ID: 1100620545

View in Genome Browser
Species Human (GRCh38)
Location 12:96268077-96268099
Sequence CTGTGTCAGTATAAGTAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100620543_1100620545 -3 Left 1100620543 12:96268057-96268079 CCGACCATCTGATATATTTACTG 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1100620537_1100620545 28 Left 1100620537 12:96268026-96268048 CCCTGGTTTTCTCAGTTTTCCAT 0: 1
1: 0
2: 27
3: 291
4: 1416
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1100620538_1100620545 27 Left 1100620538 12:96268027-96268049 CCTGGTTTTCTCAGTTTTCCATA 0: 1
1: 0
2: 4
3: 47
4: 616
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1100620542_1100620545 -2 Left 1100620542 12:96268056-96268078 CCCGACCATCTGATATATTTACT 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1100620544_1100620545 -7 Left 1100620544 12:96268061-96268083 CCATCTGATATATTTACTGTGTC 0: 1
1: 0
2: 1
3: 26
4: 259
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1100620541_1100620545 9 Left 1100620541 12:96268045-96268067 CCATAGGGAATCCCGACCATCTG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100620545 Original CRISPR CTGTGTCAGTATAAGTAAGT TGG Exonic
905080843 1:35318862-35318884 CTGTGTCAGTTTAAATGTGTAGG - Intronic
906861383 1:49364042-49364064 CTGTGTCAGGTTCAGTAAGCGGG + Intronic
908774070 1:67623452-67623474 CTGTGTTCACATAAGTAAGTAGG + Intergenic
910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG + Intergenic
913115706 1:115694707-115694729 CTGTGTAAGTATCCCTAAGTGGG + Exonic
915967079 1:160319143-160319165 GTGTGTCTGTATAGGTAAATGGG - Intronic
916728366 1:167543852-167543874 CTTTGTCAGCATAATAAAGTGGG + Intronic
917690011 1:177459184-177459206 CTGTCTCAGGACAAGAAAGTTGG + Intergenic
924370972 1:243349206-243349228 ATGTGTCTGTATATGTGAGTGGG - Intronic
924378792 1:243441193-243441215 ATGTGTCATTAAAAGAAAGTAGG + Intronic
1062928192 10:1333804-1333826 CTGTGGCATTACAGGTAAGTTGG - Intronic
1065037269 10:21652574-21652596 CTGGGACAGAATAAATAAGTTGG + Intronic
1065170824 10:23026483-23026505 CTGTGTCAGTTAATATAAGTTGG - Intronic
1065616626 10:27533513-27533535 CTGTGACAGTATATGTTAATAGG + Intronic
1066512940 10:36122168-36122190 CTCTGGCACTATAAGTCAGTGGG - Intergenic
1066703637 10:38155858-38155880 TTGTGCCAGTTTTAGTAAGTTGG - Intergenic
1066987090 10:42477084-42477106 TTGTGCCAGTTTTAGTAAGTTGG + Intergenic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1079487179 11:20947422-20947444 CCGTGTCTGTAGAGGTAAGTGGG + Exonic
1080030731 11:27658123-27658145 GTGTGACAGTATTAGTGAGTGGG - Exonic
1080789186 11:35505735-35505757 CTGTATCTGTATAAGTGAGGTGG + Intronic
1081135278 11:39432603-39432625 AAGTGTTAGTATAGGTAAGTTGG + Intergenic
1081153131 11:39656678-39656700 TAGAGTAAGTATAAGTAAGTAGG - Intergenic
1085391375 11:76184064-76184086 CTCTGTCAGGACAAGTAAATGGG - Intergenic
1085547894 11:77337315-77337337 CTCTGTCAAGCTAAGTAAGTAGG - Exonic
