ID: 1100619154

View in Genome Browser
Species Human (GRCh38)
Location 12:96255157-96255179
Sequence TTGGTGACTGACTGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 804}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100619149_1100619154 -10 Left 1100619149 12:96255144-96255166 CCGTCAGCAGGAGTTGGTGACTG 0: 1
1: 0
2: 0
3: 21
4: 158
Right 1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG 0: 1
1: 0
2: 5
3: 87
4: 804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100619154 Original CRISPR TTGGTGACTGACTGGGTGGG AGG Intronic
900103760 1:973654-973676 TGGGTGACAGAAAGGGTGGGAGG + Intronic
900357925 1:2273608-2273630 TGGGTGGCTGACCTGGTGGGGGG + Intronic
900495652 1:2974847-2974869 TTGGGGACTGGCTGGGTGGGTGG + Intergenic
900496463 1:2978197-2978219 TTGGTTTCTGAGTGGGTGAGGGG + Intergenic
900509325 1:3051153-3051175 TGGGTGGCTGGGTGGGTGGGTGG - Intergenic
900509348 1:3051223-3051245 TTGGTGGATGAGTGGGTTGGTGG - Intergenic
900509401 1:3051429-3051451 TTGGTGAATGGTTAGGTGGGTGG - Intergenic
900535773 1:3176498-3176520 TGGGTGAATCAATGGGTGGGTGG - Intronic
900597330 1:3487409-3487431 TTGGAGACTGGAAGGGTGGGAGG + Intergenic
900649861 1:3725501-3725523 TGGGTGAATGGATGGGTGGGTGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901318013 1:8322028-8322050 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
901318036 1:8322112-8322134 TTGGTGACTGAGTGGGTGGATGG + Intronic
901863753 1:12090516-12090538 TAGGTGGATGAGTGGGTGGGTGG - Intronic
902163537 1:14551653-14551675 TTGGTGAGTTAGTGGGTGGAGGG + Intergenic
902176130 1:14652561-14652583 TAGGTGGATGAGTGGGTGGGTGG - Intronic
902201718 1:14838464-14838486 TGGGTAACTGACCAGGTGGGGGG - Intronic
902202625 1:14845196-14845218 TGGGTGAGTGAGTGGATGGGTGG + Intronic
902367155 1:15983690-15983712 TTGGCGACTGACTGAGGGTGGGG - Intergenic
902621848 1:17655384-17655406 TCGGTGAATGAATGGATGGGTGG - Intronic
903002092 1:20273774-20273796 TGGGTGGATGAATGGGTGGGTGG + Intergenic
903277518 1:22231431-22231453 TGGGTGAATGAATGGGTGGATGG - Intergenic
903294703 1:22336353-22336375 TAGGTGACTGAGTGGATGGGTGG - Intergenic
903294773 1:22336765-22336787 TGGGTGATTGAGTGGATGGGTGG - Intergenic
903305764 1:22411903-22411925 TGGGTGGCTGAATGGGTGGGTGG + Intergenic
903359853 1:22770100-22770122 TAGGTGAGTGTGTGGGTGGGTGG + Intronic
903374976 1:22860188-22860210 TTGGAGAGTGGGTGGGTGGGAGG + Intronic
903777777 1:25804346-25804368 TTGCTGACTGACTGGCTAGCAGG - Intronic
904311553 1:29632700-29632722 TGGGGGACTGAGTGGCTGGGAGG - Intergenic
904663239 1:32100590-32100612 TTGGGGCCTGAGAGGGTGGGAGG + Intronic
904698091 1:32341758-32341780 TTGGTCACTGTCTGGATGGCAGG - Intergenic
905241266 1:36583141-36583163 TTGGTGGGTGGGTGGGTGGGTGG - Intergenic
905488285 1:38323244-38323266 TGGGTGACTGGGTGGGTGGTAGG + Intergenic
905656690 1:39690516-39690538 TTGGTGCCTGGCTGTGAGGGGGG + Intronic
905878595 1:41449113-41449135 TTGGTGACTGGCTGGGGAGGCGG + Intergenic
906070588 1:43013584-43013606 TTGGTGACTGACAGGATGCTGGG + Intergenic
906095102 1:43217591-43217613 ATAGTGCCTGACTGGGTGTGGGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
906200192 1:43955082-43955104 TTGATGACTGACTGGATATGAGG - Intronic
906300231 1:44676138-44676160 TTGGTTACTAATTGGGTGTGGGG + Intronic
906400642 1:45501845-45501867 TTGGTGGCTGATTGGATGTGGGG - Intronic
906478535 1:46185726-46185748 TTGGTGGGTGGATGGGTGGGGGG + Exonic
906524666 1:46487308-46487330 GTGGTGTGTGGCTGGGTGGGCGG - Intergenic
906923383 1:50088792-50088814 GTGCTGACTGGCTGTGTGGGTGG - Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907899126 1:58721336-58721358 TTGGTGACAGATTGGCTGTGGGG + Intergenic
908466382 1:64400096-64400118 GTGGTGACTGACTCAGTGGAGGG + Intergenic
908673393 1:66574104-66574126 TTTCTGAATGACTGCGTGGGAGG - Intronic
908680372 1:66654084-66654106 TTGTTGATTGTCTGGGTGGATGG + Intronic
910375048 1:86559305-86559327 TGGGAGACTGTGTGGGTGGGAGG - Intronic
911092612 1:94029798-94029820 TTTGTGACTGACTAGGTGTGGGG + Intronic
911366870 1:96949267-96949289 TTGGCCACTCACTGGGTGTGAGG - Intergenic
912472641 1:109916165-109916187 TTGGTGGCTGGTTGGGTGTGGGG - Intronic
912727920 1:112075841-112075863 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
912727922 1:112075845-112075867 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
912952429 1:114129167-114129189 TTGATGACAGACTGGGTGGAGGG - Intronic
914852105 1:151322511-151322533 ATGGTGATTAACTGGGTGAGGGG - Intronic
915489097 1:156241672-156241694 TTGGTGACTCACCGGGTGAACGG + Intronic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916124011 1:161553201-161553223 TTGGTGAGTGATTGGCTGAGGGG + Intergenic
916133894 1:161634563-161634585 TTGGTGAGTGATTGGCTGAGGGG + Intronic
916984624 1:170177459-170177481 TTGCTGAATGATTGGGTGGGAGG + Intergenic
918505027 1:185244554-185244576 TGGGTGAGTCAGTGGGTGGGTGG + Intronic
918770334 1:188549352-188549374 TTGCTGGGGGACTGGGTGGGGGG + Intergenic
919259683 1:195175873-195175895 TTGGTGTCTGACTGGAGAGGTGG + Intergenic
919895665 1:202008342-202008364 TGGGTGAGGGACTGGGTGGAGGG + Exonic
920537500 1:206748228-206748250 TTGGTGACTGGCTGGATGTGAGG - Intergenic
922526914 1:226310781-226310803 TGGGTGAGTCACTGGGTGTGAGG + Intergenic
922964360 1:229675623-229675645 TGGGTGAGTGAGTGGGTGTGTGG - Intergenic
922998027 1:229982410-229982432 GTGGTGACTGACTGGCAGAGTGG - Intergenic
923326438 1:232884324-232884346 CTAGTGACAGTCTGGGTGGGAGG + Intergenic
923367477 1:233277132-233277154 CAGCTGACTGCCTGGGTGGGAGG + Intronic
1062943929 10:1445461-1445483 GTGGTGAATGGATGGGTGGGTGG - Intronic
1063378445 10:5569026-5569048 TTGTTGGCTGACTGGTTGGTGGG + Intergenic
1063378456 10:5569086-5569108 TTGGTGCTTGACTGGTTGGTTGG + Intergenic
1064006386 10:11702627-11702649 TCGGTCACTGGCTCGGTGGGTGG - Intergenic
1064071126 10:12229020-12229042 TTGGTGACTCACTGAAAGGGAGG - Intronic
1064142399 10:12801545-12801567 TTGGTGAATGGATGGATGGGTGG - Intronic
1064986750 10:21218103-21218125 TTGGTGATTGCCTGGGTGTCAGG - Intergenic
1065564203 10:26992773-26992795 TTGGTAATTGACTGGTTGAGTGG - Intronic
1067332444 10:45334462-45334484 TTGGTGACTATCCGGGTGTGAGG - Intergenic
1067709582 10:48637396-48637418 ATGGTGAATGAGTGGGTGGATGG + Intronic
1068394252 10:56441332-56441354 TTGTTGACTCACTGGGTGATTGG + Intergenic
1069441558 10:68433258-68433280 TTGGATACTGATTGGGTGTGTGG - Intronic
1069619675 10:69829153-69829175 TTGGTGATTGACGGGGTGTGAGG - Intronic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1070268107 10:74924403-74924425 TTGGTGACTAATTGGGTTAGAGG + Intronic
1070749886 10:78957792-78957814 TGGGAGAATGAATGGGTGGGTGG + Intergenic
1072105856 10:92273073-92273095 TTGGTGACTGACTGATGGGTAGG + Intronic
1072240407 10:93490371-93490393 TTGGTAACGGCCGGGGTGGGAGG - Intergenic
1072246441 10:93547833-93547855 TTGGTGGATGGATGGGTGGGTGG + Intergenic
1074567686 10:114596093-114596115 TTGATGACTGACTGAATGGGAGG - Intronic
1074751259 10:116589573-116589595 TTGGTGATGGACTGGGAAGGTGG - Intergenic
1074872293 10:117586756-117586778 TGGGTGAATGATTGGATGGGTGG - Intergenic
1074936079 10:118182659-118182681 TGGGTGAATGGATGGGTGGGTGG + Intergenic
1074996571 10:118762227-118762249 TTGGTGAATGACTGAGTGAAAGG - Intergenic
1075627096 10:123971309-123971331 TTTGTGAGTGACTGTGTGTGAGG - Intergenic
1075844403 10:125533982-125534004 CTGGTGGGTGACTGGGTGTGGGG + Intergenic
1075987880 10:126803701-126803723 TTGGTTAGGGACTGGGAGGGAGG - Intergenic
1075997512 10:126890562-126890584 TTGGTTACTGCCTGTGTGGGAGG - Intergenic
1076246386 10:128950466-128950488 ATGGTGTCTGAGTGAGTGGGAGG - Intergenic
1076278137 10:129223501-129223523 TGAGTGGGTGACTGGGTGGGTGG + Intergenic
1076278183 10:129223827-129223849 TAAGTGAATGACTGGCTGGGTGG + Intergenic
1076278227 10:129224013-129224035 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1076763180 10:132615823-132615845 TTGGAGACTGAGGGGCTGGGAGG + Intronic
1076835830 10:133020608-133020630 CTGGTGCCTGGCTGGATGGGGGG - Intergenic
1076837409 10:133028202-133028224 TTGGTGGATGGATGGGTGGGTGG + Intergenic
1076867511 10:133175287-133175309 TGGGTGGCTGGATGGGTGGGTGG + Intronic
1076931864 10:133536850-133536872 TGGCTGGCTGGCTGGGTGGGTGG + Intronic
