ID: 1100619104

View in Genome Browser
Species Human (GRCh38)
Location 12:96254859-96254881
Sequence CAGGGTAGACAGGGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 3, 2: 10, 3: 86, 4: 932}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100619091_1100619104 28 Left 1100619091 12:96254808-96254830 CCTGGAGGGGGTGAGACCACTGG 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG 0: 1
1: 3
2: 10
3: 86
4: 932
1100619095_1100619104 12 Left 1100619095 12:96254824-96254846 CCACTGGTACAGGGTGTTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG 0: 1
1: 3
2: 10
3: 86
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100619104 Original CRISPR CAGGGTAGACAGGGAGAGGA AGG Intronic
900605532 1:3521950-3521972 CAGGGACTTCAGGGAGAGGAAGG + Intronic
900811994 1:4811210-4811232 GAGGGGAGAAAGGGAGAGGTAGG + Intergenic
900940401 1:5795030-5795052 CAGGCTAGCCAGGGTGAGGGAGG + Intergenic
901037625 1:6345817-6345839 AAGACTACACAGGGAGAGGAAGG + Intronic
901685341 1:10940606-10940628 CAGGGGAGACTGGCAGAGGCAGG - Intergenic
901740414 1:11338256-11338278 CACGGTCGCCAGGGAGAGGCTGG + Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902983576 1:20142148-20142170 CAGGGTGGACATGGAGAGAGTGG + Intronic
903034652 1:20486002-20486024 CAGAGGAGAGGGGGAGAGGAAGG + Exonic
903162711 1:21500802-21500824 CACAGAAGACAGGGAGATGATGG + Intergenic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903469786 1:23578433-23578455 GAGGATACACAAGGAGAGGAGGG - Intergenic
904005316 1:27360484-27360506 CAGGGTAGTAAGGGTGGGGAAGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904355815 1:29939075-29939097 GGGGGTAGAGAGGGAGAGAAAGG - Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904830615 1:33304185-33304207 AAGGGCAGGCACGGAGAGGAAGG + Intergenic
904871118 1:33618918-33618940 GAGGGGAGGCAGGGAGAGCAGGG - Intronic
905407198 1:37742049-37742071 CAGGATAGAGAGGTAGAAGATGG + Intronic
905741205 1:40373496-40373518 CCTGGTAGAAAGGGAGTGGAGGG - Intronic
905939741 1:41853671-41853693 ACGTGTAGAAAGGGAGAGGAAGG + Intronic
906027923 1:42690732-42690754 CAGGGTAGTTAGGGAGAAAAGGG - Intronic
906573170 1:46862280-46862302 TATGGTAGGCAGGGAGAGGGTGG - Intergenic
906651810 1:47518123-47518145 CTGGGTAGAGAGTGAGGGGAGGG - Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906916594 1:50017732-50017754 TAGGGTAGAGAGGGGCAGGAGGG + Intronic
907275639 1:53315227-53315249 CAGGGGAGAAAGGGAGATAAAGG + Intronic
907414893 1:54307366-54307388 TAGGGGAGACAGGGAGAGGTTGG - Intronic
907460231 1:54601450-54601472 CAGGGCAGAGAGGGAGGGGAGGG - Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908154089 1:61334864-61334886 AAGGAAAGACAGGGAGTGGAAGG - Intronic
908990458 1:70081732-70081754 CAGGGCAGACATGGAGTGAAGGG - Intronic
909169154 1:72272253-72272275 CAGAGTAGAGATGGGGAGGAAGG - Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909852214 1:80482378-80482400 GAAGCTAGAAAGGGAGAGGAAGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911004342 1:93202630-93202652 AAAGGTAGAAAGGCAGAGGAAGG + Intronic
911027086 1:93447822-93447844 CAAGATAGAAAGGGAGAGAAGGG - Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912511328 1:110192238-110192260 TAAGGTAGACAGGGAGAAGGAGG - Intronic
912705221 1:111906643-111906665 CAGGGTAGAGAGGAAAAGCAAGG - Intronic
912911805 1:113768579-113768601 TATGGCACACAGGGAGAGGAAGG - Intronic
913966195 1:143379532-143379554 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
914060569 1:144205139-144205161 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
914118581 1:144761230-144761252 GAAGGTAGCAAGGGAGAGGAAGG - Intergenic
914823397 1:151122836-151122858 TAGGGTAGAGAGGGAGAGAATGG + Exonic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915318906 1:155045358-155045380 AAGGGTAGCCAGGGAGAGCCAGG + Intronic
915388475 1:155518795-155518817 GAGGGGAGACGGGGAGAGGAAGG + Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915591773 1:156874937-156874959 CAGCGTAGAAAGGAAGAGGCAGG - Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
917063090 1:171062288-171062310 CAGGCCAGACAGGAAGAGGGTGG + Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917374368 1:174333174-174333196 GAGGGTAGATGGGGAGAGGCTGG + Intronic
917442550 1:175080122-175080144 CAGGGCAGAGAGGGTGAGCAAGG - Intronic
917620121 1:176786924-176786946 GAGGGTGGAGAGGAAGAGGAGGG + Intronic
918269935 1:182888563-182888585 CAGGGTAGGTGGGGAGGGGAAGG - Intergenic
919600291 1:199614055-199614077 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
919920485 1:202164004-202164026 CAGGGGAGACAGGGTGAGTGGGG + Intergenic
920178438 1:204117640-204117662 CAGGGGTGACAGGCAGAGGTTGG - Exonic
920288643 1:204900662-204900684 CAGGGGAGACAGGGAGTGCTGGG + Intronic
921012362 1:211155102-211155124 GAGGGTAGAGAGCGGGAGGAGGG - Intergenic
921270965 1:213469502-213469524 CAGGGTACACATGGAAGGGAGGG + Intergenic
921290135 1:213649509-213649531 CAAGGGAGAAAGGGAGAGCAGGG - Intergenic
921617290 1:217284571-217284593 GAGGGGGGATAGGGAGAGGATGG - Intergenic
922092630 1:222411228-222411250 AAGGGCAGGGAGGGAGAGGAAGG + Intergenic
922212294 1:223495524-223495546 TAGGGTAGAATGGGTGAGGAGGG - Intergenic
922250676 1:223846084-223846106 CTGGGTAGACGGGGAGCGGCGGG + Intergenic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
923134539 1:231106637-231106659 GAGGACAGAGAGGGAGAGGAAGG - Intergenic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923687014 1:236160497-236160519 AAGGGCAGACAGGGAGAGGCAGG - Intronic
1063143133 10:3273782-3273804 CAGGGGAAACGAGGAGAGGATGG + Intergenic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1063505571 10:6595176-6595198 AAGGGAAGACAGGGAGATGTTGG - Intergenic
1064165306 10:12980524-12980546 CAGGGCAGACAGGGAGGAGGGGG + Intronic
1064274749 10:13895229-13895251 CAGGATAGAGGGTGAGAGGAGGG - Intronic
1064529905 10:16297326-16297348 AAGGGAAGAGAAGGAGAGGAAGG + Intergenic
1064676275 10:17763494-17763516 CAGGGTAGAAAGGGATGGGTAGG - Intronic
1065582425 10:27185132-27185154 CAGGGAAGAAAGGGAGAAGGGGG + Intronic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065815783 10:29481306-29481328 CAGGGAAGATAGGGAGATGTTGG + Intronic
1066059520 10:31709410-31709432 CAGGGTAGAGGGGTTGAGGAGGG + Intergenic
1066109945 10:32186997-32187019 CAAGGTTTACTGGGAGAGGATGG - Intergenic
1066453294 10:35550514-35550536 CAGGGAGGCCAGGGAGAGAAGGG - Intronic
1066596206 10:37052618-37052640 GAGGGAAGGCAGGGAGGGGAGGG + Intergenic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1067116051 10:43436548-43436570 TTGGGGAGACACGGAGAGGATGG - Intergenic
1067167589 10:43878024-43878046 AAGGGGAGAAAGGGAGAGGCAGG - Intergenic
1067254700 10:44625313-44625335 CAGGGGAGACAGGGAAGGGTTGG - Intergenic
1067655037 10:48185429-48185451 AAAGGCAGACTGGGAGAGGAGGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069556596 10:69402416-69402438 TTGGGTAGAGAGGGAGGGGAGGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069845743 10:71369966-71369988 CTGGGTAGACAGGGTAAGGAGGG + Intergenic
1069890449 10:71649110-71649132 CTGGGGAGACTGGGAGAGGAAGG - Intronic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1070331863 10:75423238-75423260 CCGGGTACACAGGGTGACGAGGG - Intergenic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070540319 10:77410882-77410904 CAGCACAGACAGGGAGAGGTCGG - Intronic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070767271 10:79063992-79064014 CATGGTAGAAAGTGAGAAGACGG + Intergenic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1071040384 10:81301811-81301833 GAGGGTAGAGAGTGAGAGGAGGG - Intergenic