1086365214 11:86102348-86102370 GTGAGTCAGTATAAGGTAGTGGG - Intergenic
1087119950 11:94563205-94563227 CTGTGTCAGTATGGCTGAGTGGG + Intronic
1089634755 11:119804989-119805011 CTATGACAGTCTAGGTAAGTGGG - Intergenic
1089883743 11:121799803-121799825 CTGTGACAGTATTAGAAGGTGGG - Intergenic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1092710611 12:11333285-11333307 CTGCATCAGTAAATGTAAGTTGG + Intergenic
1092775411 12:11941138-11941160 CTGTGTCAGTCTAACTAAGCAGG + Intergenic
1093441784 12:19206810-19206832 GTGAGTCAGTATAAAGAAGTGGG - Intronic
1096452271 12:51753803-51753825 CTGTGTTAGTATAATTCAATAGG + Intronic
1097715026 12:62956581-62956603 ATGTGTCAGTATATGTAATTGGG + Intergenic
1098918082 12:76277785-76277807 CTGTGTCTGGAAAAGTAAGTTGG - Intergenic
1099647503 12:85378105-85378127 CTGTGTCACTTTATCTAAGTTGG + Intergenic
1099810372 12:87574062-87574084 CTCTGTAAGAATAAATAAGTAGG - Intergenic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106497053 13:30287776-30287798 TTGTGTCTGTATTTGTAAGTAGG - Intronic
1107023052 13:35771673-35771695 ATGTGTCAGTAAAAGAAAGACGG + Exonic
1107934977 13:45338641-45338663 ATGTGTAAGTACAAGGAAGTGGG - Exonic
1108009137 13:45985971-45985993 TTGGGGCAGTATAGGTAAGTTGG - Intronic
1109907047 13:68856814-68856836 GTGTGTCAGCATAGCTAAGTTGG + Intergenic
1110769491 13:79323241-79323263 TTGTGTGAGTATAAGTTATTTGG - Intronic
1111303718 13:86378934-86378956 ATGTGTCTTCATAAGTAAGTAGG - Intergenic
1111840597 13:93445341-93445363 CTATGACAGTATTAGGAAGTAGG - Intronic
1113102760 13:106737787-106737809 GTGTGTCAGTATCAGTAAATAGG + Intergenic
1113272369 13:108687340-108687362 CTGTGTGATTATAATTATGTAGG - Intronic
1114768419 14:25401157-25401179 CTTTGTTAGGAAAAGTAAGTTGG + Intergenic
1115922377 14:38390402-38390424 TTGTATCATTATAAGTTAGTTGG + Intergenic
1118120744 14:62838776-62838798 CAGTGTCTGTATCAGTAAATGGG + Intronic
1120387469 14:83864371-83864393 CTGTTTCAGTATTGGCAAGTAGG + Intergenic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1129609212 15:77039530-77039552 CTGTTTCAGCATCAGTAAGATGG + Intergenic
1129747368 15:78033253-78033275 GTGTGTGCGTATAAGTAAGGTGG - Intronic
1129940909 15:79495686-79495708 CTGTGTGAGTATATGTAAAGTGG + Intergenic
1129940925 15:79495968-79495990 CAGTGTGAGTATATGTAAGGGGG + Intergenic
1129998096 15:80024136-80024158 CTATGTCAATATAAGAAAGCAGG - Intergenic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1131911887 15:97214609-97214631 TTGTGTTAGAATAAGTATGTTGG + Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1138025715 16:53520996-53521018 CTGTGTGAATATAAATCAGTTGG - Intergenic
1138300415 16:55922302-55922324 CTGTGTCTTTATAGGTAAGGTGG - Intronic
1139054679 16:63168109-63168131 TTGTATCAGTATAAGTTTGTAGG - Intergenic
1139083502 16:63556059-63556081 ATGTGTCACTCTAAGTAAATTGG - Intergenic
1144125800 17:12201931-12201953 CTTTGTCAGTATCAGGAAGCTGG + Intergenic
1146526676 17:33572700-33572722 CTGAGTCAGTGTGAGTAAATAGG + Intronic