1077168574 11:1154548-1154570 TGGGTGAGTGAGTGAGTGGGTGG - Intergenic
1077171785 11:1169660-1169682 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171817 11:1169866-1169888 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171888 11:1170267-1170289 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171927 11:1170477-1170499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171966 11:1170689-1170711 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172054 11:1171254-1171276 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172068 11:1171367-1171389 TGGGTGAGTGAATGGGTGAGTGG - Intronic
1077172088 11:1171477-1171499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172098 11:1171525-1171547 TAGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172110 11:1171585-1171607 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172124 11:1171665-1171687 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172130 11:1171693-1171715 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077312090 11:1893398-1893420 TGGGTGAATGGATGGGTGGGTGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077319112 11:1933120-1933142 TGGGTGAATGGGTGGGTGGGTGG - Intronic
1077319124 11:1933156-1933178 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1077319126 11:1933160-1933182 ATGGTGGGTGAGTGGGTGGGTGG - Intronic
1077357728 11:2126490-2126512 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1077357791 11:2126764-2126786 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1077357832 11:2126951-2126973 TTGGTGAATGAGTGGGTAAGTGG + Intergenic
1077537508 11:3131547-3131569 TGGATGAATGAATGGGTGGGTGG - Intronic
1078060134 11:8038020-8038042 TTGATGATTGTCTGGGTTGGTGG + Intronic
1078550653 11:12278075-12278097 TGGGTGAGTGAGTGGGTGAGTGG + Intronic
1079081048 11:17413993-17414015 TTGGTCACTTACTGGCTGGGTGG + Intronic
1079341870 11:19618243-19618265 TTGCTGGCTGGCTGGCTGGGTGG + Intronic
1080458572 11:32435426-32435448 TGGGTGAATGAGTAGGTGGGAGG + Exonic
1081649550 11:44814690-44814712 TTGATGAATGAGTGGGTGGGTGG - Intronic
1081657174 11:44864959-44864981 TTGGTGAATGGATGGATGGGTGG + Intronic
1083091093 11:60201044-60201066 GTGGTGGCTGGCCGGGTGGGGGG + Intergenic
1083201233 11:61122289-61122311 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
1083828385 11:65216075-65216097 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828438 11:65216402-65216424 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1083828448 11:65216434-65216456 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1083828454 11:65216458-65216480 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828478 11:65216590-65216612 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828482 11:65216610-65216632 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828509 11:65216738-65216760 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828515 11:65216762-65216784 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828523 11:65216786-65216808 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828537 11:65216834-65216856 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1084698271 11:70769134-70769156 GGGGTGAATGAATGGGTGGGTGG + Intronic
1084705098 11:70811525-70811547 TGGGTGGATGAGTGGGTGGGTGG - Intronic
1084713041 11:70856048-70856070 CAGGTGAGTGAATGGGTGGGTGG + Intronic
1084776594 11:71380751-71380773 TGGATGAATGAGTGGGTGGGTGG + Intergenic
1084776622 11:71380870-71380892 TTGTTGAATGAGTGGATGGGTGG + Intergenic
1085031472 11:73273475-73273497 TGTGTGACTGGCTGGGTGGGTGG + Intronic
1085034585 11:73292408-73292430 TGGGTGAGTGAATGGCTGGGAGG + Intronic
1085203972 11:74719198-74719220 CTGGTGACTGACTTGCTGTGTGG - Intronic
1085396208 11:76208432-76208454 TTGGATACAGGCTGGGTGGGAGG - Intronic
1085402846 11:76244801-76244823 ATGGTGAATGGCTGGATGGGTGG - Intergenic
1085464298 11:76713583-76713605 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1085607548 11:77915635-77915657 TTGGTGACTTGCTGGGTGCAGGG - Intronic
1085721312 11:78914689-78914711 TGGTTGATTGATTGGGTGGGAGG - Intronic
1085746869 11:79122566-79122588 TTGGTGACTGACTGGATATGGGG + Intronic
1085776752 11:79373411-79373433 TGGGTGACTGGCTGGCTGGCTGG + Intronic
1086097734 11:83067654-83067676 TTGTTGATTGATTGGATGGGGGG - Intronic
1087185453 11:95187927-95187949 TTGGTGACTGGCAGGATGTGAGG - Intronic
1087247200 11:95853257-95853279 TTGGTCACTGACTGGATGTAAGG - Intronic
1087713964 11:101585151-101585173 TGGGTGGGTGAGTGGGTGGGTGG + Intronic
1087713966 11:101585155-101585177 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1089099498 11:115950347-115950369 TTGGTGATTCACTGGGTGTCAGG + Intergenic
1089455432 11:118622914-118622936 TTGGTGTCTGGCTGCCTGGGAGG + Intronic
1089644610 11:119870497-119870519 ATGGAGGCTGACTGGGTGGGGGG - Intergenic
1089808736 11:121114697-121114719 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808758 11:121114765-121114787 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1089808782 11:121114833-121114855 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808812 11:121114949-121114971 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808844 11:121115065-121115087 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089845486 11:121454778-121454800 TTGGTGACTGAAGGGGTTTGAGG + Intronic
1089847608 11:121470781-121470803 CTGGAGGCTGAGTGGGTGGGAGG - Intronic
1090256026 11:125284955-125284977 TTGGGGACTGATTGAGTGGGAGG + Intronic
1090624277 11:128592326-128592348 TTGGTGTGAGACTGGGTGGAAGG - Intergenic
1090637317 11:128698051-128698073 TTGTTGACTGGCTGTGTGGTTGG - Intronic
1091117812 11:133031184-133031206 TAGGTGAATGAATGGATGGGTGG + Intronic
1091133616 11:133167828-133167850 TGGTTGGGTGACTGGGTGGGTGG - Intronic
1091214571 11:133892875-133892897 TTGTTGATTGACTGGGTGACTGG + Intergenic
1091433521 12:455963-455985 TTGGTGACGGAGTTGGGGGGAGG + Intergenic
1091670082 12:2446449-2446471 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1091860319 12:3775677-3775699 CTGGTGACTGAATGAGTGTGAGG - Intergenic
1092050811 12:5468767-5468789 TTGATGACCCACTTGGTGGGGGG - Intronic
1092190086 12:6512872-6512894 TTGCTAACAGACTGGGTGTGAGG + Intronic
1092245419 12:6861420-6861442 CTGGTGACAGAATGGGTTGGTGG - Intronic
1092623456 12:10299651-10299673 CTGTTGACTGACTGGGGTGGTGG + Intergenic
1092720975 12:11440176-11440198 TTGGTGACTGATTAGATGTGGGG + Intronic
1093137474 12:15469488-15469510 CTGGTGTCTGACTGGGTAGGGGG - Intronic
1093872383 12:24307524-24307546 TGGGTGAGTGGGTGGGTGGGGGG - Intergenic
1094208669 12:27867418-27867440 TGGGAGCCTGACTGGGTGGTGGG + Intergenic
1094735097 12:33225036-33225058 ATGGTAACAGACTGGGTGGTGGG - Intergenic
1095733906 12:45535820-45535842 TGGGTGAATGAATGGGTGGATGG - Intergenic
1096069091 12:48764835-48764857 TTGGGAACTGAATGGGTGGGGGG - Intergenic
1096180417 12:49547645-49547667 TTGCTGAATGAATGAGTGGGTGG + Intronic
1096468987 12:51864532-51864554 ATGGGGACGGACTGGGTTGGAGG + Intergenic
1096491652 12:52015901-52015923 GTGGTGACTGCCTGAGGGGGAGG + Intergenic
1097039080 12:56143627-56143649 GTGGTGAGTGTCTGCGTGGGTGG + Exonic
1098087739 12:66865635-66865657 TAGATGAATGAATGGGTGGGTGG - Intergenic
1098534000 12:71574412-71574434 TTGGTGAGTGACTGAATGTGAGG - Intronic
1099541946 12:83922119-83922141 TAGGTGAGTGACTGAGTGAGTGG - Intergenic
1099670149 12:85680989-85681011 TTGTTTAGTGACTGGGAGGGAGG - Intergenic
1100012913 12:89975213-89975235 TTCGTGAATGATTGGGTTGGAGG + Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1101323208 12:103691899-103691921 TTGGTGGCTGAGTGGGTGGGTGG + Intronic
1101716456 12:107317558-107317580 ATGGTTTCTGCCTGGGTGGGTGG + Intergenic
1101814707 12:108136936-108136958 TGGGTGACTGAATGGCTGGAGGG + Intronic
1102076088 12:110061329-110061351 TTGGCAACTGAATGGGTGAGGGG - Intronic
1102452737 12:113053879-113053901 TGGGTGAATGACTGGATGGATGG + Intergenic
1102504225 12:113373723-113373745 TAGATGAGTGAGTGGGTGGGTGG - Intronic
1102504251 12:113373870-113373892 TGGGTGGATGAGTGGGTGGGTGG - Intronic
1102558267 12:113743151-113743173 TTGGTCACTGAGAGGCTGGGAGG + Intergenic