1071295013 10:84213209-84213231 CAGGGCATCCAGGGAGCGGATGG - Exonic
1071418981 10:85470065-85470087 CAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1071524570 10:86350924-86350946 GAGGGAAGATAGGGAGAAGATGG - Intronic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071988591 10:91076944-91076966 GAGGGGAGAAAGGGAGAGAAGGG - Intergenic
1072075072 10:91963014-91963036 GAGGAGAGACAGGGAGGGGAGGG - Intronic
1072155104 10:92716775-92716797 CAAGGTAGACAGGGACAGACTGG - Intergenic
1072602573 10:96942441-96942463 CCGTGGAGAGAGGGAGAGGAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1073549521 10:104384886-104384908 TAGGGAAGAATGGGAGAGGAGGG + Intronic
1073948944 10:108784847-108784869 CAGGGTGGAGAGGAAGACGATGG - Intergenic
1074287884 10:112115597-112115619 CTGGGAAGAGAGGGAGAGGAAGG + Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075044894 10:119139139-119139161 GAGGGTCTACAGGGAGGGGAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075212399 10:120502327-120502349 TAGGGGAGGCAGGGAGAGAAGGG + Intronic
1075482730 10:122796362-122796384 AAGGAGAGAGAGGGAGAGGAAGG + Intergenic
1075517995 10:123124833-123124855 CATGGGAGTCAGGGAGAGGGAGG - Intergenic
1076542688 10:131224122-131224144 CTGGAAAGAGAGGGAGAGGATGG - Intronic
1076821433 10:132941927-132941949 CAGCTTTGACAGGGAGAGGGAGG - Intronic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078105468 11:8355555-8355577 CAGGCTGGACAAGGAGAGGAAGG - Intergenic
1078436865 11:11332619-11332641 TAGTGAAGAAAGGGAGAGGAGGG - Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1079298246 11:19254162-19254184 CAGGGAAGAGGAGGAGAGGATGG - Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1080770090 11:35332705-35332727 CAGGGCAGATGGGGAGAGGGAGG - Intronic
1081451531 11:43175304-43175326 GCGGGGAGCCAGGGAGAGGAAGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1082040672 11:47682280-47682302 CATGTTAGTCAGGGAGATGAAGG + Intronic
1082747795 11:56984954-56984976 CAGTTTACACAGGGAGAGGGAGG + Intergenic
1082803375 11:57430845-57430867 CACAGTAGACAGGAAGGGGATGG + Intergenic
1082859329 11:57839075-57839097 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1083615409 11:64023701-64023723 CAGGGGAGTCGGGGAAAGGAGGG - Intronic
1083997802 11:66280694-66280716 CAGGGTCCACAGGGAGCAGAAGG - Intronic
1084149107 11:67279908-67279930 CAGGGAAGTGTGGGAGAGGAAGG + Intronic
1084282115 11:68104328-68104350 GAGGGGAGACAGGGAGAGGTTGG + Intronic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084468509 11:69341484-69341506 CAAGGTAGGAAGGAAGAGGAAGG - Intronic
1084533911 11:69745784-69745806 CAGGGAAGCCAGGGCCAGGAAGG + Intergenic
1084628408 11:70327837-70327859 CAGGTTAGAAAGTGACAGGAAGG - Intronic
1084793658 11:71490468-71490490 CAGAGTTGACAGGCAGGGGAGGG + Intronic
1084908800 11:72370822-72370844 CAGGGTAGAGAAGCAGAGGGAGG - Intronic
1084991733 11:72931970-72931992 CAGGTTAGAAAGTCAGAGGAGGG - Intronic
1085156677 11:74301957-74301979 CTGGGTAGAAAGGGAAAGCAGGG - Intronic
1085220650 11:74871318-74871340 CAAGGTAGACAGGAAGACAATGG - Intronic
1085245429 11:75097152-75097174 CAGGGAAGACAGGCAGAGTCAGG + Intergenic
1085405172 11:76257356-76257378 CAGGCTAGGCTGGGAGAGGGAGG - Intergenic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1085819086 11:79772762-79772784 AGAGATAGACAGGGAGAGGAAGG + Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086334382 11:85785039-85785061 CAAGGTAGAGAGGGAGAAGTGGG + Intronic
1086548148 11:88022999-88023021 GAGGGTATAGAGTGAGAGGAAGG + Intergenic
1087023248 11:93624181-93624203 CATGGTTGAGAGGGAGAGGATGG + Intergenic
1087138898 11:94746561-94746583 CAGGGGAGAAAGGGAGAAGGGGG - Intronic
1087617612 11:100506385-100506407 GAGGAAAGAGAGGGAGAGGAAGG + Intergenic
1088267480 11:108001584-108001606 CAGGGAACCCAGGGAGAGAATGG - Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088585254 11:111355490-111355512 CAGGGGAGACAGGGATGGTAGGG - Intronic
1088786700 11:113188788-113188810 CCAGGGAGACAGGGTGAGGAAGG + Intronic
1089047957 11:115520118-115520140 CAGGTAAGAAAGGGAGGGGAGGG - Intergenic
1089277184 11:117345342-117345364 CAGAGTAGACATGGAGAACACGG - Intronic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089364233 11:117911310-117911332 CAGGGTAGACAGGCAGCAGTAGG - Intronic
1089564239 11:119362683-119362705 CAGGGTCGACAGGGAGAAAGGGG + Intronic
1089708259 11:120296546-120296568 GAGGGTAGAAGGTGAGAGGAGGG - Intronic
1089859018 11:121572425-121572447 CAGGTGAAACAGGGAGACGACGG - Intronic
1090089629 11:123683612-123683634 CAAGGTAGTCAGGGAGAGTGTGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1091233176 11:134001580-134001602 CAGGGAAGGCAGGCATAGGATGG - Intergenic
1091302968 11:134519384-134519406 CAGGTTATCCAGGGAGAGGCTGG + Intergenic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1091382460 12:70920-70942 AAGGGTAGTGAGGCAGAGGAGGG - Intronic
1091445478 12:542350-542372 ATGGGCAGGCAGGGAGAGGAGGG - Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1092028504 12:5263354-5263376 GAGAGTAGAGAGGGAGAGAAGGG + Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092268455 12:7001907-7001929 TAGGGCAGGCAGGGAAAGGAAGG + Intronic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092754759 12:11753033-11753055 CAGCACAGACAGGGAGGGGAGGG - Intronic
1092806283 12:12226029-12226051 CTGTGTAGACGGGGAGAGGGAGG - Intronic
1093950873 12:25164172-25164194 AGGGGTAGACATGGAGAGAAGGG - Intronic
1095265284 12:40149430-40149452 TGGGGTAGAAAGGGAGAGTAGGG - Intergenic
1095977375 12:47949050-47949072 CAGGCCTGACAGGGAGAGGCGGG - Intergenic
1096244201 12:49975259-49975281 CAGGGAGGGCAGGGAGAGCAAGG + Intronic
1096324518 12:50647471-50647493 CAGGGTGGAGAGGAAAAGGAGGG - Intronic
1096592843 12:52673315-52673337 CACGGTGGACAGGGACATGAGGG + Intergenic
1096601217 12:52731064-52731086 TAGGGAACACAGGGAGAGGATGG + Intergenic
1097078821 12:56414329-56414351 GAGGGTAGTCAGTGAGAGGTGGG + Intergenic
1097355370 12:58594820-58594842 CAGGGAGCAAAGGGAGAGGAAGG + Intronic
1097571520 12:61338784-61338806 CAGAGTAGAAAGGAATAGGAGGG + Intergenic
1097958745 12:65512292-65512314 CAGAATACACAGGGAGAGGGAGG - Intergenic
1098008994 12:66030602-66030624 GAGGGAAGAGATGGAGAGGAAGG - Intergenic
1098541884 12:71666110-71666132 TAGAGTAGAAATGGAGAGGAGGG + Intronic
1098989915 12:77054073-77054095 GAGGGTAGAGGGTGAGAGGAGGG + Intronic
1099138395 12:78938169-78938191 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101008019 12:100420536-100420558 TAGGGTAGCCATGCAGAGGAGGG + Exonic
1101413190 12:104486069-104486091 CAGGGAAGGCTGGGAGGGGAAGG - Intronic
1101731375 12:107429170-107429192 CAGAGCAGACAAGGAGAGAATGG - Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102571487 12:113829627-113829649 CAGGGTGGACAGGACGAGGTGGG + Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102745275 12:115244113-115244135 GAAGGGAGAGAGGGAGAGGAAGG + Intergenic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103449068 12:121015317-121015339 GAGGGAAGGAAGGGAGAGGAAGG + Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103910639 12:124350163-124350185 GAGCCTAGAGAGGGAGAGGATGG + Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104058211 12:125246272-125246294 CAGGGAAGGCGGGGAAAGGAGGG - Intronic
1104222013 12:126794280-126794302 CAGGGGAGGAAGGGAGAGGGTGG - Intergenic
1104378724 12:128288428-128288450 CAGGGGAGGGAAGGAGAGGAGGG - Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104540242 12:129657377-129657399 CAGGGAACAAAGGGATAGGATGG + Intronic
1104566268 12:129887223-129887245 CACGGTAGACAGGGAGGGGCGGG - Intronic
