTGGGGACCAGGTCATGGG - Intergenic
1049094592 8:140540908-140540930 GGGCCTGGGGACCAAGAGATGGG - Intronic
1051727228 9:20100842-20100864 GGGCCAGGGGGTCAGGTAGTAGG - Intergenic
1052965638 9:34338611-34338633 GCTTCAGGGGCTCAGGATATGGG + Intronic
1058869494 9:109190183-109190205 GGGCCTAGGGACCAGGATAGTGG + Intronic
1061045476 9:128162772-128162794 GGGCTAGGGGCTCAGCATAGAGG + Intronic
1061407865 9:130402750-130402772 GGGTGAGGGGATCAGGACAGAGG - Intronic
1062060329 9:134492046-134492068 GGGCCACGGGCTCGGGATGTCGG + Intergenic
1190182504 X:48205052-48205074 GGGTCAGGGGGTCAGAAGATGGG + Intronic
1190416060 X:50181559-50181581 GGGCCTGGGGTTCAGGAAACTGG + Intergenic
1191142557 X:57132044-57132066 GGGCTTGGGGAACAGGAAATGGG + Intergenic
1197958956 X:131983058-131983080 GGGCCAGTGGTTCTAGATATAGG + Intergenic
1199264117 X:145810452-145810474 GGCCCAGGGGATGTGGATGTTGG + Intergenic
1200103405 X:153699719-153699741 GGGTCAGGGGAGCAGGTTAGAGG - Intergenic
1201705766 Y:16935080-16935102 GGGCTAGAGGAACAGGCTATGGG - Intergenic