1102618447 12:114174913-114174935 TGGGAGACTGAGTTGGTGGGTGG - Intergenic
1102640175 12:114360425-114360447 TTGGTGGATGAGTGGGTGGATGG + Intronic
1103027213 12:117583350-117583372 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1103656410 12:122474654-122474676 CTGGTTACTGAGTGGGTGGAAGG + Intronic
1104334471 12:127880691-127880713 TGGTTGAATGAATGGGTGGGTGG - Intergenic
1104528087 12:129543204-129543226 TTGGTGAGTGGGTGGGTGGGTGG + Intronic
1104763988 12:131314711-131314733 TAGGTGAATGAATGGGTGGATGG - Intergenic
1104925760 12:132313297-132313319 TTGGTGTGTGAATGGATGGGTGG - Intronic
1104925907 12:132313814-132313836 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1104942472 12:132401513-132401535 TTGGTGGATGAATGGGTGGGTGG - Intergenic
1104942555 12:132401812-132401834 TTGGTGGATGAATGGGTGGATGG - Intergenic
1104942588 12:132401940-132401962 TTGGTGGATGAATGGGTGGGTGG - Intergenic
1104942678 12:132402281-132402303 ATGGTGGATGAATGGGTGGGTGG - Intergenic
1104954444 12:132457520-132457542 CGGGTGAGTGGCTGGGTGGGCGG + Intergenic
1104954628 12:132458074-132458096 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105470665 13:20691830-20691852 TTTGTGACTTAGTGGGTTGGGGG + Intergenic
1105637669 13:22231201-22231223 TGGATGACTGAGTGGGTGGATGG - Intergenic
1106490588 13:30217846-30217868 TTGTTGACTGACTGGTGGTGGGG - Intronic
1106945513 13:34823461-34823483 TTGTTGAATGAATGGGTGAGTGG + Intergenic
1107818752 13:44267303-44267325 TGGATGAATGAATGGGTGGGTGG + Intergenic
1109976969 13:69850428-69850450 TTGGTGACTGTTTGGATGTGAGG - Intronic
1111776128 13:92664284-92664306 TTGGTGATTGATTGGGTCTGTGG + Intronic
1112850583 13:103701203-103701225 TTGGTGAATGAATGGATGGCTGG - Intergenic
1113098177 13:106688510-106688532 TTGCTGATTGGCTGGGTGGGGGG + Intergenic
1113212125 13:107995405-107995427 TTGGTTACATACTGGGTGGCTGG - Intergenic
1113852278 13:113424653-113424675 ATGGTGAATGGATGGGTGGGTGG - Intronic
1114053602 14:18944839-18944861 TTGGTCACTCACTGGGGAGGTGG - Intergenic
1114108954 14:19457086-19457108 TTGGTCACTCACTGGGGAGGTGG + Intergenic
1115795446 14:36930433-36930455 TTGGTTACTGAGTGGATGAGGGG - Intronic
1116857996 14:49970444-49970466 TTGTTGGCTGGCTGGGTGGTTGG + Intergenic
1116953592 14:50900552-50900574 ATGGAGAATGACTGGGTGGTGGG + Intronic
1117996033 14:61479175-61479197 GTGGAGAAAGACTGGGTGGGTGG - Intronic
1119191845 14:72688260-72688282 TGGGTGGATGAGTGGGTGGGTGG + Intronic
1119728001 14:76933707-76933729 TTGGTGACGTTCTGTGTGGGTGG - Intergenic
1120067471 14:80060358-80060380 TTGGAGACTCACTGTGTGGGTGG + Intergenic
1121089214 14:91169756-91169778 TAGGAGACACACTGGGTGGGAGG + Intronic
1121277509 14:92678202-92678224 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1121647069 14:95525827-95525849 TTGGTGACTGGCTGACTGTGGGG - Intergenic
1121798239 14:96753413-96753435 TTTTTCACAGACTGGGTGGGGGG - Intergenic
1121900386 14:97688428-97688450 ATGGTGACTCACAGGCTGGGAGG - Intergenic
1122142809 14:99672940-99672962 GTGGTGAATGAGTGGATGGGGGG - Intronic
1122185379 14:99988885-99988907 TTAGTGATTGCTTGGGTGGGTGG + Intronic
1122867635 14:104614655-104614677 TGAGTGAGTGAGTGGGTGGGTGG + Intergenic
1122867664 14:104614796-104614818 TTGATGACTGTGTGAGTGGGTGG + Intergenic
1122923682 14:104890303-104890325 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1122923752 14:104890587-104890609 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1122923814 14:104890842-104890864 TGGATGAATGAGTGGGTGGGTGG + Intronic
1123018256 14:105385737-105385759 CTGGGGACAGACAGGGTGGGAGG - Intronic
1123633033 15:22275138-22275160 TAGGTGAGTGGGTGGGTGGGTGG - Intergenic
1124555764 15:30724401-30724423 TAGGTGGGTGGCTGGGTGGGTGG + Intronic
1124555766 15:30724405-30724427 TGGGTGGCTGGGTGGGTGGGTGG + Intronic
1124675506 15:31681319-31681341 TAGGTGGGTGGCTGGGTGGGTGG - Intronic
1124969893 15:34477163-34477185 TTGGTGATTGATTGGGTCTGTGG + Intergenic
1125411321 15:39409287-39409309 TGGGTGGATGAGTGGGTGGGTGG + Intergenic
1125521351 15:40349409-40349431 TTGGTTTATGACTAGGTGGGAGG - Intergenic
1125597838 15:40899036-40899058 TCAGTCACTGCCTGGGTGGGTGG + Intronic
1126039361 15:44575466-44575488 TTGGAGACCGACTGGGGGTGAGG - Intronic
1126485666 15:49177757-49177779 TTGGTGATCCACTGGGTGGCAGG + Intronic
1127761157 15:62140196-62140218 TTGGTGAGGGTCGGGGTGGGGGG + Intergenic
1128233745 15:66053101-66053123 TTGGTGGGTGAATGGGTGGGTGG + Intronic
1128558815 15:68651078-68651100 TGGGTTACTGACTCCGTGGGAGG + Intronic
1128796743 15:70471843-70471865 TGGGTGAATGGATGGGTGGGTGG + Intergenic
1129261396 15:74369899-74369921 TGGGTGACTGGGTGGCTGGGTGG + Intergenic
1129261404 15:74369923-74369945 TGGGTGACTGGGTGGCTGGGTGG + Intergenic
1129603186 15:77012165-77012187 TGGGTGAATGGGTGGGTGGGTGG - Intronic
1129773331 15:78216737-78216759 TTGGCTCCTGCCTGGGTGGGTGG + Intronic
1130520015 15:84654966-84654988 TTGCTGAATGAATGGGTAGGAGG + Intergenic
1130946442 15:88553007-88553029 GGGGTGGCTGGCTGGGTGGGGGG + Intergenic
1131981745 15:98000939-98000961 TGGGGGACTGAGTGGGTGTGTGG + Intergenic
1132189428 15:99838592-99838614 TTGGTGATTGATTGGGTCTGTGG - Intergenic
1132243954 15:100280317-100280339 TTGGTGACTGGCAGGATGTGGGG - Intronic
1132584843 16:701612-701634 TTGGTGACCGTCTGGCTGGGTGG - Intronic
1132644719 16:993641-993663 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1132644774 16:993829-993851 TGGGTGAGTGAGTGGGTGGACGG - Intergenic
1132644846 16:994086-994108 TGGGTGGATGAATGGGTGGGAGG - Intergenic
1132653985 16:1034116-1034138 TAGGTGGATGACTGGGTGGATGG - Intergenic
1132839938 16:1974004-1974026 CTGGGGACTGAGGGGGTGGGTGG + Intronic
1133003349 16:2862797-2862819 TTGGAGACTGGGAGGGTGGGAGG + Intergenic
1133204897 16:4227350-4227372 TGGGTGAATGGCTGGGTGGAAGG + Intronic
1133239233 16:4404705-4404727 TTGGAGAAGGATTGGGTGGGAGG - Intronic
1133462712 16:6000862-6000884 TGGGTGGATGAATGGGTGGGTGG + Intergenic
1133500906 16:6365453-6365475 TGGGTGAATGGATGGGTGGGTGG + Intronic
1133615264 16:7470434-7470456 TGGATGAATGAGTGGGTGGGTGG + Intronic
1134224751 16:12381483-12381505 TGGGTGGATGAGTGGGTGGGTGG - Intronic
1134224781 16:12381575-12381597 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1134241922 16:12512893-12512915 TTGGTGACGGACTGGGAAGGAGG - Intronic
1134242765 16:12517982-12518004 TTGGTGAGGGTCGGGGTGGGAGG + Intronic
1135466116 16:22686443-22686465 TGGGTGGCTGAGTGGGTGGATGG - Intergenic
1135661124 16:24297520-24297542 TGAGTGAGTGAGTGGGTGGGCGG - Intronic
1135661128 16:24297528-24297550 TTGGTGAGTGAGTGAGTGAGTGG - Intronic
1135828825 16:25754973-25754995 TGGATGGATGACTGGGTGGGTGG - Intronic
1135893034 16:26374312-26374334 TGGATGATTGGCTGGGTGGGTGG + Intergenic
1135931926 16:26745628-26745650 ATGGTGAATGGATGGGTGGGTGG - Intergenic
1136278969 16:29196964-29196986 TGGATGCATGACTGGGTGGGTGG + Intergenic
1136278994 16:29197093-29197115 TGGATGCATGACTGGGTGGGTGG + Intergenic
1136279020 16:29197230-29197252 TGGATGCATGACTGGGTGGGTGG + Intergenic
1136279090 16:29197578-29197600 TGCGTGAGTGAATGGGTGGGTGG + Intergenic
1136279097 16:29197613-29197635 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1136279143 16:29197836-29197858 TGGATGAATGGCTGGGTGGGTGG + Intergenic
1136290858 16:29270592-29270614 TAGATGGCTGAATGGGTGGGTGG + Intergenic
1136290903 16:29270784-29270806 TGGATGAATGACTGGATGGGTGG + Intergenic
1137250169 16:46735618-46735640 CGTGTGACTCACTGGGTGGGAGG + Intronic
1137561673 16:49506392-49506414 TTGGTGAGTGGGTGGATGGGTGG + Intronic
1137770404 16:51011953-51011975 TTGATGGATGAATGGGTGGGTGG + Intergenic
1138223084 16:55269602-55269624 TTGTTGAATAAATGGGTGGGTGG - Intergenic
1138229223 16:55325160-55325182 TAGGGGACAGACTGGGTGGAGGG + Intronic
1138454292 16:57112513-57112535 TTGGAAATGGACTGGGTGGGAGG + Intronic
1138547694 16:57729455-57729477 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1138547716 16:57729531-57729553 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1138547737 16:57729603-57729625 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1139345558 16:66300768-66300790 TAGGGGACTGGCTGGCTGGGTGG - Intergenic