1104605512 12:130184778-130184800 CAGGGTGGGGAGGGAGCGGAAGG - Intergenic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1105683345 13:22752267-22752289 GAGGGTAGAGAGGGGAAGGAGGG - Intergenic
1105994063 13:25653450-25653472 GAGGGTGGAGAGTGAGAGGAAGG + Intronic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1107318522 13:39160702-39160724 AAGAGGAGAGAGGGAGAGGAAGG + Intergenic
1107430824 13:40338604-40338626 CTGGGTAGACAGGGAAAGGGAGG + Intergenic
1107790156 13:43993999-43994021 GAGGGTGGAGAGTGAGAGGACGG + Intergenic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1110123006 13:71906523-71906545 CAGGGAACACAGGCAGAGGGTGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111097423 13:83534097-83534119 CAGGGTGGACCCGGAGAGGGAGG - Intergenic
1111356749 13:87116262-87116284 GAGGGTGGAAAGTGAGAGGAGGG + Intergenic
1111764366 13:92509241-92509263 CAGAAAAGATAGGGAGAGGAGGG - Intronic
1112531327 13:100206742-100206764 CAGGGAAGAGAGGAAGGGGAAGG - Intronic
1112554175 13:100451745-100451767 GAGGACAGAGAGGGAGAGGAAGG - Intronic
1113107731 13:106789565-106789587 CAGGGTAGAGAGTGACAGGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113542309 13:111118363-111118385 AAGGTTAGACAGTGAGAAGATGG + Intronic
1113618501 13:111697393-111697415 GAAGGGAGGCAGGGAGAGGAAGG - Intergenic
1113624030 13:111782654-111782676 GAAGGGAGGCAGGGAGAGGAAGG - Intergenic
1113735369 13:112674761-112674783 ATGGGCAGACAGGGAGAGGTGGG + Intronic
1113754762 13:112803769-112803791 CAGGGAGGGGAGGGAGAGGAAGG - Intronic
1115152764 14:30304385-30304407 CAGGGAAGCCAGGCACAGGAGGG - Intergenic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116031834 14:39583217-39583239 CACAGGAGTCAGGGAGAGGAAGG + Intergenic
1116239418 14:42322386-42322408 TATGGAAGACAGGGAGAGGCAGG + Intergenic
1116355163 14:43919245-43919267 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117271259 14:54146203-54146225 CATGGCAGAGAGGGAGAGGCAGG + Intergenic
1117652510 14:57921676-57921698 AAGGGAAGACAGGGAGAAGATGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118592950 14:67414510-67414532 CAGGCCTGAGAGGGAGAGGAGGG - Intergenic
1118842513 14:69523910-69523932 CAGAGAAGACAGGGTGAGGCTGG + Intronic
1119094832 14:71819888-71819910 AAGGGTAGAGGGTGAGAGGAGGG - Intergenic
1119150745 14:72357304-72357326 CATGGGTGACAGGCAGAGGAAGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119733221 14:76964363-76964385 CAGGGTATAGAGTGAGAAGATGG + Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1119776401 14:77251807-77251829 GAGGGTGGACAGGGAAAAGATGG - Exonic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1119920613 14:78442592-78442614 AAGGGAAGACAGGGAGAGGCAGG + Intronic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120929677 14:89836093-89836115 CAGGCTAGACAGGGAAAGAAGGG + Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121521163 14:94587138-94587160 TAGGGATGACGGGGAGAGGAAGG - Intronic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122447948 14:101782330-101782352 AAGGGGAGAGAGGGAGGGGAAGG - Intronic
1122448064 14:101782647-101782669 AAGGGGAGAGAGGGAGGGGAAGG - Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1124176887 15:27434738-27434760 TAGAGTAGGCAGGGAGTGGAAGG + Intronic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125448946 15:39787814-39787836 CACAGCAGACAGGGAGAGGAGGG - Intergenic
1125750841 15:42027172-42027194 CAGTGTTGACAGGAAGAGGCAGG + Intronic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1125921990 15:43530419-43530441 CAAAGTTAACAGGGAGAGGATGG + Exonic
1126665126 15:51069005-51069027 TAGGGTAGGGAGGGAGAGGCAGG + Intronic
1126841654 15:52723142-52723164 TGAGGTAGACAGGGAGAGGGCGG + Intergenic
1127108806 15:55645925-55645947 AAGGGAAGACAGGGAGAAGTTGG + Intronic
1127230264 15:56984295-56984317 AAGGGTGGAGAGGGAGAGAAAGG + Intronic
1127370170 15:58331834-58331856 CAGGACAAACAGGGAGGGGAGGG - Intronic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1127855908 15:62953460-62953482 CAGGGTAGATAGGGAGACTATGG + Intergenic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128382644 15:67124807-67124829 CAGGGCAGCCGGGGAGAGGCTGG + Intronic
1128563242 15:68682351-68682373 CAGGGTGCACCTGGAGAGGAAGG + Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1128753845 15:70167697-70167719 CATGGCAGCCAGGGAGAGAAGGG + Intergenic
1128755787 15:70182771-70182793 CAGGGTACACAGGTAGATCAAGG - Intergenic
1128942336 15:71799097-71799119 CAGGGAAGAAAGGGAGGGAAGGG - Intronic
1128973288 15:72128115-72128137 GAGGGGAGAGAGGGAGGGGAGGG + Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130214052 15:81952056-81952078 GAGGGGAGACAGGGAGAGGTTGG - Intergenic
1130244328 15:82230405-82230427 CAGTGTAGATCGGGAGAGGTGGG - Intronic
1130456124 15:84110718-84110740 CAGTGTAGATCGGGAGAGGTGGG + Intergenic
1130867874 15:87947701-87947723 AAGAGAAAACAGGGAGAGGAAGG + Intronic
1130904949 15:88233722-88233744 CAGGGAAGGAAGGGAGAGTAAGG - Intronic
1130970036 15:88725202-88725224 CAGAGAAGCCAGGGAGAGCAAGG + Intergenic
1130998493 15:88919237-88919259 GAGGGGAGGCATGGAGAGGAAGG + Intergenic
1131005534 15:88974429-88974451 CAGGGCAGACGGTGAGAGGTTGG - Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132374856 15:101322337-101322359 TAGGATGGAAAGGGAGAGGATGG - Intronic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1132728591 16:1349600-1349622 GAGGGCAGCCTGGGAGAGGAGGG + Exonic
1132855453 16:2042793-2042815 GAGGGTTGAGAGGGAGAAGAGGG - Intronic
1132994899 16:2817729-2817751 AAGGGGAGAAAGGGAGAGGTCGG + Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133452924 16:5918625-5918647 CAGGGTAGACAGTGAGCTGTAGG + Intergenic
1134295240 16:12939705-12939727 CACAATAGACAGGGAGAGGCAGG - Intronic
1134684595 16:16149898-16149920 CAGGGTGGACAGGGCGAGATGGG + Exonic
1135180079 16:20265279-20265301 GAGGGTGGAGAGGGGGAGGAGGG - Intergenic
1135624780 16:23984804-23984826 AAGTGTAGAGAGGGAGAGGGAGG + Intronic
1135869475 16:26136247-26136269 GAGGCTAGAGAGGCAGAGGAAGG + Exonic
1136525380 16:30826227-30826249 CAGGGAAGACAAGCAGAGTAAGG - Intergenic
1136537358 16:30907900-30907922 CAGGGGAGCCTAGGAGAGGAGGG - Intergenic
1137023228 16:35450897-35450919 CAGTGTAGGCAGGGACAGGCAGG + Intergenic
1137542865 16:49377090-49377112 CAGGGGAGGCAGGGAGGGCAGGG - Intronic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1138217229 16:55214795-55214817 CGAGGAAGACAAGGAGAGGAAGG + Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138493062 16:57387922-57387944 GAGGGAAGGGAGGGAGAGGAAGG + Intergenic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1139346276 16:66305913-66305935 CAGGAGAGAGAGGGAGAGAAGGG - Intergenic
1139492327 16:67292940-67292962 CAGGCTAGGCAGGTAGTGGAGGG - Intronic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140060437 16:71564812-71564834 CAGGGTAGACAGGCTGAAAAAGG + Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140833451 16:78772184-78772206 GAGGGTAGAGGGAGAGAGGAAGG - Intronic
1140914700 16:79483165-79483187 GAGGGGAGAGAGGGAGGGGATGG - Intergenic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141937385 16:87250113-87250135 GAGGGTAGAGGGTGAGAGGAGGG + Intronic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1141988066 16:87592952-87592974 AAAGGAAGAGAGGGAGAGGAAGG - Intergenic
1142604414 17:1073682-1073704 CGGGGGAGACAGGGAGAAGGAGG + Intronic
1142606374 17:1083642-1083664 CAGGGAACAGAGGGAGAGGAGGG + Intronic
1143021257 17:3918137-3918159 AAGGGAAGAGAGGGAGGGGAGGG + Intergenic
1143028849 17:3956189-3956211 CCAGGTAGACAGGTAGAGAAAGG - Intronic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1143987177 17:10924749-10924771 CTGGGGTGACTGGGAGAGGAGGG + Intergenic