1146601815 17:34223917-34223939 CTGTGTGAGTAATAGCAAGTGGG - Intergenic
1147748347 17:42710116-42710138 CTGAGTCAGGATAAATAATTAGG - Intronic
1152133048 17:78488770-78488792 CTGTGTCCTTATAAGCAAATGGG + Intronic
1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG + Intronic
1156130160 18:33963149-33963171 CTGTGTCAAATTAAGTAACTTGG - Intronic
1157788113 18:50505116-50505138 CTTTATCAGAATAAGCAAGTGGG - Intergenic
1158422356 18:57306441-57306463 CTGTGTCCTTATCAGGAAGTTGG - Intergenic
1159670811 18:71218534-71218556 CTGTAACTGGATAAGTAAGTTGG + Intergenic
1161796361 19:6388939-6388961 CTGTCTCAAAATAAATAAGTAGG + Intronic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
929819495 2:45261888-45261910 TTGTGACAATATAATTAAGTGGG - Intergenic
933230179 2:79797953-79797975 TTGTGTCAGTGTCAGTAAGAGGG - Intronic
934859495 2:97752025-97752047 CTCTGTCATTAGAAGTAAGTGGG + Intergenic
942498944 2:176568029-176568051 CTGTGTGAATATAAGCAAATTGG + Intergenic
943821176 2:192323610-192323632 CTGTGTCATTATAAATTAGACGG - Intergenic
1174738845 20:52992318-52992340 CTCTGTGAGTATAAATAACTGGG - Intronic
1175512488 20:59540998-59541020 ATGTGTCTGTATAAGTGAGTGGG + Intergenic
1176897459 21:14398169-14398191 CTTTGTCAATATAACTAATTTGG - Intergenic
1181677063 22:24462168-24462190 CTGTCAGAATATAAGTAAGTTGG + Intergenic
950728558 3:14936060-14936082 CTGGGTTAGTCTTAGTAAGTAGG + Intergenic
952447565 3:33397110-33397132 CTTTGTCAGTTTTAATAAGTCGG + Exonic
958449603 3:94257621-94257643 CTGTGTCAGTCTGAGTTAATTGG + Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
959146606 3:102553772-102553794 TTGTGTCAGTATTAAAAAGTGGG - Intergenic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
964605389 3:158555323-158555345 CTGTGTCAATCTTAGTAACTTGG + Intergenic
965361025 3:167737923-167737945 CTGTGTCAGTAAAAGAGATTGGG + Intronic
965971349 3:174559808-174559830 ATGTGACAGTATTAGTAGGTAGG - Intronic
967279026 3:187804653-187804675 CTGTGTCAGTGTAAGCCCGTGGG - Intergenic
969121137 4:4912250-4912272 CTGTCTCAAAATAAGTAAATAGG + Intergenic
969950388 4:10829630-10829652 CAGTGACAGTATTAGGAAGTGGG + Intergenic
972504787 4:39710662-39710684 CTTTCTCAGTATCAGTAACTTGG + Intronic
972577552 4:40365622-40365644 CTGTGTCATATTAAGGAAGTTGG - Intergenic
973068078 4:45822062-45822084 CTGTGTCAGTTTCAATAATTGGG + Intergenic
978326106 4:107558336-107558358 CTGTGTCAATAAATGTAAATAGG - Intergenic
979044682 4:115848004-115848026 GTGTGTCAGTAAAATTAACTAGG + Intergenic
980693248 4:136322874-136322896 CAATGTCATTATTAGTAAGTTGG - Intergenic
984602074 4:181739318-181739340 CTGTGACATTATGAGTAAGTGGG - Intergenic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
994178146 5:96734465-96734487 CTGTGATAGAATAAGAAAGTGGG + Intronic
995126509 5:108581990-108582012 CAGTGATAGTATAAGGAAGTGGG - Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999589997 5:153134337-153134359 CTGCTTCAGTAAAAGGAAGTTGG + Intergenic