1139962401 16:70725497-70725519 TTGGTCACTGAGGGGGTGGGGGG - Intronic
1140067670 16:71625324-71625346 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1140067678 16:71625352-71625374 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1140111598 16:72009551-72009573 TTGTTGATTGACATGGTGGGGGG + Intronic
1140873437 16:79128017-79128039 TTGATGAGTGACTGGATGTGAGG + Intronic
1140951787 16:79825366-79825388 TTGATGGATGAATGGGTGGGTGG - Intergenic
1141045960 16:80716387-80716409 TAGATGAATGAGTGGGTGGGTGG + Intronic
1141048868 16:80742735-80742757 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1141297242 16:82781572-82781594 TTGGTGAATAAGTGGGTAGGTGG - Intronic
1141488298 16:84355318-84355340 TGGGTGGATGAATGGGTGGGTGG + Intergenic
1141650025 16:85387973-85387995 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650047 16:85388057-85388079 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650065 16:85388145-85388167 TTGGTGAATGAATGGGTGAGTGG + Intergenic
1141650100 16:85388273-85388295 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650147 16:85388461-85388483 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650175 16:85388569-85388591 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141871329 16:86788652-86788674 GTGGTGAGGGCCTGGGTGGGGGG + Intergenic
1141982458 16:87558981-87559003 TGGGTGAATGAATGCGTGGGTGG - Intergenic
1142083367 16:88163082-88163104 TGGATGCATGACTGGGTGGGTGG + Intergenic
1142083393 16:88163215-88163237 TGGATGCATGACTGGGTGGGTGG + Intergenic
1142083420 16:88163352-88163374 TGGATGCATGACTGGGTGGGTGG + Intergenic
1142083490 16:88163706-88163728 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1142083534 16:88163929-88163951 TGGATGAATGGCTGGGTGGGTGG + Intergenic
1142096731 16:88244090-88244112 TAGATGGCTGAATGGGTGGGTGG + Intergenic
1142128570 16:88422074-88422096 CGGGTGGCTGACTGGGTGGATGG + Intergenic
1142152244 16:88517731-88517753 TGGATGAATGAATGGGTGGGTGG + Intronic
1142152249 16:88517747-88517769 TGGGTGGCTGAAAGGGTGGGTGG + Intronic
1142152257 16:88517779-88517801 TGGATGAATGAATGGGTGGGTGG + Intronic
1142152262 16:88517795-88517817 TGGGTGGCTGAAAGGGTGGGTGG + Intronic
1142152648 16:88519521-88519543 TGGATGAATGAGTGGGTGGGTGG + Intronic
1142152786 16:88520102-88520124 TGGATGAATGAATGGGTGGGTGG + Intronic
1142152877 16:88520519-88520541 TGGATGAATGAATGGGTGGGTGG + Intronic
1142248294 16:88979683-88979705 TTGATGAATGAATGGGTGGGTGG + Intergenic
1142248327 16:88979806-88979828 TGGGTGAGTGAGTGAGTGGGTGG + Intergenic
1142255309 16:89011129-89011151 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255345 16:89011281-89011303 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255363 16:89011353-89011375 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255391 16:89011461-89011483 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255410 16:89011533-89011555 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255437 16:89011641-89011663 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255637 16:89012474-89012496 TGGGTGGATGAGTGGGTGGGTGG - Intergenic
1142794346 17:2295907-2295929 TTGTTGACTGATTTGGTGTGAGG - Intronic
1142825443 17:2507338-2507360 GGGGTGGCTGGCTGGGTGGGGGG - Intronic
1143093330 17:4462717-4462739 TTGGTGGATGGGTGGGTGGGTGG - Intronic
1143093364 17:4462849-4462871 TTGGTGGGTGGGTGGGTGGGTGG - Intronic
1143301254 17:5912153-5912175 TAGATGACTGGCTGAGTGGGTGG - Intronic
1143301516 17:5913981-5914003 TAGATGACTGGCTGAGTGGGTGG - Intronic
1143408108 17:6691354-6691376 TTGGTGACTGACTGGGTATAAGG - Intronic
1143857788 17:9865133-9865155 TGGGTGCCTGGGTGGGTGGGTGG - Intronic
1144773908 17:17774566-17774588 CTGGTCACTGCCCGGGTGGGCGG - Intronic
1144966243 17:19078514-19078536 ATGGGGACTGACTGGATGGAAGG + Intergenic
1144981675 17:19173543-19173565 ATGGGGACTGACTGGATGGAAGG - Intergenic
1144986549 17:19204696-19204718 ATGGGGACTGACTGGATGGAAGG + Intergenic
1145240183 17:21236417-21236439 TGGGTGAATGGCTGGGTGGATGG - Intergenic
1145261400 17:21356870-21356892 TGGGTGAATGGATGGGTGGGTGG - Intergenic
1145271488 17:21407204-21407226 TGGGTGAATGGATGGGTGGGTGG - Intronic
1145309702 17:21694652-21694674 TGGGTGAATGGATGGGTGGGTGG - Intronic
1146504749 17:33395144-33395166 TGGGTGGGTGAGTGGGTGGGGGG - Intronic
1147340332 17:39750057-39750079 TTTGGGACTGACTGGGCAGGAGG + Intergenic
1147925544 17:43943314-43943336 TTGGGGTCTGACTGGCTGTGGGG - Intergenic
1148071427 17:44911046-44911068 TTGATGACTGAATGGATGGATGG - Intronic
1148346039 17:46904237-46904259 TGGGTGACTGGATGGGTAGGTGG + Intergenic
1148346050 17:46904269-46904291 TGGGTGGATGAATGGGTGGGTGG + Intergenic
1148346076 17:46904371-46904393 TGGGTGGCTGACTGGCTGGCTGG + Intergenic
1149418301 17:56483339-56483361 AGGGTGAGTGAGTGGGTGGGTGG + Intronic
1149431946 17:56601221-56601243 CTGGTCACTGACTGGGTGCGAGG + Intergenic
1149633147 17:58142894-58142916 GTGGTGGCTGGCAGGGTGGGGGG - Intergenic
1150515276 17:65802513-65802535 TGTGTGACTGAGTGGGTGAGTGG - Intronic
1150833708 17:68545558-68545580 TTGCTGACTGACTGGGGTGGTGG + Intronic
1151973215 17:77469773-77469795 TGGGTGAGTGAGTGGATGGGTGG - Intronic
1151973271 17:77470055-77470077 TGGGTGAATGAGTGGATGGGTGG - Intronic
1152133241 17:78489840-78489862 TGGGTGAGTGGGTGGGTGGGCGG + Intronic
1152141631 17:78540500-78540522 TGGGTGGGTGACTGGGTGGGTGG + Intronic
1152141688 17:78540736-78540758 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1152141906 17:78541304-78541326 TGGGTGAGTGAGTGGATGGGTGG + Intronic
1152312558 17:79559830-79559852 GTGGTGAATGAATGGGTGGATGG + Intergenic
1152312611 17:79560027-79560049 TGGATGAATGAATGGGTGGGTGG + Intergenic
1152767410 17:82148737-82148759 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1153456048 18:5282934-5282956 GTGGTTACTCACTTGGTGGGGGG + Intergenic
1153519415 18:5937893-5937915 TATGTGTATGACTGGGTGGGTGG + Intergenic
1153605449 18:6827568-6827590 GGGGCGACTGGCTGGGTGGGGGG + Intronic
1153961055 18:10140538-10140560 TTGGTGACTGATGGGAGGGGAGG + Intergenic
1154032237 18:10763883-10763905 TTGATGACTGATTGGCTTGGTGG + Intronic
1154307926 18:13243983-13244005 TGGGTGCATGAGTGGGTGGGTGG - Intronic
1157559356 18:48635819-48635841 TGGGTGACTGGCTGGGAGGCTGG - Intronic
1159006900 18:63021419-63021441 TGGTTGACTGACTGGCTGGCTGG - Intergenic
1159603856 18:70454490-70454512 TTGGAGGCTGGCTGGGTTGGTGG + Intergenic
1160103094 18:75942285-75942307 TTGGTGACTGAGTGGTAGAGAGG - Intergenic
1160692118 19:464985-465007 TGGGTGGCTGAATGGGTGGGAGG + Intronic
1160926618 19:1549732-1549754 TAGGTGAATGGATGGGTGGGTGG - Intergenic
1160926634 19:1549792-1549814 TAGGTGAATGGATGGGTGGGTGG - Intergenic
1160926734 19:1550124-1550146 TGGGTGAATGGATGGGTGGGTGG - Intergenic
1160960393 19:1718294-1718316 ATGGTGGGTGAGTGGGTGGGTGG + Intergenic
1161131370 19:2590849-2590871 TGGGTGAATGGATGGGTGGGTGG - Intronic
1161227451 19:3153629-3153651 TGGGTGAATGGATGGGTGGGTGG + Intronic
1161287662 19:3477237-3477259 TTGGTGAATGGATGGGTTGGGGG + Intronic
1161372921 19:3923761-3923783 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1161372925 19:3923785-3923807 TGAGTGAGTGACTGGATGGGTGG + Intronic
1161449101 19:4334708-4334730 TTGATGAATGACTGGATGGATGG - Intronic
1161679773 19:5673994-5674016 TGGATGGATGACTGGGTGGGTGG - Intergenic
1161857985 19:6776684-6776706 TAGGTGAATGGGTGGGTGGGTGG - Intronic
1161916008 19:7228835-7228857 TGGGTGGATGAATGGGTGGGTGG + Intronic
1161974045 19:7599225-7599247 TGGATGAATGAATGGGTGGGTGG - Intronic
1161974133 19:7599538-7599560 TGGATGAATGAATGGGTGGGTGG - Intronic
1161974260 19:7599951-7599973 TGGGTGGATGAGTGGGTGGGTGG - Intronic
1161974395 19:7600335-7600357 TGGGTGGATGAGTGGGTGGGTGG - Intronic
1162326451 19:10002465-10002487 TTGGTGGGTCACTGGGTTGGGGG - Intronic
1162388981 19:10377959-10377981 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1162909038 19:13839776-13839798 TTAGTGACAGGCTGGGAGGGCGG - Intergenic
1163276881 19:16290475-16290497 TGGGTGACAGGCTGGATGGGTGG - Intergenic
1163404291 19:17112820-17112842 TGGGTGAGTGCCTGGCTGGGAGG - Intronic
1163675660 19:18654143-18654165 TGGGTGGATGAATGGGTGGGTGG - Intronic