1144045467 17:11450960-11450982 CAAGGTAGACCAGGACAGGAGGG + Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144212267 17:13025653-13025675 CTGGAAAGAGAGGGAGAGGATGG - Intergenic
1144260774 17:13517982-13518004 CAGAGTCAACTGGGAGAGGAAGG + Intronic
1144383227 17:14723738-14723760 GAGGGTAGAGGGTGAGAGGAGGG + Intergenic
1144650809 17:17005660-17005682 CAGAGCAGTCAGGGAGAGCATGG + Intergenic
1145031646 17:19508620-19508642 CAAGGCAGGCAGGGAGAAGACGG - Intronic
1145053422 17:19681800-19681822 CAGGGAAGAAAGGGAGATAAGGG - Intronic
1145398854 17:22515446-22515468 GAGGGGAGGGAGGGAGAGGAGGG + Intergenic
1146534062 17:33634312-33634334 CAGGGCAGGCTAGGAGAGGATGG - Intronic
1146663115 17:34678340-34678362 AAGGGTAGACAGGAAAAAGAAGG - Intergenic
1146945445 17:36870127-36870149 CAGGGGAGCTGGGGAGAGGAGGG + Intergenic
1147266201 17:39236512-39236534 CCAGGAAGACGGGGAGAGGAGGG - Intergenic
1147376143 17:40023437-40023459 TAGGGTGGGGAGGGAGAGGAGGG + Intronic
1147556931 17:41485641-41485663 GAGGGCAGTCAGGGAGAGCAGGG - Intergenic
1147652198 17:42069091-42069113 CAGGGAAGACAGGGAACAGAGGG - Intergenic
1148087052 17:45000617-45000639 CAGGCAAGGCAGGGACAGGATGG + Intergenic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148862858 17:50613551-50613573 CTGGGGTGACGGGGAGAGGAGGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149580787 17:57749021-57749043 CAAGCAAGAAAGGGAGAGGACGG + Intergenic
1149584117 17:57773685-57773707 CTGGGTTGACCAGGAGAGGAAGG + Intergenic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1149686965 17:58541340-58541362 AAGAGTATAAAGGGAGAGGAGGG + Intergenic
1150269062 17:63850670-63850692 AGGGGTAGGCAGTGAGAGGAGGG - Intergenic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151431140 17:74064066-74064088 GAGGGTGGGAAGGGAGAGGAGGG + Intergenic
1151517197 17:74604266-74604288 AGGTGTAGACAGGGAGGGGAAGG - Intergenic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1152327821 17:79651766-79651788 AAGGATGGACAGGGAGAGGGAGG - Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1152564617 17:81094661-81094683 CACGGTACCCAGGCAGAGGAGGG - Intronic
1152842506 17:82579520-82579542 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842524 17:82579590-82579612 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842542 17:82579660-82579682 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842560 17:82579729-82579751 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842578 17:82579799-82579821 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842614 17:82579939-82579961 CATGGGCGACATGGAGAGGAGGG - Intronic
1152842650 17:82580079-82580101 CACGGGTGACATGGAGAGGAGGG - Intronic
1152842705 17:82580289-82580311 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842762 17:82580499-82580521 CACGGGTGACATGGAGAGGAGGG - Intronic
1152842781 17:82580569-82580591 CACGGGTGACATGGAGAGGAGGG - Intronic
1152842799 17:82580639-82580661 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842818 17:82580709-82580731 CACGGGTGACATGGAGAGGAGGG - Intronic
1152842837 17:82580779-82580801 CACGGGTGACATGGAGAGGAGGG - Intronic
1152842855 17:82580849-82580871 CATGGGTGACATGGAGAGGAGGG - Intronic
1152842873 17:82580919-82580941 CACGGGTGACATGGAGAGGAGGG - Intronic
1153001853 18:463029-463051 CGGGGGAGTCAGGGAGAGGGTGG + Intronic
1153101389 18:1474160-1474182 CAGGGCAGGCAGGTAGGGGAAGG - Intergenic
1153256666 18:3178499-3178521 CATGATGGAAAGGGAGAGGAAGG + Intronic
1153328448 18:3847289-3847311 CAAGGCAGATAGGGAGAGGTTGG + Intronic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1153660791 18:7324422-7324444 CATGTTAGACAAGGAGAGGAAGG - Intergenic
1153777121 18:8463944-8463966 GAGGGTTGGCAGGGAGAGCAAGG + Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1155176783 18:23307931-23307953 CAGGGCAGACCGGGACAGGCAGG - Intronic
1156504157 18:37578249-37578271 TAGGATGGACAGGGAGAGGAGGG + Intergenic
1156704154 18:39859600-39859622 CTGGGATGACAGGGTGAGGAAGG + Intergenic
1156752456 18:40475435-40475457 GAGGGGAGGCAGGGAGGGGAGGG + Intergenic
1157012022 18:43661149-43661171 AAAGGTAGACAGGGAGAAGGAGG + Intergenic
1157503953 18:48212895-48212917 CAGGCTGGCCAGGCAGAGGAGGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157701735 18:49765121-49765143 CAGTGTAGACAGGGAGCAGATGG + Intergenic
1157804712 18:50649543-50649565 AAGGCTGGACAGGGAGAGGTGGG - Intronic
1158092279 18:53728175-53728197 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1158619138 18:59015737-59015759 CAGGGAAGCCAGGCAGAGCAGGG + Intergenic
1158703441 18:59770124-59770146 TGGGGCAGACAGGGAGAGGCAGG + Intergenic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159576329 18:70182512-70182534 GAAGGAAGAAAGGGAGAGGAAGG + Intronic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1160505092 18:79422572-79422594 CAGGGGAGTGAGGGAGAGGGAGG + Intronic
1160790143 19:919311-919333 GTGGGGAGACTGGGAGAGGAGGG - Intronic
1161258889 19:3324701-3324723 AAGGGAGGGCAGGGAGAGGATGG - Intergenic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1161405624 19:4089756-4089778 GCGGGGGGACAGGGAGAGGATGG + Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161464020 19:4417424-4417446 CCTGGGCGACAGGGAGAGGATGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161604202 19:5205650-5205672 CAGGGTAGGCGGGTAGAGGGGGG + Exonic
1161636208 19:5390869-5390891 CAGGGAAGACAGGGTGGGGTAGG - Intergenic
1161642325 19:5432071-5432093 CAGGGAAGAAAGGGGTAGGATGG + Intergenic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161719829 19:5896579-5896601 CGGGGTAGACGGGAAGAGCAAGG + Exonic
1161883540 19:6975158-6975180 AAAGGAAGACAGGGAGAGGAAGG - Intergenic
1161957422 19:7504286-7504308 GTGGGCAGACAGGGATAGGAAGG - Intronic
1161983564 19:7642676-7642698 CAGGGGGGACAGGGAGAGGTGGG - Intronic
1162129557 19:8517643-8517665 CAAGGAAGGAAGGGAGAGGAGGG + Intergenic
1162138018 19:8568058-8568080 CAGGATAGAGAGGGAGAGAATGG - Intronic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163820219 19:19492191-19492213 CAGGGCAGACAGGGAACAGACGG + Intronic
1164451833 19:28372723-28372745 CAGGTTCCACAGGGTGAGGAGGG - Intergenic
1164704290 19:30308540-30308562 CAGGGCAGTGAGGGAGGGGATGG + Intronic
1164741578 19:30580053-30580075 AAGGGGTGACAGGGAGAGGGAGG - Intronic
1164779480 19:30880862-30880884 CAGGGGGCACAGGGAGAGGTGGG + Intergenic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1165311885 19:35033474-35033496 AGGGGTAGCCAGGGAGGGGAAGG - Intronic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165464607 19:35966210-35966232 CAGGGAAGACTAGGAGGGGATGG - Intergenic
1166091490 19:40512383-40512405 CAGAGTAGTCAGGGCTAGGATGG + Intronic
1166672435 19:44718976-44718998 CAGGGCAAAAAGGGAGAAGAAGG + Intergenic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167163173 19:47780673-47780695 CAGGGGAGAGAGGGAGAAGTGGG - Intronic
1167538524 19:50070825-50070847 CAGGGGAGACAGGGAGTGTGGGG + Intergenic
1167600377 19:50451387-50451409 GAGGATAGGCAGGGCGAGGAAGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
1167984411 19:53302233-53302255 TTGGGTAGACAGGGGTAGGAGGG - Intergenic
1168110204 19:54188180-54188202 GAGGGAGGAGAGGGAGAGGAGGG - Intronic
1168149251 19:54436055-54436077 CGGGGTAGCGGGGGAGAGGAGGG - Intronic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168203921 19:54835560-54835582 CAGGGTAGACATGAAGTGGAGGG - Intronic
1202699976 1_KI270712v1_random:157027-157049 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
925199248 2:1952903-1952925 AAGGGAAGGAAGGGAGAGGAAGG - Intronic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