1001701065 5:173706759-173706781 GTGTGACAGTATTAGGAAGTGGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005706379 6:28458219-28458241 CTGTGTCCGTCTCAGTAAGGAGG - Intergenic
1008644794 6:53503089-53503111 TTGTGACAGTATTAGAAAGTAGG + Intronic
1009985638 6:70778708-70778730 CAGTGTCAGTCTGAGTACGTCGG + Intronic
1010650797 6:78453388-78453410 CCCTGTCACTATCAGTAAGTAGG + Intergenic
1013936685 6:115604923-115604945 ATGTGACAAAATAAGTAAGTAGG + Intergenic
1013947619 6:115740823-115740845 CTGGTTCAAAATAAGTAAGTAGG + Intergenic
1018914406 6:168124044-168124066 ATGTATCAGTATAAGTAAGTGGG - Intergenic
1027777153 7:82480776-82480798 CTGCATCAGTTTAATTAAGTCGG + Intergenic
1027838912 7:83281638-83281660 CTTTGTCTGTATAAGACAGTTGG - Intergenic
1027974229 7:85128799-85128821 CTGTATCAGCATAAATAATTGGG + Intronic
1029788971 7:102822557-102822579 CTGTGACAGTAATAGAAAGTGGG - Intronic
1029841470 7:103368424-103368446 CTTTGCCACTACAAGTAAGTAGG - Exonic
1031153190 7:118078052-118078074 CAGAGGCAGTATAAGTTAGTGGG - Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1035030880 7:155858385-155858407 CTGTGTGAGTGTAAATATGTGGG + Intergenic
1036470104 8:9045351-9045373 CAGTGCAAGTATACGTAAGTGGG - Intronic
1038455604 8:27670436-27670458 GTGTCCCAGTATGAGTAAGTGGG - Intronic
1039225061 8:35379205-35379227 CTGTGTGACTATAAGTTACTAGG - Intronic
1040681451 8:49815374-49815396 CTGTCTCAGTATAAGGAATTTGG - Intergenic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1042741821 8:72057205-72057227 GTGTGTCTGTATGTGTAAGTGGG + Intronic
1042757442 8:72231854-72231876 GTGTGTCTGTATGTGTAAGTGGG + Intergenic
1043716711 8:83496109-83496131 CTGTGTGAGTCTAAGTCTGTAGG - Intergenic
1046368974 8:113275438-113275460 CTGACTCAGAATATGTAAGTGGG + Intronic
1046867452 8:119166559-119166581 CTGAGTCAGTTTAATTCAGTTGG - Intronic
1047032974 8:120903539-120903561 CTGTGATAGTATTAGCAAGTGGG + Intergenic
1047067744 8:121305270-121305292 ATGTGAAAGAATAAGTAAGTTGG + Intergenic
1050419799 9:5451610-5451632 CTTTCTCAGTAAAAGTAGGTAGG + Intronic
1052965137 9:34334807-34334829 CTGTGTCAGTTTAGCTAAGCTGG + Intronic
1055451358 9:76433775-76433797 CTGTGTCAGTACCAGATAGTAGG + Intronic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1058877366 9:109256363-109256385 CTGTGTGCGTTTAAGTAATTTGG - Intronic
1059033953 9:110733297-110733319 CTTTGTTAATTTAAGTAAGTTGG - Intronic
1059135737 9:111804272-111804294 TTTTGTCAGTATAAATAATTTGG - Intergenic
1061433426 9:130545505-130545527 ATGTGGCAGTATCAGGAAGTGGG + Intergenic
1188541873 X:31259843-31259865 CTGTGTAGGTATACGTAAGTGGG - Intronic
1189571009 X:42297032-42297054 ATGTGTCACTATAGGTCAGTGGG + Intergenic
1194317077 X:92391735-92391757 CTATTTCACTATAGGTAAGTTGG + Intronic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic
1196015623 X:110937437-110937459 GTGTGTCAGTATTGGGAAGTGGG + Intergenic
1197907334 X:131439913-131439935 AGATGTCAGCATAAGTAAGTAGG - Intergenic