1163811217 19:19432993-19433015 TTCCTGAGTGACTGGGTGGTGGG + Intronic
1164597970 19:29542518-29542540 TGGGAGAATGAATGGGTGGGTGG + Intronic
1164701484 19:30287727-30287749 TGGGTGGCTGGATGGGTGGGTGG + Intronic
1164797284 19:31044327-31044349 TGGATGAATGAATGGGTGGGGGG + Intergenic
1165885835 19:39077521-39077543 CAGGTCACCGACTGGGTGGGGGG - Intergenic
1166324170 19:42039007-42039029 TTGGTGACTGCCTAGGGTGGGGG - Intronic
1166329819 19:42071279-42071301 GTGGTGCATGGCTGGGTGGGGGG + Intronic
1166699896 19:44876253-44876275 TCGGTGTCTGTCTGGGCGGGTGG - Intronic
1167134323 19:47608338-47608360 TTGGAGCCTGACAGGGTGGAAGG - Intronic
1167136642 19:47620275-47620297 TTGTTGAATGAATGGATGGGTGG + Intronic
1167212717 19:48143513-48143535 ATGAGGACTGCCTGGGTGGGGGG - Intronic
1167610853 19:50507131-50507153 TGGGTGAATGGCTGGCTGGGTGG - Intronic
1168086927 19:54054918-54054940 TGGGTGAATGAGTGGGTAGGAGG + Intronic
1168326756 19:55542639-55542661 TTGGTGGATGGATGGGTGGGTGG - Intronic
925011816 2:491456-491478 TGGATGACTGAATGGATGGGTGG - Intergenic
925216615 2:2101656-2101678 TTGGTGGATGAGTGGATGGGTGG - Intronic
926050297 2:9740241-9740263 TGGGTGAATGGATGGGTGGGTGG - Intergenic
926151730 2:10429301-10429323 TGGGTGAATGGATGGGTGGGTGG + Intergenic
926151750 2:10429377-10429399 TTGGTGAATGGGTGGGTCGGTGG + Intergenic
926151820 2:10429597-10429619 TGGGTGAATGGTTGGGTGGGTGG + Intergenic
926151845 2:10429673-10429695 TGGGTGAATGGTTGGGTGGGTGG + Intergenic
927988188 2:27428537-27428559 TGGGTGACGTTCTGGGTGGGCGG - Exonic
928395398 2:30939738-30939760 TTGGTGACTTGGTGGGTAGGAGG + Intronic
928895539 2:36258415-36258437 TAGGTGGGTGAATGGGTGGGTGG + Intergenic
929873458 2:45777010-45777032 TTGCTGACTGACAGGCTGTGTGG + Intronic
931229020 2:60358488-60358510 GGGGTCACTAACTGGGTGGGGGG - Intergenic
931257494 2:60585894-60585916 TTGTTGAATGACAGGGTGGGTGG - Intergenic
931818011 2:65923524-65923546 TTGTTGAATGAATGGGTGGATGG + Intergenic
933963160 2:87417720-87417742 TGGGTGGCTGGCTGGGTGGCTGG - Intergenic
934621844 2:95815041-95815063 TGAGTGACTGACTGGATGTGTGG - Intergenic
934811600 2:97283772-97283794 TGAGTGACTGACTGGATGTGTGG + Intergenic
934826091 2:97424168-97424190 TGAGTGACTGACTGGATGTGTGG - Intergenic
935144776 2:100388108-100388130 GTGGTGACTGATTGGATGTGAGG + Intergenic
935292252 2:101620556-101620578 TTGGAGAGTGACTGAGAGGGTGG - Intergenic
936504720 2:113096467-113096489 GGGGTGGCTGGCTGGGTGGGGGG + Intergenic
936891663 2:117378044-117378066 TTGGTGAAAGACTGGGTTGGGGG - Intergenic
937368138 2:121279874-121279896 TTGCTGGATGCCTGGGTGGGTGG + Intronic
937383429 2:121403359-121403381 TGGGTGAATGAATGGGTGGATGG + Intronic
937533947 2:122863387-122863409 TTGGTGACAGGCTGGGAGGCTGG + Intergenic
937970747 2:127546904-127546926 TGGGTGAATGGGTGGGTGGGTGG - Intronic
937977041 2:127588698-127588720 TGGGTGAATGGATGGGTGGGTGG + Intronic
937977127 2:127588997-127589019 TGGGTGAGTGAGTGGATGGGTGG + Intronic
937981584 2:127619201-127619223 GTGGTGGCTGGCTGGGTGGTGGG + Intronic
937981609 2:127619270-127619292 GTGGTGGCTGGCTGGGTGGTGGG + Intronic
938108020 2:128546561-128546583 TGGGTGAATGGATGGGTGGGTGG - Intergenic
938373687 2:130790256-130790278 TGGGTGGATGAGTGGGTGGGTGG + Intergenic
938471567 2:131567338-131567360 TTGGTCACTCACTGAGTAGGTGG - Intergenic
938730200 2:134141489-134141511 TGGGTGGATGAATGGGTGGGTGG + Intronic
939359480 2:141150030-141150052 TTGAGGACTGAATGGGTGTGAGG + Intronic
939484978 2:142800029-142800051 TTTGTGACAGTCTGTGTGGGCGG - Intergenic
939625572 2:144473178-144473200 TTGGTAACAGACTGGTTGTGGGG + Intronic
942306527 2:174612890-174612912 TCGTAGACTGACTGGGTGGAAGG + Intronic
942578881 2:177394993-177395015 TTGGTTACTGAGTGGTGGGGAGG + Intronic
942920920 2:181372869-181372891 TTGGTGACTGATTGCATGTGGGG - Intergenic
942954253 2:181755860-181755882 TTGGTGCCTGAATGGGGGAGGGG - Intergenic
943619624 2:190133813-190133835 ATGGTGACTGACTGGGTCTGGGG + Intronic
943788733 2:191908248-191908270 TTAGTGACTGGCTGGGGGTGGGG - Intergenic
944197614 2:197072009-197072031 TTTGTGACTGAGAGGGAGGGAGG + Intronic
944606815 2:201359128-201359150 TTGGTGATTGACTGGATGCTGGG + Intergenic
945024421 2:205606432-205606454 ATTGGGACTGACTAGGTGGGTGG - Intronic
945110412 2:206356430-206356452 GGGGTGGCTGGCTGGGTGGGGGG + Intergenic
945110585 2:206356829-206356851 GGGGTGGCTGGCTGGGTGGGGGG + Intergenic
946169145 2:217884124-217884146 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
946998069 2:225418535-225418557 TTGGTGACAGATTGGATGGGAGG + Intronic
947812857 2:233015209-233015231 TTGGTGGGTGGATGGGTGGGTGG - Intronic
947812897 2:233015361-233015383 TGGGTGGATGACTGGATGGGTGG - Intronic
948708312 2:239809520-239809542 TTGGAGACTGACTCGGTCGATGG + Intergenic
948818792 2:240527844-240527866 TGGGTGGGTGATTGGGTGGGTGG + Intronic
1168818539 20:757586-757608 TTTGTGAAGGACTGGGTGGAGGG - Intergenic
1170851166 20:20005589-20005611 TTGGTGACAGATAGTGTGGGCGG - Intergenic
1170897462 20:20428760-20428782 TGGGTGAATGGGTGGGTGGGTGG - Intronic
1172189509 20:33053629-33053651 TAGGTGGCTGAATGGGTAGGTGG + Intergenic
1172196176 20:33093251-33093273 TGGGTGGATGAATGGGTGGGTGG - Intronic
1172196206 20:33093391-33093413 TTGGTGGATGGGTGGGTGGGTGG - Intronic
1172196215 20:33093419-33093441 TTGGTGGATGAATGGGTGGATGG - Intronic
1172457291 20:35087463-35087485 CTGGTGACAGACTGGGTTGTGGG - Intronic
1172779857 20:37430099-37430121 TAGGTGAGTGAGTAGGTGGGTGG - Intergenic
1172779901 20:37430343-37430365 TGGATGAGTGAGTGGGTGGGTGG - Intergenic
1172899116 20:38321070-38321092 TGGGTGAATGAATGGATGGGAGG + Intronic
1172939509 20:38644774-38644796 TGGGTGAATGAGTGGGTGGATGG - Intronic
1173354028 20:42270257-42270279 TTGATGGGTGAATGGGTGGGGGG + Intronic
1173871536 20:46345077-46345099 TTGGTGGATGGCTGGATGGGTGG - Intergenic
1174195012 20:48766811-48766833 TTGGTGAGTGAGTGGATGGACGG + Intronic
1174305162 20:49609804-49609826 TTGTTGAATGAATGGATGGGTGG - Intergenic
1174405999 20:50303836-50303858 TTGGTGACCAATTGGGTTGGAGG + Intergenic
1174429821 20:50459592-50459614 TTAGTGGATGACTGGGTGGGTGG + Intergenic
1174550418 20:51357855-51357877 GTGATGAGTGGCTGGGTGGGTGG + Intergenic
1174943524 20:54958620-54958642 CTGCTGACTGACTAGGTTGGTGG + Intergenic
1175375308 20:58519947-58519969 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1175493229 20:59393338-59393360 TGGATGAATGATTGGGTGGGTGG - Intergenic
1176057837 20:63158222-63158244 TAGGTGAATGACTGGGTGGGTGG + Intergenic
1178305804 21:31489344-31489366 TTGGTGACAGACAAGGTTGGGGG + Intronic
1179025970 21:37678617-37678639 TTGATGAATGTATGGGTGGGTGG + Intronic
1179124103 21:38576620-38576642 TTGGAGACTGGCTCGGTGGAAGG - Intronic
1179504646 21:41832593-41832615 TTAGTGCCTGGCTGGGAGGGAGG - Intronic
1180086077 21:45508472-45508494 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1180180685 21:46117499-46117521 TGGGTGCCTGACCGGGTGGGAGG + Intronic
1180182349 21:46123618-46123640 TTGCTGGATGAGTGGGTGGGTGG + Intronic
1180905919 22:19411424-19411446 TAGCTGGCTGGCTGGGTGGGTGG + Intronic
1181096647 22:20509561-20509583 TTGATGACTAACTGGATGGAGGG + Intronic
1181736014 22:24881996-24882018 CTGGTTACTGACTTGGGGGGGGG + Intronic
1181783201 22:25207627-25207649 TGGGTGGATGAATGGGTGGGTGG - Intergenic
1181783219 22:25207703-25207725 TGGGTGGATGAATGGGTGGGTGG - Intergenic
1181822533 22:25487219-25487241 TGGGTGACTGAATGGGAGTGTGG + Intergenic
1181822555 22:25487315-25487337 TAGGTGAGTGGATGGGTGGGTGG + Intergenic
1182050033 22:27305617-27305639 TTTGTGGCTGAATGGGTTGGAGG - Intergenic
1182410685 22:30182917-30182939 TGGCTGAGGGACTGGGTGGGAGG - Intergenic
1183261850 22:36800305-36800327 TGGGTGGATGAATGGGTGGGTGG - Intergenic
1183845563 22:40537730-40537752 GGGGTGACTGGCCGGGTGGGGGG - Intronic
1184123673 22:42471578-42471600 TTGGTGGATGAGTGGATGGGTGG - Intergenic
1184434287 22:44460638-44460660 TTGGTGAATGAATGAGTGGATGG - Intergenic
1184486815 22:44784866-44784888 TTGTTGACTGACTGGAAGGAGGG + Intronic
1184503294 22:44886709-44886731 ATTGTGACTGCCTGGGTCGGGGG - Intronic
1184653373 22:45929488-45929510 TTGGTGGGTGGGTGGGTGGGTGG - Intronic
1184855035 22:47142214-47142236 TTGGTGGGTGAATGGGTGGGTGG - Intronic