925222676 2:2154677-2154699 GAGGGTAGAGAGTGATAGGAGGG + Intronic
926083006 2:10004000-10004022 CAGGAAAGACGGGGAGAGCAGGG + Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926856378 2:17260659-17260681 GAGGGTAGAGGGTGAGAGGAAGG - Intergenic
927333461 2:21892890-21892912 CAGGGTAGAAAGTGAGAGGAGGG - Intergenic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
927800177 2:26091523-26091545 CAGGGTAGAGAGGGGTAGGTGGG + Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928439794 2:31282829-31282851 CAAAGGGGACAGGGAGAGGATGG + Intergenic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
928921794 2:36534518-36534540 TAGGGAAGGGAGGGAGAGGAAGG + Intronic
928982826 2:37154516-37154538 AAGCTAAGACAGGGAGAGGAGGG - Intronic
929120020 2:38476801-38476823 CAGTGTGGAGAGGGAGGGGATGG - Intergenic
929675374 2:43921604-43921626 CAGAGAAGACATGGAAAGGATGG + Intronic
930134821 2:47891285-47891307 CAGGGGTGAAAGGGAGGGGAGGG - Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932777500 2:74536841-74536863 CAGGGAACAGAGGGAGAGGTGGG + Exonic
932839875 2:75072179-75072201 CAGGGCACAGAGGGAGAGAAGGG + Intronic
932937257 2:76118730-76118752 TAGGGTAGAGAGTGGGAGGAGGG + Intergenic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
933897374 2:86824098-86824120 CAGGCCAGGCAGGGAGAAGAGGG - Intronic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
934085901 2:88509291-88509313 CAGGTCAGACAGGGAGAGAACGG + Intergenic
934170908 2:89540502-89540524 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
934281213 2:91614820-91614842 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934934905 2:98458369-98458391 CAGGGTAGAGAAGGTGAGAAAGG - Intronic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935368046 2:102315277-102315299 GTGGGTAGACAGGGAGAGTGGGG - Intronic
935885707 2:107617142-107617164 AAGGGTACCCAGGTAGAGGATGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
936949537 2:117964375-117964397 AAAGGAAGAGAGGGAGAGGAAGG - Intronic
936980686 2:118262632-118262654 CAAGGCAGTCAGGGAGGGGAGGG - Intergenic
937387977 2:121454329-121454351 CATGGGAGAGAGGGAGAGCAGGG - Intronic
938131042 2:128715734-128715756 TGGGGAAGACAGGGAGAGGAAGG + Intergenic
938461826 2:131502242-131502264 GAGGGGAGAAAGGGAGAGGCAGG + Intergenic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
938901569 2:135802720-135802742 GAGGGAGGACAGGGAGAGGTTGG + Intronic
938928678 2:136067017-136067039 CATGGTAGAAAGGGTGATGAGGG - Intergenic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939706183 2:145456781-145456803 CAGTGTAGACAGGTAGGAGATGG - Intergenic
939801355 2:146714045-146714067 CGGGGTGGACAGTGAGAGGAGGG + Intergenic
940472598 2:154117415-154117437 CAGGGTAAAGGGTGAGAGGAGGG - Intronic
940655360 2:156481436-156481458 GGGGGAAGACAGGGAGAGGTTGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
942321340 2:174739170-174739192 CTGGCTGGCCAGGGAGAGGATGG - Intergenic
942752846 2:179307566-179307588 GGGTGTAGACAGGGAGAGAAAGG - Intergenic
943030043 2:182675098-182675120 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943356749 2:186865781-186865803 CTGGGTAGACAGGGACATAATGG + Intergenic
943411274 2:187551530-187551552 AAGTGAAGACAGGGAGAGAAAGG + Intronic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945943010 2:215968565-215968587 CAGGGCTGAGAGGTAGAGGAGGG - Intronic
946114943 2:217453172-217453194 CATGGGAGACAGGTAGAGGCTGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947074665 2:226329478-226329500 CAGGGGTGACAGTGAGTGGATGG - Intergenic
947531381 2:230910675-230910697 CAGGGTGCACAGGGACGGGAAGG + Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947727661 2:232410002-232410024 CAGGGTGCACCGGGAGGGGAAGG - Exonic
948327362 2:237136487-237136509 CAAGATAGACATGGAGAGAAAGG + Intergenic
948542168 2:238698888-238698910 CAGGGCAGTCATGGAGATGAAGG - Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1168938537 20:1689115-1689137 CAGGAGGGACAGGGAGAGTAGGG + Intergenic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169672729 20:8121306-8121328 CAGGAGAAAGAGGGAGAGGATGG + Intergenic
1169739849 20:8880315-8880337 TCCGGTAGACAGGGAGAGAACGG - Intronic
1169825035 20:9758440-9758462 CATGGTAGGCATGGATAGGAAGG - Intronic
1170032685 20:11959282-11959304 CTGGTGAGAGAGGGAGAGGAGGG + Intergenic
1170403762 20:16014657-16014679 CTGGGGAGCCAGGGACAGGAAGG - Intronic
1171197843 20:23215226-23215248 CAGGGTAGGAAGGGATGGGAGGG - Intergenic
1171249635 20:23638083-23638105 CAGGGGAGGCGGGGAGAGGCAGG - Intronic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1171392634 20:24811433-24811455 TTGGGTAGACAGTGACAGGAGGG - Intergenic
1171986557 20:31665196-31665218 CATGGGAGCCAGGGAGGGGAAGG + Exonic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172444006 20:34983874-34983896 CAAGGAAGAAAGGGAGAGAAGGG - Intronic
1173413125 20:42832359-42832381 GAGGGTGGAGAGGGAGAGGAGGG + Intronic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1174037240 20:47675760-47675782 CAGGGCAGGCTTGGAGAGGAGGG - Intronic
1174111525 20:48201072-48201094 CTGGGTAGAGAGGCAGAGCACGG + Intergenic
1174137820 20:48392872-48392894 CAAGGCAGGCAGGGAGGGGATGG + Intergenic
1174215286 20:48911780-48911802 CAGGGAGGTCAGGGAGAGGGAGG - Intergenic
1174392982 20:50229320-50229342 GAGGGGTGAAAGGGAGAGGAGGG - Intergenic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175381787 20:58568771-58568793 GAGGGTAGAGTGGGAGAGGGTGG - Intergenic
1175487362 20:59355658-59355680 GGGGGGAGATAGGGAGAGGAGGG - Intergenic
1175615006 20:60390495-60390517 AAGGGAAGAAGGGGAGAGGATGG - Intergenic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
1176002579 20:62839674-62839696 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002597 20:62839722-62839744 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002615 20:62839770-62839792 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176041639 20:63068834-63068856 CAGGGCAGACAGGAAGCGGGAGG - Intergenic
1176105649 20:63384601-63384623 CCTGGTAGAGAGGGAGAGAAGGG + Intergenic
1176282747 20:64323915-64323937 AAGGGTAGTGAGGCAGAGGAGGG + Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179116678 21:38499723-38499745 AAGGGGGGAAAGGGAGAGGAAGG + Intronic
1179182514 21:39057798-39057820 CAGGGGATACAGGGACAGAAAGG + Intergenic
1179418520 21:41217435-41217457 CGGGGTAAAGAGGGAAAGGAGGG - Intronic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179711150 21:43263956-43263978 CAGGGTACAATGAGAGAGGAAGG + Intergenic
1179805385 21:43834102-43834124 CTTGGCAGACAGGGAGAGGAGGG + Intergenic
1180617103 22:17135503-17135525 CGGCCTAGACAAGGAGAGGAAGG + Intergenic
1181126036 22:20702967-20702989 CAGGGGAGACAGGGACGGGGAGG - Intergenic
1181239373 22:21468276-21468298 CAGGGGAGACAGGGACGGGGAGG - Intergenic
1181433353 22:22895980-22896002 AAGGGGTGACTGGGAGAGGAAGG - Intronic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181844368 22:25694751-25694773 CAGGGGAGGCAGGGAAAGGGAGG - Intronic
1182550521 22:31098626-31098648 CATGTTAGGCAGGGAGAGCAGGG - Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1183255581 22:36759474-36759496 CAGGGTGCACAGGGACAGGCTGG + Intronic
1183291194 22:37002919-37002941 CGTGGGAGACAGGGAGAGGCGGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183375652 22:37463405-37463427 CAGGGTAGACGTGGGGAGGGAGG + Intergenic
1183520574 22:38294201-38294223 GCGGGTCGACCGGGAGAGGAAGG - Exonic
1183683981 22:39350995-39351017 ACGGGTGGTCAGGGAGAGGATGG + Intronic
1183775685 22:39963313-39963335 CTGGGTCTACAAGGAGAGGATGG - Intronic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184389230 22:44193373-44193395 CAGCGTAGGGAGGGAGAGGATGG + Intronic
1184889322 22:47369845-47369867 AAGGGTGGACAGGGAGAAGGAGG - Intergenic
1184971855 22:48028132-48028154 CAGGGCACAGAGGGAGTGGAAGG + Intergenic
1185013812 22:48331993-48332015 CAGGGCAGACAGGTACAGGGAGG - Intergenic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950423198 3:12910637-12910659 CAGGGCATACAGGGAGTGCAGGG + Intronic
950494236 3:13324224-13324246 CAGGGAGGAAGGGGAGAGGAGGG - Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950649053 3:14395951-14395973 CAGGGGAGATGGGGAGGGGAGGG + Intergenic
950686297 3:14620836-14620858 GAGAGTAGGCAGGGAGGGGAAGG + Intergenic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
951277404 3:20705218-20705240 AAGGATAGACAGGGAGAAAAAGG - Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952538376 3:34338310-34338332 TAGGGTGGACAGGGAAAGGAGGG + Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953757780 3:45662596-45662618 TAGGGAAGGAAGGGAGAGGATGG - Intronic
953930783 3:47004767-47004789 GAGGCTAGGCAGGGAGGGGAAGG - Intronic
954690437 3:52392742-52392764 TAGGGCAGGCAGGGAGAGGTGGG - Intronic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955497024 3:59544106-59544128 CAGGGAAGACAGGTATAGAAAGG + Intergenic
955989882 3:64615202-64615224 CAAGGGAGAAAGGGAGAGGTGGG + Intronic
956392460 3:68788229-68788251 CAGGGTAGTGAGGGAGAAGGTGG - Intronic
956576364 3:70757023-70757045 CAGGGGAGTCAGGGAGAGAGAGG - Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958744328 3:98114227-98114249 CAGTTTACACAGGGAGAGGGAGG - Intergenic
959935630 3:112025640-112025662 TATGGTAGAGAGGGGGAGGATGG - Intergenic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960347388 3:116550908-116550930 GAGGGTAGAGGGTGAGAGGAGGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960883225 3:122367102-122367124 GTGGGGAGACAGGGAGAGGGAGG + Intronic
961018701 3:123486298-123486320 CAGGGGAGACAGAGAAAGGTTGG + Intergenic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
961740761 3:129031964-129031986 CTGGGTGGAGAGGAAGAGGAGGG + Intronic
961786464 3:129350036-129350058 CAGGGCTGACAGGCAGAGCAGGG - Intergenic
961829908 3:129618122-129618144 GAGGGTGGTCAGGCAGAGGAGGG + Intergenic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962479593 3:135787042-135787064 CAGGGTTGATTGGGAGAGGATGG + Intergenic
962784769 3:138757639-138757661 AAGGGAGGAGAGGGAGAGGAAGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963919143 3:150888919-150888941 GATGGAAGACAGGGAGGGGAGGG + Intronic
963983167 3:151562842-151562864 CAGGGCAGTCAGGGAGTGGTCGG + Intergenic
964546014 3:157834658-157834680 GAGCTTAGCCAGGGAGAGGATGG - Intergenic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
964768178 3:160198224-160198246 CTGGGCAGACAGGGAGAGTTGGG + Intergenic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965179196 3:165379380-165379402 GAGGGTAGAGAGAGAAAGGAAGG - Intergenic
965384429 3:168029225-168029247 CAGGGAATCCAAGGAGAGGAAGG - Exonic
965386158 3:168049093-168049115 CAGAGTAGACTGGGTGGGGAGGG - Intronic
965494573 3:169382210-169382232 CAGCGGGGAAAGGGAGAGGAAGG + Intronic
965540662 3:169868177-169868199 GATGGGAGACATGGAGAGGAAGG - Intronic
965743743 3:171903671-171903693 GAGGGGAGATAGGGAGAGGTTGG - Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
966861542 3:184233470-184233492 CAGGGTACCCAGGGATGGGAAGG + Intronic
967138018 3:186528910-186528932 CAAGGCAGAGAGGCAGAGGATGG + Intergenic
967374319 3:188783554-188783576 GAGGGTGGAGGGGGAGAGGAGGG + Intronic
967948172 3:194820469-194820491 CAGGCTAGACAGGGAGGAGGAGG + Intergenic
967972858 3:195012150-195012172 CAGGGTGGCCAAGGACAGGAGGG + Intergenic
968456116 4:700885-700907 CAGGGCAGGGACGGAGAGGAGGG - Intergenic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969465096 4:7351659-7351681 GATGGAAGAGAGGGAGAGGAAGG - Intronic
969717960 4:8877524-8877546 GAGGGGAGGCATGGAGAGGAGGG + Intergenic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970083201 4:12314083-12314105 CAGGGTAGAAAGTGGAAGGAGGG + Intergenic
970251713 4:14123356-14123378 AAGTGCAGACTGGGAGAGGAGGG - Intergenic
970682619 4:18528094-18528116 GAGGGTAGAGGGCGAGAGGAGGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
971791332 4:31173624-31173646 CAGAGTGGAGAGTGAGAGGAGGG - Intergenic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
975363642 4:73502431-73502453 AAGGGTAGTCAGGGAGAAAAGGG + Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975452363 4:74544148-74544170 GAGGGTGGACAGGGAGAGACTGG + Intergenic
975807715 4:78130120-78130142 CAAGGTAGAGAGGAAGAGCAAGG - Intronic
975901236 4:79155513-79155535 CATGGTAGAAAGGGAGAGCGTGG + Intergenic
975971729 4:80047552-80047574 CAAGGGAGAGAGGGAGAAGAAGG - Intronic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
976349093 4:84040277-84040299 CAGGGCAGATGGGGAGGGGAGGG - Intergenic
976611396 4:87034259-87034281 CAGGGAGGATAGGGGGAGGAAGG + Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
978430956 4:108633055-108633077 CAGGGTAGAGGGTGGGAGGAGGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979939221 4:126738924-126738946 TGGGATAGACAGTGAGAGGAAGG - Intergenic
980156259 4:129110661-129110683 GAAGGCAAACAGGGAGAGGAAGG - Intronic
981444787 4:144823131-144823153 GAGGGTGGAGAGCGAGAGGAGGG - Intergenic
981738046 4:147973199-147973221 CAGAATAGACATGGAGGGGAAGG + Intronic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
983468091 4:168120616-168120638 CAACGTTGACAGGGAGAAGAGGG + Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
984501376 4:180563625-180563647 CAGGCTCTACAGGGAGAGCAGGG + Intergenic
984596646 4:181676518-181676540 CAGAGAGGAGAGGGAGAGGAGGG - Intergenic
984612324 4:181855812-181855834 AAGGAGAGAAAGGGAGAGGATGG + Intergenic
984854601 4:184183954-184183976 GCTGGTAGACAGGGAAAGGAAGG - Intronic
984949239 4:184994467-184994489 CAGCATAGATGGGGAGAGGATGG + Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985099118 4:186440409-186440431 GAGTGTTGAAAGGGAGAGGAAGG + Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985757093 5:1725584-1725606 CGGGGTATACCAGGAGAGGAGGG - Intergenic
985843017 5:2323584-2323606 CAGGGGAGACAGGGAGTGAAAGG + Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986264560 5:6181057-6181079 CACAGGAGAGAGGGAGAGGAGGG - Intergenic
986541969 5:8853874-8853896 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
989017344 5:36954208-36954230 AAGGGTAGAAAGTGAGAGGATGG + Intronic
989388169 5:40873590-40873612 GAAGCTAGAAAGGGAGAGGAAGG + Intergenic
989476811 5:41883557-41883579 AAGGGTGGAGAGTGAGAGGAGGG + Intergenic
989667015 5:43866445-43866467 CAGGGTGGTCAGGGAGAACAGGG + Intergenic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
991251201 5:64563143-64563165 AAGGGTAGAAAGGGAAAGTAGGG + Intronic
992111527 5:73498643-73498665 CAGGGCAGAGGAGGAGAGGAAGG + Exonic
992624813 5:78627357-78627379 CAGGGGAGACAGGGAAAGTGAGG - Intronic
992808353 5:80360896-80360918 AAGGTTAGGCAGGCAGAGGAGGG - Intergenic
993298365 5:86173801-86173823 CATGGTGGATGGGGAGAGGATGG + Intergenic
993726912 5:91380034-91380056 GAGGGAAGAAAGGGAAAGGAAGG - Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995123115 5:108556108-108556130 GGGGGTACAGAGGGAGAGGAAGG + Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995682414 5:114734760-114734782 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996621898 5:125515296-125515318 CAGGGTATAGGGTGAGAGGAAGG + Intergenic
997399464 5:133591267-133591289 CTGACAAGACAGGGAGAGGAAGG + Intronic
997533797 5:134599982-134600004 AAGGGAAGAAAGGGAAAGGAAGG + Intergenic