1184855096 22:47142407-47142429 TGGGTGAATGGATGGGTGGGTGG - Intronic
1184855105 22:47142431-47142453 TGGGTGAATGGATGGGTGGGTGG - Intronic
1184878072 22:47288168-47288190 TCAGTGAATGACTGGGTAGGTGG - Intergenic
1184911840 22:47540373-47540395 TTGGGGACTGGCTGGGGGGGGGG - Intergenic
1184991048 22:48170301-48170323 TGGGTGAATGGATGGGTGGGCGG - Intergenic
1185027230 22:48421870-48421892 TTGGTGGATGAGTGGGTAGGTGG + Intergenic
1185063859 22:48621036-48621058 TTGGTGGGTGGATGGGTGGGAGG - Intronic
1185211431 22:49572896-49572918 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185211457 22:49572980-49573002 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185212560 22:49579128-49579150 TGGGGGAGGGACTGGGTGGGAGG - Intronic
949510787 3:4764987-4765009 TGGGTGAATGGGTGGGTGGGTGG + Intronic
950147911 3:10664925-10664947 TTGGTGATGGAGTGGGTTGGGGG - Intronic
950202954 3:11057667-11057689 TTGGTGAATCGATGGGTGGGTGG + Intergenic
950202971 3:11057737-11057759 TTGGTGAAGGGATGGGTGGGTGG + Intergenic
950202987 3:11057807-11057829 TTGGTGAATGGATGGGTGGGTGG + Intergenic
950203006 3:11057882-11057904 TTGGTGAATGGATGGGTGGATGG + Intergenic
950203032 3:11057985-11058007 TAGGTGAGTGGGTGGGTGGGTGG + Intergenic
950486685 3:13278131-13278153 TTGGTGACTCACTCCGGGGGAGG - Intergenic
950486832 3:13278818-13278840 TTGGTGAGGGGCAGGGTGGGGGG + Intergenic
950541265 3:13614682-13614704 TGGGTGAGTGAATGGGTGGATGG - Intronic
950541817 3:13617627-13617649 TGGGTGAATGAATGGGTGGGTGG - Intronic
950541854 3:13617740-13617762 TAGGTGAATGAATGGGTGGGGGG - Intronic
950541874 3:13617796-13617818 TGGGTGAGTGAGTGGATGGGTGG - Intronic
950551627 3:13669613-13669635 TAGGTGGATGAGTGGGTGGGTGG - Intergenic
950617986 3:14177882-14177904 TTGCTGACGGACTGGATGTGTGG + Intronic
952005586 3:28838801-28838823 TGGCTGACTGGCTGGGTGAGAGG + Intergenic
952056518 3:29453516-29453538 TTGGTTACTAACTGGGTTGGGGG - Intronic
952772406 3:37014181-37014203 TAGGTGGGTGAGTGGGTGGGTGG + Intronic
952772408 3:37014185-37014207 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
952846055 3:37688975-37688997 TGGATGACTGGCTGGGTGGATGG + Intronic
953182435 3:40608513-40608535 TTGGGGACTGATTGGATGGAGGG + Intergenic
953201499 3:40781950-40781972 TTCGTGACTGGATGTGTGGGAGG + Intergenic
953566181 3:44033739-44033761 TTGGTGGGTGGGTGGGTGGGTGG + Intergenic
953637143 3:44673030-44673052 TGGATGAATGAATGGGTGGGTGG + Intergenic
953705501 3:45226870-45226892 GTGGAGAGTGACTGGCTGGGGGG + Intergenic
953873483 3:46647944-46647966 TTGGTGACTGACAGGGGTTGGGG - Intergenic
953899856 3:46833874-46833896 CAGGTGACTCACTGCGTGGGAGG - Exonic
954689700 3:52389040-52389062 TTGTTGAATGACTGAGTGAGCGG - Intronic
954916275 3:54150906-54150928 TGGGTGAATGGATGGGTGGGTGG + Intronic
955332331 3:58057664-58057686 TAGTTGGTTGACTGGGTGGGTGG + Intronic
955436534 3:58905847-58905869 TTGGTGACTGGCTGTGTTGAGGG - Intronic
955545990 3:60030749-60030771 ATGGTAGATGACTGGGTGGGTGG + Intronic
956784852 3:72633869-72633891 GTGGAGAGTGACTGGGTAGGGGG + Intergenic
957437928 3:80203122-80203144 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
960058194 3:113291589-113291611 GTGGAGACTGAATGGGTGGGAGG + Exonic
960252537 3:115472369-115472391 TGGGTGACTGAGTGGATGGGAGG - Intergenic
961315247 3:126030648-126030670 TAGGTGGGTGAATGGGTGGGTGG + Intronic
961572081 3:127806434-127806456 TTGGTGAATGGATGGGTGGAAGG + Intronic
961661240 3:128469888-128469910 TGGGTGGCTGGGTGGGTGGGTGG - Intergenic
961661254 3:128469924-128469946 TGAGTGGCTGGCTGGGTGGGTGG - Intergenic
961661256 3:128469928-128469950 TGGGTGAGTGGCTGGCTGGGTGG - Intergenic
961661265 3:128469956-128469978 TGGGTGGCTGGCTGTGTGGGTGG - Intergenic
961661278 3:128470004-128470026 TGGGTGGCTGGGTGGGTGGGTGG - Intergenic
962342327 3:134596053-134596075 TTGGTCTCTGGGTGGGTGGGTGG + Intergenic
963572362 3:147014551-147014573 TGGGGGACAGACTTGGTGGGAGG + Intergenic
963774893 3:149428729-149428751 TGGGAGACAGACCGGGTGGGAGG - Intergenic
964301798 3:155295885-155295907 TGGCTGGCTGACTGGGTAGGTGG + Intergenic
964609354 3:158594713-158594735 TTGGTGATTGACAGGGTTGAAGG + Intronic
964663717 3:159150110-159150132 TTGTTGATTGCCTGGGTTGGAGG + Intronic
964683069 3:159363631-159363653 TTGGAGAGTGATTGGGTTGGTGG - Intronic
964852365 3:161108623-161108645 TTGGTGACTGACTGGACATGTGG - Intronic
965258439 3:166446485-166446507 TGGGTGAGTCACTGGGTGAGTGG + Intergenic
965422713 3:168481897-168481919 ATGGTGAGTGACTGGCTGTGAGG + Intergenic
965550932 3:169964382-169964404 TTGGTGACTGACTGGCAGAAAGG + Intergenic
966893181 3:184422985-184423007 TTGTTGACTGACTGAGTGAATGG + Intronic
967396704 3:189016618-189016640 TTGGTGAGGGACCAGGTGGGAGG + Intronic
968093459 3:195911774-195911796 TTGGTGAGGAACAGGGTGGGAGG - Intronic
968594707 4:1476395-1476417 TTGGTGGCTGGGTGGGTGAGTGG + Intergenic
968762039 4:2447622-2447644 TGGGTGAATGAATGGATGGGTGG + Intronic
968762091 4:2447910-2447932 TGGGTGAATGAATGGATGGGTGG + Intronic
968924780 4:3541493-3541515 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
968930948 4:3578457-3578479 TGGGTGAGTGAATGGATGGGTGG - Intronic
968946147 4:3665525-3665547 TGGGTGGATGACTGGATGGGTGG - Intergenic
968946180 4:3665641-3665663 TGGGTGAATGGATGGGTGGGTGG - Intergenic
969216717 4:5729076-5729098 TGGGTGAATGAATGGGTGGGTGG - Intronic
969448952 4:7262206-7262228 TTGGTGGATGGGTGGGTGGGTGG - Intronic
969499305 4:7543463-7543485 TGGGTGAATGGATGGGTGGGTGG - Intronic
969501616 4:7556842-7556864 TGGGTGACTGGATGGATGGGTGG - Intronic
969524044 4:7695297-7695319 TGGGTGAGTGAATGGGTGGGTGG + Intronic
969524103 4:7695477-7695499 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524110 4:7695497-7695519 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524117 4:7695517-7695539 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969571598 4:8012141-8012163 TGGGTGGATGAGTGGGTGGGTGG - Intronic
969624359 4:8294806-8294828 TGGATGAATGGCTGGGTGGGTGG - Intronic
969624425 4:8295115-8295137 CAGGTGAATGAGTGGGTGGGTGG - Intronic
969687525 4:8683955-8683977 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
971057360 4:22928638-22928660 TTGGTGACTGACTTAATGTGGGG - Intergenic
972191375 4:36595678-36595700 TTGGTGAGTGAGTGGGTAGGGGG + Intergenic
972602132 4:40582046-40582068 TCAGTGACTGACTGGGTGAAGGG - Intronic
972906151 4:43749986-43750008 TTGGTGACTGACTGGATACAAGG + Intergenic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
973989342 4:56388469-56388491 TTGATAACTGTCTGGCTGGGTGG - Intergenic
976099147 4:81541980-81542002 CATGTGACTGAATGGGTGGGTGG + Intronic
976178675 4:82379047-82379069 TTGGTGATTGATTGGATGTGGGG - Intergenic
977573786 4:98657021-98657043 ATGGTGGCTGTCTGGGTAGGGGG - Intronic
978554640 4:109966206-109966228 TTGGAGACTGCAAGGGTGGGAGG - Intronic
979963577 4:127050516-127050538 TTGGCAACTGATTGGGTGTGAGG - Intergenic
982166336 4:152616988-152617010 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
982462650 4:155690274-155690296 TGGGCTACTGACTGGGTGTGGGG - Intronic
982581829 4:157188447-157188469 TTGGGGACTGAGAGGCTGGGTGG - Intergenic
983900356 4:173127037-173127059 TTGATGACTGATTGGGTTTGGGG + Intergenic
984374989 4:178918387-178918409 TTGGTGAGTGTGTGTGTGGGTGG - Intergenic
985142645 4:186858209-186858231 TTGGAGACTGATGGGGTTGGGGG + Intergenic
985528610 5:420809-420831 TGGGTGGCTGCGTGGGTGGGTGG - Intronic
985560555 5:584023-584045 TGGGTGAGTGGATGGGTGGGCGG + Intergenic
985560567 5:584055-584077 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
985560654 5:584354-584376 TGGGTGGATGAATGGGTGGGTGG + Intergenic
985560668 5:584398-584420 TGGGTGGCTGGCTGAGTGGGTGG + Intergenic
985560670 5:584402-584424 TGGCTGGCTGAGTGGGTGGGTGG + Intergenic
985560711 5:584574-584596 TGGGTGGCTGGATGGGTGGGTGG + Intergenic
985560725 5:584618-584640 TGGGTGGCTGGATGGGTGGGTGG + Intergenic
985560743 5:584674-584696 TGGGTGGCTGGATGGGTGGGTGG + Intergenic
985560757 5:584718-584740 TGGGTGGCTGGATGGGTGGGTGG + Intergenic
985560769 5:584762-584784 TGGGTGAGTGGCTGGATGGGTGG + Intergenic
985560792 5:584850-584872 TGGGTGACTGGATGTGTGGGTGG + Intergenic
985786276 5:1896929-1896951 TTGGTGAATGGTTGGGTGCGGGG + Intergenic