997835651 5:137191002-137191024 AAGGGTAGACACTGACAGGAAGG - Intronic
998158187 5:139797843-139797865 CAGGGAAGAAGAGGAGAGGATGG - Intronic
998430401 5:142065340-142065362 GAGGGTGGAAAGGCAGAGGAGGG + Intergenic
999044957 5:148457078-148457100 CAGGCTAGGCAGGCAGAGGGGGG - Intronic
999243124 5:150138880-150138902 CCAGGGAGACTGGGAGAGGAGGG - Intronic
999269017 5:150285626-150285648 CATGGTTGACAGGGAGGAGAGGG - Intronic
999553618 5:152717586-152717608 CAGGTTCCACAGGAAGAGGAGGG - Intergenic
999690126 5:154139326-154139348 AAGGGAAGAGAGGGAGAGTAAGG - Intronic
999699720 5:154217413-154217435 CAAGGGAGACAGTGAGAGGGTGG + Intronic
1000359573 5:160434539-160434561 CAGGGGAGAGAGGGAAAGGCAGG + Intergenic
1001510200 5:172315270-172315292 CAGGGTTGTCTGGGAGAGAAGGG - Intergenic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1002164588 5:177336520-177336542 CCAGGTAGTCAGGGAGGGGAGGG + Intronic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002518693 5:179777934-179777956 CAGGGCAGCCTGGGAGAGGCTGG + Intronic
1002565194 5:180109043-180109065 CAGGGCAGAGAGGGAGAAAAGGG - Intronic
1002791466 6:440773-440795 CAGGGTAGGAAGGGATGGGATGG - Intergenic
1002821209 6:726673-726695 GAGGGTAGAGGGTGAGAGGAGGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003140791 6:3469628-3469650 CTGAGAGGACAGGGAGAGGAAGG - Intergenic
1003447827 6:6200792-6200814 CAGGGTCTGCAGGGAGAGAAGGG + Intronic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1005103915 6:22202992-22203014 CACAGAAGACAGGGAGAAGATGG + Intergenic
1005801515 6:29429786-29429808 GGGGGAAGACAGGGAGAGAAAGG + Intronic
1005896649 6:30184911-30184933 ATGGGAAGACAGGGAAAGGAAGG - Exonic
1006365170 6:33611005-33611027 CAGAGTGGAGAGGGAGAGAAAGG - Intergenic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1007387232 6:41528195-41528217 CAGGGAAGCCAGGGAAATGAAGG - Intergenic
1007388384 6:41534893-41534915 GAGGGTAGGCAGGGTAAGGATGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007975644 6:46098675-46098697 CAGCCTGGACAGGGAGTGGAAGG + Intergenic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008512224 6:52287030-52287052 CAGAGTATACAGGAAGAGAATGG + Intergenic
1009330646 6:62415519-62415541 AAGGGTAGACGGTGAGAGGAGGG + Intergenic
1009734475 6:67659216-67659238 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
1010415703 6:75609186-75609208 GCGGGGAGAAAGGGAGAGGAAGG - Intronic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1012097280 6:94978124-94978146 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1012404243 6:98876798-98876820 AAGGGTGGTGAGGGAGAGGACGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013432071 6:110064226-110064248 CAGGGCAGATAAGGAGAGGGCGG + Intergenic
1014274118 6:119367433-119367455 CAGGGTGGAGGGTGAGAGGAGGG + Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015334884 6:132025642-132025664 CAGGGCAGGCGGGGAGAGAAAGG + Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1015732446 6:136362469-136362491 AAAGGAAGAAAGGGAGAGGAGGG - Exonic
1015801618 6:137066192-137066214 CAGTAGAGACAGGGAGAGAAGGG + Intergenic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016696849 6:147006204-147006226 GAAGGTAGACAGTAAGAGGAGGG - Intergenic
1016998214 6:149976176-149976198 CAGTGAAGACAGGGAGAGACTGG + Intergenic
1017063193 6:150505970-150505992 AAGGGTAGTGAGGGAGGGGAGGG + Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017191763 6:151661814-151661836 CAGGAGAGAGAGGGAGAGAAAGG - Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017743232 6:157425738-157425760 CAGGGGAAACAGGGACCGGATGG - Intronic
1017991974 6:159497794-159497816 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1018266112 6:162025932-162025954 CTTGGTAGATAGGGAGATGAGGG + Intronic
1018315262 6:162550334-162550356 GGGGCTAGACAGGGAAAGGAAGG + Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018362686 6:163087586-163087608 CAGGGGAGAGAAGGTGAGGATGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018449182 6:163890830-163890852 GAAGGAAGAGAGGGAGAGGAAGG - Intergenic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1019095307 6:169574942-169574964 CAGGACAGAAAGGCAGAGGAGGG + Intronic
1019165696 6:170096291-170096313 CAGGGCTGGGAGGGAGAGGAAGG - Intergenic
1019196175 6:170284414-170284436 CAGGGGAGGGAGGGAGGGGAAGG + Intronic
1019712193 7:2522795-2522817 GAGGGCTGTCAGGGAGAGGAAGG + Intronic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1020117921 7:5486852-5486874 CAGGCCACCCAGGGAGAGGACGG + Intronic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1021845192 7:24757097-24757119 CAGCGGGGACGGGGAGAGGATGG + Intronic
1021924218 7:25519295-25519317 CAGGGAAAAGAGGGAGAGCAGGG + Intergenic
1021958230 7:25847762-25847784 CAGATAAGACAGGGAGAAGAAGG - Intergenic
1022075758 7:26968328-26968350 GAGGGTGGAGAGTGAGAGGAAGG - Intronic
1022100955 7:27168922-27168944 AAGGGAAGACAGGGAAAAGAAGG + Intronic
1022224683 7:28350731-28350753 AAGGGTAGGCAAGGAGAAGAGGG + Intronic
1022489525 7:30805788-30805810 AAGGGTACACAGGGACAGGGTGG + Intronic
1023873518 7:44275128-44275150 CAGGGAAGGGAGGGAGGGGAGGG - Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024406292 7:48985231-48985253 GAGGGTGGAGGGGGAGAGGAGGG - Intergenic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1024594519 7:50920854-50920876 GAGGGGAGGCAGGGAGGGGAAGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026305196 7:69134451-69134473 AAGGGGAGACAGGGAGGGAAAGG - Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1027358313 7:77382054-77382076 CAAGTTAGAGAGGGAGAGGAAGG - Intronic
1027418755 7:77999571-77999593 GAGGGAGGGCAGGGAGAGGAGGG + Intergenic
1028455606 7:91035140-91035162 GAGGGTAGACAGGGAGAAGTGGG - Intronic
1028640377 7:93035751-93035773 GAGGGTAGAGGGTGAGAGGAAGG + Intergenic
1028688478 7:93621212-93621234 CAGGGCAGACTGGAAGGGGAAGG + Intronic
1028785520 7:94788371-94788393 GACGGTAGAGAGTGAGAGGAGGG - Intergenic
1028920763 7:96307658-96307680 CTGGCTAGATAGGGAGATGAGGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029889650 7:103914026-103914048 CAGGGTTGCCTGTGAGAGGAAGG + Intronic
1030131826 7:106208013-106208035 CAGGATCGTGAGGGAGAGGAAGG - Intergenic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030287035 7:107837441-107837463 CTGGCTGGACAGGGAGAGGTGGG - Intergenic
1031074354 7:117198706-117198728 CAGGTGCAACAGGGAGAGGAAGG - Intronic
1031181956 7:118430720-118430742 GAGGGTAGAAGGTGAGAGGAAGG - Intergenic
1031460928 7:122047730-122047752 CAGTTAAGCCAGGGAGAGGAAGG - Intronic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1032493194 7:132340488-132340510 CAGTGGGGACAGGGACAGGAAGG - Intronic
1032511303 7:132474744-132474766 CAAGGTAGAAATGCAGAGGAGGG - Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033866138 7:145692373-145692395 CAGTTTACACAGGGAGAGGGAGG - Intergenic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1034453349 7:151149653-151149675 CAGGACAGACGGGGAGAGAAGGG + Intronic
1034748182 7:153542747-153542769 AAGGGGAAACAGGGAGATGATGG + Intergenic
1035022617 7:155808394-155808416 GAGGGCAGCCAGGGAGAGGGCGG + Intronic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035651098 8:1265844-1265866 AAGAGTAGACAGGTAGGGGAGGG + Intergenic
1035747773 8:1974140-1974162 GAGGGGGGACCGGGAGAGGAGGG + Intronic
1035772390 8:2158280-2158302 AGTGGTAGACAGGGAAAGGATGG - Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036620059 8:10419128-10419150 CAGGGTCGGGAGGGAGTGGAGGG - Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036744270 8:11392958-11392980 GACGGTGGACAGGGAGAGAATGG + Intronic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037926442 8:22847258-22847280 CAGGGTAGGATGGGAGAGGATGG - Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038378667 8:27070655-27070677 CAAGGAAGACAGGGAGTGAAGGG - Intergenic