985821171 5:2161165-2161187 TGGATGAATGAGTGGGTGGGTGG - Intergenic
985829658 5:2219156-2219178 TGGGTGAGTGAATGGATGGGTGG - Intergenic
985829716 5:2219440-2219462 TGGGTGAATGGATGGGTGGGTGG - Intergenic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
985837328 5:2280819-2280841 GTGGTGAATGAGTGGGTGGGTGG + Intergenic
985837376 5:2280999-2281021 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
985837378 5:2281003-2281025 TGGGTGAATGGGTGGGTGGGTGG + Intergenic
985837508 5:2281498-2281520 TGGGTGGATGACTGGGTGGGTGG + Intergenic
985874674 5:2585681-2585703 TGGGTGGGTGATTGGGTGGGTGG + Intergenic
986020503 5:3796949-3796971 ATGGTGAATTACTGGATGGGTGG + Intergenic
986020510 5:3796973-3796995 TGGCTGGCTGAATGGGTGGGTGG + Intergenic
986145273 5:5071872-5071894 CTGGTGACTGACAGGCTGTGAGG - Intergenic
986505062 5:8441254-8441276 TTGGTGGATGGGTGGGTGGGTGG + Intergenic
986714116 5:10510339-10510361 TGGGTGACTGGCAGGGTTGGGGG + Intronic
986944030 5:12992683-12992705 TTGGGGACTGAAAGGGTGGGAGG + Intergenic
987037526 5:14033081-14033103 TTGGTGACTCACTGCGTGTGGGG - Intergenic
987067964 5:14308380-14308402 TGGGTGACTGAATGGATGGATGG - Intronic
987068094 5:14309005-14309027 TGGGTGACTGCGTGGGTGGATGG - Intronic
989010176 5:36862586-36862608 TTGGTGATTGATTGAATGGGTGG + Intergenic
990165876 5:52992624-52992646 TGAGGGACTGACTGGGTGGCAGG - Intronic
990488017 5:56278088-56278110 TTGTTGAATGGATGGGTGGGTGG + Intergenic
991298567 5:65105577-65105599 TTGGTGATTGACTGATTGTGGGG - Intergenic
992830709 5:80590746-80590768 TGGGTGAATGACCGGGTGGAGGG + Intergenic
992888245 5:81180676-81180698 TTTGTGTCTAGCTGGGTGGGGGG - Intronic
994038102 5:95225775-95225797 ATGGGGACAGACTAGGTGGGAGG - Intronic
994516617 5:100780296-100780318 TTGGTGATCTACTGAGTGGGGGG + Intergenic
995589271 5:113682161-113682183 TGGGTGAGTGATTGGGTGAGTGG - Intergenic
995873749 5:116768721-116768743 TTGGTGACTGATTTTTTGGGAGG + Intergenic
997110310 5:131067150-131067172 CTGGTGACTGACTGAGGTGGGGG - Intergenic
998164544 5:139835555-139835577 TGGGTAAGTGAGTGGGTGGGTGG - Intronic
998230847 5:140360665-140360687 GGGGTGACTGCCAGGGTGGGGGG + Intronic
998275899 5:140753311-140753333 CTGGTGACTGACTGCGTGTGTGG + Intergenic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
999709250 5:154301902-154301924 TGGCTGGCTGGCTGGGTGGGTGG - Intronic
999890189 5:155969770-155969792 TTGATGACCCACTGGGTAGGAGG - Intronic
999916853 5:156272176-156272198 TTGGGGACTCACAGAGTGGGGGG - Intronic
1000618872 5:163460408-163460430 TCCGGGAATGACTGGGTGGGTGG + Intronic
1001329822 5:170754320-170754342 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001329878 5:170754520-170754542 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1001329895 5:170754572-170754594 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001490987 5:172155106-172155128 TGGGTGGCTGGGTGGGTGGGTGG + Intronic
1001702800 5:173719826-173719848 TTAGTGACTGGCTGGCAGGGGGG - Intergenic
1001828750 5:174767727-174767749 TTGGTGAATGGATGGGTGAGTGG - Intergenic
1001840386 5:174871288-174871310 TAAGTGAGTGAGTGGGTGGGTGG - Intergenic
1002303305 5:178269570-178269592 TTGATGGATGAGTGGGTGGGTGG - Intronic
1002601092 5:180354151-180354173 TTGGTGCCTCACTGGGGGGTCGG - Intergenic
1002643785 5:180643227-180643249 TTGGTGACCGATTGGCTGTGGGG - Intronic
1002917978 6:1544268-1544290 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1003181083 6:3792294-3792316 CAGGTGAATGAATGGGTGGGTGG - Intergenic
1003667973 6:8129227-8129249 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1005057165 6:21740117-21740139 TTGGTGACTGAATGGAGGTGGGG + Intergenic
1006338578 6:33433513-33433535 CTGGGGAGTGACTGGGTGAGGGG - Intronic
1007252992 6:40509081-40509103 TTGTTGACAGACTGAGTGGATGG - Intronic
1007521828 6:42455995-42456017 TGGGTGGCAGACAGGGTGGGAGG - Intergenic
1007774697 6:44218564-44218586 TTGCTAAGAGACTGGGTGGGAGG + Intergenic
1009529541 6:64794354-64794376 TTGGTGAGGGGCTTGGTGGGAGG + Intronic
1009681361 6:66897263-66897285 TTGGTATCAGACTGAGTGGGGGG - Intergenic
1009859773 6:69312236-69312258 TTGGTGATTGACTGGATGTGAGG + Intronic
1010186180 6:73146008-73146030 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1010749925 6:79606522-79606544 TTGGTGCCTGGCTGGCTGGCTGG + Intergenic
1011119057 6:83930188-83930210 TTGGTGACTGATTAGGGTGGTGG + Intronic
1011297293 6:85838875-85838897 GGGGTGGCTGGCTGGGTGGGGGG - Intergenic
1012546031 6:100420482-100420504 ATGGTCACTCACTGGGTGGGAGG + Intronic
1012803882 6:103870165-103870187 TTGCTGCATGAATGGGTGGGTGG - Intergenic
1013245561 6:108283954-108283976 TTGGTGAAGGACTGGATAGGAGG + Intergenic
1013309440 6:108879546-108879568 TGGATGACTGCGTGGGTGGGTGG - Intronic
1017171857 6:151463577-151463599 GAGGTGACTGACTGGCTGGAAGG + Intronic
1017570893 6:155742870-155742892 GTGGGGAGTGACAGGGTGGGGGG + Intergenic
1017582005 6:155875458-155875480 TTAGTAACTGACTGGGTACGTGG - Intergenic
1017946960 6:159103896-159103918 TTGGTGACTGAGCAGGTGTGGGG - Intergenic
1018127437 6:160695334-160695356 TTTGTGACTGACTGAATGTGGGG - Intergenic
1018610466 6:165643220-165643242 TAGGTGAGTGAGTGGGTGGGTGG + Intronic
1019051702 6:169188494-169188516 TTGGAGACTGGCTGGATTGGAGG + Intergenic
1019510775 7:1416219-1416241 TGGGTGAATGGGTGGGTGGGTGG + Intergenic
1019567245 7:1690386-1690408 TAGGTGAGTGGCTGGATGGGTGG + Intronic
1019676534 7:2316781-2316803 TGAGTGAGTGAGTGGGTGGGTGG - Intronic
1019704657 7:2491753-2491775 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019704720 7:2492048-2492070 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1019704722 7:2492052-2492074 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019776077 7:2912910-2912932 ATGATGGGTGACTGGGTGGGTGG - Intronic
1020890528 7:13872365-13872387 TTGGTGGGTGGGTGGGTGGGGGG - Intergenic
1022516288 7:30976880-30976902 TGGGTGGATGAATGGGTGGGTGG - Intronic
1023079546 7:36514339-36514361 TGGGTCCCTGACTGGGTGGGGGG + Intronic
1023406274 7:39836020-39836042 TGGTTGACTGATTGAGTGGGTGG + Intergenic
1024042137 7:45564074-45564096 TTGGTGACAGATTTGGTGTGGGG + Intergenic
1025845404 7:65192294-65192316 TTGGTGACTTGCTGGGTGCAGGG + Intergenic
1025895680 7:65698326-65698348 TTGGTGACTTGCTGGGTGCAGGG + Intergenic
1026103787 7:67404609-67404631 CTGGTGAGTGGGTGGGTGGGTGG + Intergenic
1026873471 7:73867040-73867062 TGGGTGAATGGATGGGTGGGTGG - Intergenic
1026873521 7:73867252-73867274 TGGGTGGCTGAATGGATGGGTGG - Intergenic
1026994356 7:74606144-74606166 CTGGCAGCTGACTGGGTGGGGGG - Intergenic
1027122834 7:75534210-75534232 TTGGTGTCTGACTTGGTAGCTGG + Exonic
1029117043 7:98242892-98242914 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1029673053 7:102047255-102047277 TTGGTGGATGAATGGGTGGATGG + Intronic
1030555044 7:111013456-111013478 TGGGTGACTGCCTGGATGGGAGG + Intronic
1030582839 7:111381720-111381742 TTGGTGACTGACTGAGTATAAGG + Intronic
1030656914 7:112178591-112178613 TTGGTGTCTGACTGGTTTTGAGG - Intronic
1030781909 7:113611254-113611276 TTGGTGGATAACTGGGTGGCTGG + Intergenic
1031144979 7:117987485-117987507 TTGGTGACCGATTGGATGGAAGG + Intergenic
1031504296 7:122561914-122561936 TGGATGAATGAATGGGTGGGTGG + Intronic
1031922544 7:127612548-127612570 TGGGTGACTGGCTGGCTGGATGG + Intronic
1032453678 7:132055975-132055997 TTGGTGGCAGGTTGGGTGGGAGG - Intergenic
1032834461 7:135660474-135660496 TTGGTGATCGACTGGGTGTCAGG - Intergenic
1033076942 7:138258539-138258561 TTGGTGGGTGGGTGGGTGGGGGG - Intergenic
1034050293 7:147976967-147976989 TTTGGGAGTGAATGGGTGGGAGG - Intronic
1034270407 7:149800918-149800940 ATGGTGGCTGGCTGGATGGGTGG - Intergenic
1035047947 7:155981532-155981554 TGGGTGGATGAGTGGGTGGGTGG - Intergenic
1035048062 7:155981956-155981978 TGGGTGGATGAGTGGGTGGGTGG - Intergenic
1035091807 7:156319131-156319153 CTGTTGGCTGACCGGGTGGGTGG - Intergenic
1035290785 7:157837265-157837287 GTGGTGAGTGGATGGGTGGGTGG - Intronic
1035318579 7:158013804-158013826 TAGGTGGGTGAGTGGGTGGGTGG - Intronic
1035318593 7:158013844-158013866 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318595 7:158013848-158013870 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035318638 7:158014036-158014058 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318640 7:158014040-158014062 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035402293 7:158574801-158574823 TTGCTGGCACACTGGGTGGGTGG + Intronic
1035404035 7:158587146-158587168 TCGGTGAGTGACGGGGCGGGTGG - Intronic
1035426111 7:158775276-158775298 TTGCTGACTGACCGGGGTGGTGG + Intronic
1035673317 8:1436717-1436739 TGGGTGAGTGAATGGGTGAGTGG - Intergenic
1035896341 8:3406980-3407002 TAAGTGGCTGAGTGGGTGGGTGG + Intronic
1037211498 8:16393710-16393732 TTGGGGACTCAAAGGGTGGGAGG + Intronic
1037377594 8:18248762-18248784 TTGGTGACTGAGTGGGTAAATGG + Intergenic
1037885642 8:22594759-22594781 TTGGTGATTGATTTGGAGGGGGG + Intronic
1037932157 8:22887901-22887923 TAGGTAACTGAGTGGGAGGGAGG + Intronic
1038337318 8:26655863-26655885 TTGGTGAGAGACGGGGTGTGGGG - Exonic
1038510632 8:28131139-28131161 TTGGTGACTGATTGGAAGTGAGG + Intronic
1038562085 8:28589366-28589388 CTGTTGACTGACTGGAGGGGAGG + Intergenic
1039598872 8:38816735-38816757 ATGTTGACTTACTGGGAGGGTGG - Intronic
1040584528 8:48726905-48726927 TGGGTGAATGGATGGGTGGGTGG - Intronic
1041091744 8:54308121-54308143 TGGGTGACTGAATGAGTGGGTGG - Intergenic
1042104182 8:65307211-65307233 TGGGGGAGGGACTGGGTGGGAGG - Intergenic
1042598820 8:70477992-70478014 TTGATGATTATCTGGGTGGGAGG - Intergenic
1044277495 8:90319640-90319662 TGGATGAATGAATGGGTGGGCGG - Intergenic
1044508681 8:93049840-93049862 ATTGGGACTGACTGGGTGGTTGG - Intergenic
1045376910 8:101583380-101583402 TTGATGACTGATTGGCTGTGGGG + Intronic
1045388974 8:101696196-101696218 TTGATGAATGACTGAGTGAGTGG - Intronic
1045496606 8:102714693-102714715 TCGGTGACTGACTGGATATGAGG - Intergenic
1045822192 8:106352231-106352253 TTAGTGATTAACTGGATGGGTGG + Intronic
1046897263 8:119486336-119486358 TTGATGCCTGAGTGGGTGGGGGG - Intergenic
1047657364 8:126992459-126992481 TGGGTGAGTGAATGGGTGGGTGG + Intergenic
1048254118 8:132892537-132892559 ATGGTGACTGAATGGGAGTGTGG + Intronic
1048349912 8:133607958-133607980 TAGGTGACTGTATGGGTGTGGGG - Intergenic
1048427062 8:134332699-134332721 TTGGTGAATGGATGGGTGGATGG - Intergenic
1048568637 8:135630845-135630867 TGGGTGAGTGAGTGAGTGGGTGG + Intronic
1048876401 8:138839697-138839719 TTGGTGATTATCTGGATGGGGGG + Intronic
1049236571 8:141515198-141515220 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1049348239 8:142150327-142150349 TGGGTGAATGGATGGGTGGGTGG + Intergenic
1049371946 8:142272196-142272218 TGGGTGAGTGGCTGGGTGGATGG - Intronic
1049418183 8:142505056-142505078 TTGGTGGGTGGGTGGGTGGGTGG + Intronic
1049477183 8:142802157-142802179 ATGGTGGATGAATGGGTGGGTGG + Intergenic
1049576513 8:143392289-143392311 TGGGTGGATGAATGGGTGGGTGG - Intergenic
1049694210 8:143975748-143975770 TGGGTGACAGAGTAGGTGGGTGG - Intronic
1051495135 9:17712851-17712873 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1052323437 9:27192708-27192730 GTGGTGGGTGAGTGGGTGGGTGG + Intronic
1052944724 9:34159118-34159140 GTGGTGAGTGACTGGTTGGTTGG - Intergenic
1052993832 9:34539027-34539049 TTGATGAGTGAGTGGTTGGGAGG - Intergenic
1053167776 9:35856715-35856737 TTGGTGACTGATTGGGTGTGTGG + Intergenic
1053799853 9:41757468-41757490 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1054145358 9:61557465-61557487 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1054188261 9:61969522-61969544 TTGGTAAGTGGATGGGTGGGTGG + Intergenic
1054459177 9:65453489-65453511 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1054650253 9:67619054-67619076 TTGGTAAGTGGATGGGTGGGTGG - Intergenic
1055582472 9:77721681-77721703 TGGGTGGGTGCCTGGGTGGGTGG - Intronic
1055641195 9:78320209-78320231 TGGGTGAATGAATGGGCGGGTGG - Intronic
1055964747 9:81854920-81854942 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1057185973 9:93057960-93057982 TTGGTGGCTGCCTGGGCAGGGGG + Intergenic
1058146217 9:101414577-101414599 TTGGTGTCTGGTTGGGTGAGGGG + Intergenic
1060005022 9:119992199-119992221 TGGGTGTCTGACTGGGAGGGAGG - Intergenic
1060040158 9:120293461-120293483 TTGGTGAGTTAGTTGGTGGGTGG + Intergenic
1060069492 9:120533865-120533887 TTGGTGACTGACTGGATCTGGGG - Intronic
1060263172 9:122093201-122093223 TTGGTGGCGGACTGGGGCGGCGG - Exonic
1060293814 9:122329628-122329650 TTGGTGACTTATTGGATGAGGGG - Intergenic
1060889128 9:127177181-127177203 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1061387601 9:130299707-130299729 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387613 9:130299743-130299765 TAGGTGAGTGAATGGGTGGGTGG - Intronic
1061387631 9:130299839-130299861 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387638 9:130299863-130299885 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387658 9:130299959-130299981 TGGGTGAGTGAGCGGGTGGGTGG - Intronic
1061714736 9:132511535-132511557 TTGTTGACTGACTGCGTGAGAGG + Intronic
1061716009 9:132519257-132519279 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1061846771 9:133392648-133392670 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846798 9:133392756-133392778 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846823 9:133392840-133392862 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061847028 9:133393634-133393656 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061932149 9:133838724-133838746 TGGGTGGATGAATGGGTGGGTGG + Intronic
1061934837 9:133851725-133851747 TGGGTGAATGAATGGGTGGATGG + Intronic
1061938306 9:133870889-133870911 TGGGTGAGTGCGTGGGTGGGTGG + Intronic
1062051979 9:134452118-134452140 TGGGTGAGTGAATGGGTGGATGG - Intergenic
1062051997 9:134452190-134452212 TGGGTGAGTGAATGGGTGGTTGG - Intergenic
1062052008 9:134452242-134452264 TGGGTGACTGGGTGGGTGGGTGG - Intergenic
1062089687 9:134668987-134669009 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1062092523 9:134685883-134685905 ATGGTGGCTGGATGGGTGGGTGG - Intronic
1062112613 9:134790390-134790412 TGGGTGGCTGGGTGGGTGGGTGG - Intronic
1062247708 9:135577993-135578015 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1062543646 9:137052448-137052470 TTGGCACATGACTGGGTGGGGGG - Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1185583266 X:1226938-1226960 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185583307 X:1227122-1227144 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185624630 X:1473366-1473388 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185624735 X:1473809-1473831 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185639312 X:1577921-1577943 TTGATGACTGGCTGAATGGGTGG + Intergenic
1185759639 X:2680746-2680768 TTGGTGAATGGGTGGGTGGGTGG - Intergenic
1185759651 X:2680818-2680840 TTGGTGAATGGGTGGGTGGGTGG - Intergenic
1185883295 X:3759379-3759401 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1186508865 X:10115934-10115956 TAGATGGCTGGCTGGGTGGGTGG - Intronic
1186508872 X:10115958-10115980 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1186508918 X:10116086-10116108 TGGGTGGCTGGATGGGTGGGTGG - Intronic
1186508924 X:10116102-10116124 TGGGTGGCTGGATGGGTGGGTGG - Intronic
1187230761 X:17420542-17420564 TGGGTGGCTGAATGGATGGGTGG - Intronic
1187381584 X:18806812-18806834 TGGGGGACTGAGTGGGTGTGGGG - Intronic
1189695744 X:43660077-43660099 TTGGTGACTGGAAGGGTGTGGGG - Intronic
1189865335 X:45321691-45321713 CTGCTGAGTGGCTGGGTGGGTGG + Intergenic
1190474052 X:50810615-50810637 TTGGTGACGGACTGGGTTGTAGG - Intronic
1190734520 X:53247193-53247215 CTGGTGCCAGACTGGGTGGATGG - Intronic
1190738321 X:53270236-53270258 TTGGTGACTGACTTGCTAAGAGG - Intronic
1190971678 X:55356269-55356291 TTTGGGACTGACTAGGTGGTTGG + Intergenic
1191015145 X:55801426-55801448 TTGGTGACTAACTGGATTGTAGG + Intergenic
1195466968 X:105190210-105190232 TGGGTCATTCACTGGGTGGGGGG + Intronic
1197220362 X:123906474-123906496 TGGGTGACTGACTGGATATGAGG - Intronic
1198963267 X:142204417-142204439 GTGGTGACGAACTGGGTGTGAGG - Exonic
1199308322 X:146293126-146293148 ATTGGGACTGACTGGGTGGCTGG - Intergenic
1200135755 X:153873831-153873853 TTGGTGGCTGTCTGGGAGGAAGG - Intronic
1200282041 X:154785211-154785233 TTAGAGACTGAGTGGCTGGGGGG - Intronic