1038646345 8:29365491-29365513 CAGGGAAGCCAGGGAGAATACGG - Intergenic
1039547584 8:38421019-38421041 CAGGGCAGAGTGGGAAAGGAGGG + Intronic
1039893358 8:41699173-41699195 GAGGGGAGCCTGGGAGAGGATGG + Intronic
1040617779 8:49056199-49056221 CAAGTGAGACAGGGAGAGGGAGG - Intronic
1041098726 8:54374924-54374946 CAGAGAAGATGGGGAGAGGAGGG + Intergenic
1041514752 8:58688649-58688671 CCAGCTGGACAGGGAGAGGAAGG + Intergenic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1042457085 8:69018417-69018439 CAATGTAGACAGGAAGAAGATGG - Intergenic
1042646834 8:70996751-70996773 CAGGGTAGAAGGGTAGAAGAAGG - Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043718464 8:83512920-83512942 CAGGGTAGACAATGAGGGTACGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044802207 8:95968778-95968800 GAGGGGAGACAAGGAGACGAAGG + Intergenic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045347354 8:101305036-101305058 CAGGGTGGGCAGGGAAAGGCAGG + Intergenic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046239516 8:111472328-111472350 GAGGGTGGAGAGGGAGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046984351 8:120370765-120370787 CAGGGGAGGAAGGGAGAGTAGGG - Intronic
1047099252 8:121658054-121658076 GAGGGTAGAGGGTGAGAGGAGGG - Intergenic
1048292711 8:133192697-133192719 CTGGGAGGGCAGGGAGAGGATGG + Intronic
1048299248 8:133239262-133239284 CCGAGTGGACATGGAGAGGACGG - Intronic
1048696260 8:137031631-137031653 AAGGGGAGGAAGGGAGAGGAGGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049175590 8:141190609-141190631 CTGGGTAGAAAGGCAGAGGGAGG - Intronic
1049309594 8:141926617-141926639 CAGGCTAGACAGGGAGGGCCAGG - Intergenic
1049328633 8:142038108-142038130 CAGGGGTGGCAGGGAGAGGCTGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1050009590 9:1172164-1172186 CTGGGTGGATGGGGAGAGGAAGG + Intergenic
1050589893 9:7150027-7150049 TACTGTAGAAAGGGAGAGGAAGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1051721123 9:20038576-20038598 TATCGTAGAAAGGGAGAGGATGG - Intergenic
1055341026 9:75283350-75283372 CAGGGTGCACGGTGAGAGGAGGG - Intergenic
1055786991 9:79881634-79881656 AAAAGAAGACAGGGAGAGGAGGG - Intergenic
1055824474 9:80307066-80307088 GAGGGAAGCGAGGGAGAGGAAGG - Intergenic
1056024878 9:82483498-82483520 CAGGATAGAAAGGGTGAGAATGG + Intergenic
1056163160 9:83918334-83918356 CAGGACAGGGAGGGAGAGGAGGG + Intronic
1056861522 9:90188871-90188893 GAGGGTAGAGAGGGACAGGCAGG - Intergenic
1056918847 9:90768440-90768462 CATGGAAGACAGGAAGAGGCAGG + Intergenic
1057274702 9:93670174-93670196 CAGGGAGCAGAGGGAGAGGACGG + Intronic
1057490548 9:95516587-95516609 GAGGGAAGACTGGGAGAAGACGG - Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057569374 9:96192641-96192663 CAGTGTAGATAGGGAAAGAATGG + Intergenic
1057807620 9:98231202-98231224 AAGGGCTGACTGGGAGAGGAAGG + Intronic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059740660 9:117146307-117146329 CAGGAAAGGGAGGGAGAGGAGGG + Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1059987573 9:119835392-119835414 GAGGGAAGGAAGGGAGAGGAAGG + Intergenic
1059987586 9:119835438-119835460 GAGGGAAGGAAGGGAGAGGAAGG + Intergenic
1060147957 9:121268278-121268300 CCGGGAAGGAAGGGAGAGGAAGG - Intronic
1060214437 9:121730221-121730243 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1060227777 9:121805831-121805853 AAGGGAGGATAGGGAGAGGATGG + Intergenic
1060252162 9:121995188-121995210 CAGGATAGAGAGGAAGAAGAGGG + Intronic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060424982 9:123496964-123496986 CAGGGGAGATAGGGAGTGGTGGG - Intronic
1060442683 9:123656223-123656245 CAGGGAAGAGAGTGAGAGGCAGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061397744 9:130352775-130352797 CATGGTGGACAAGGAGGGGAGGG - Intronic
1061405370 9:130390731-130390753 CAGGGCGGGGAGGGAGAGGATGG + Intronic
1061463755 9:130761390-130761412 CAGGGTAGGGAGGGACTGGAAGG - Intronic
1061466041 9:130780596-130780618 CAGAGGAGAGAGGGAGATGAGGG - Intronic
1061492108 9:130951074-130951096 AGGGGGAGACAGGGAGAGGAAGG - Intergenic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062117605 9:134817802-134817824 GAAGGCAGACAGGGAGAGAAAGG + Exonic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062437867 9:136554624-136554646 CTGGGAAGACAGGCAGAGGCTGG + Intergenic
1062440846 9:136568631-136568653 CGGGGTAGGGAGGGAGAGGGTGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062525126 9:136975155-136975177 CAAGGTGGACAGGGGCAGGAGGG - Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185459944 X:329110-329132 TAGGGGGGACGGGGAGAGGAGGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186577770 X:10784973-10784995 CAGGGCAGTCAGGCAGAAGAGGG + Intronic
1186625746 X:11291629-11291651 CAAGGTGGTAAGGGAGAGGAAGG - Intronic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187242941 X:17530214-17530236 CTGGCTGGAGAGGGAGAGGAGGG - Intronic
1187397450 X:18930929-18930951 CCGGGGAGGCAGGGAGGGGAAGG - Intronic
1187428451 X:19200199-19200221 CAGGGTAGAGTGAGAGATGAGGG + Intergenic
1187452840 X:19413765-19413787 GAGGGGAGAGAGGGAGAAGAGGG + Intronic
1187514484 X:19955138-19955160 CAAGTTAGAAAGGGAGAGGCTGG - Intronic
1187726598 X:22209693-22209715 GAGGGAAGAGAGGGAGAGGGAGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187882905 X:23862921-23862943 AAGGGGAGAGAGGGAGGGGAGGG + Intronic
1187941942 X:24391172-24391194 CAGGGGAGGCAGGGAGGGAATGG + Intergenic
1188053077 X:25510296-25510318 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1188335062 X:28921492-28921514 GAGGGTAGACAGGGAAAGAAAGG - Intronic
1188573080 X:31613016-31613038 CCAGGTAGACAAGGAGAGAAAGG + Intronic
1189206210 X:39241403-39241425 CAGGGTCGGGAGGGAGAAGAGGG - Intergenic
1190054986 X:47176118-47176140 GAGGGGAGACAGGGAGGGGGAGG - Intronic
1190491846 X:50990336-50990358 CCAGGTAGACAAGGAGGGGAAGG + Intergenic
1190501314 X:51081344-51081366 CCAGGTAGACAAGGAGGGGAAGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192317667 X:70065611-70065633 CAGGCTGGAGAAGGAGAGGAAGG + Intergenic
1192415079 X:70972552-70972574 GAGGGTAGAGGGTGAGAGGAAGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192511520 X:71723006-71723028 CATGGTCGACAGGGTGTGGAAGG + Intergenic
1192515177 X:71758499-71758521 CATGGTCGACAGGGTGTGGAAGG - Intergenic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192529335 X:71872022-71872044 GAGGGTGAAAAGGGAGAGGAGGG + Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193350726 X:80462026-80462048 GAGGGTGGAAAGTGAGAGGAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1197353595 X:125406334-125406356 GAGGGTAGAGGGTGAGAGGATGG - Intergenic
1198205107 X:134458501-134458523 GAGGGAAGACAGGGAAAGTAGGG + Intergenic
1198242024 X:134796589-134796611 GAGGGGGGAAAGGGAGAGGAAGG + Intronic
1198556761 X:137802326-137802348 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198733232 X:139756818-139756840 CAGGGTGGAGAGTGAGAGGAGGG + Intronic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1199518951 X:148713179-148713201 CAGATGAGACAGGGAGGGGAAGG + Intronic
1199850838 X:151724079-151724101 GAGAAGAGACAGGGAGAGGAGGG + Intergenic
1199943877 X:152650355-152650377 CAGGGTGGAGAGGTACAGGATGG - Intronic
1200022060 X:153220111-153220133 CAAGTGAGACAGGGAGAAGAAGG - Intergenic
1200080218 X:153572560-153572582 GAGGTTAGACAGGGTGGGGAGGG - Intronic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic