ID: 1100620870

View in Genome Browser
Species Human (GRCh38)
Location 12:96271455-96271477
Sequence CACACGCGCCACTGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100620870 Original CRISPR CACACGCGCCACTGGGGAGT GGG (reversed) Intergenic
900171075 1:1269145-1269167 CACACCCGAGACTGGGGAGAGGG + Intronic
900171097 1:1269224-1269246 CACACCCGAGACTGGGGAGAGGG + Intronic
900171118 1:1269303-1269325 CACACCCGAGACTGGGGAGAGGG + Intronic
901233884 1:7657109-7657131 CACACTGGCCACTGGGAAGCAGG - Intronic
905046217 1:35004683-35004705 CACCCCCGCCTCAGGGGAGTGGG - Intronic
913250497 1:116909364-116909386 CACCCTAGCCACCGGGGAGTGGG + Intergenic
916316544 1:163454699-163454721 CACAGGTGCCAATGGGGAGAGGG + Intergenic
919130925 1:193449444-193449466 CACTTGAGCCAGTGGGGAGTGGG + Intergenic
1064428644 10:15252612-15252634 CACACGCGCCCTCGGGGACTTGG - Intronic
1065464941 10:26009545-26009567 CACACCCGCACCTGAGGAGTAGG - Intronic
1075975646 10:126691815-126691837 CCCAGGCTCCACTGGGCAGTGGG - Intergenic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1083637823 11:64129807-64129829 AATACGCGCCCCAGGGGAGTTGG + Intronic
1085034004 11:73289399-73289421 CACAGGAGCCACTGGGGACGTGG - Intronic
1091676625 12:2495648-2495670 CACACGCTCCCCAGGGGAGAAGG - Intronic
1100256004 12:92883953-92883975 CACACATGCCACTGTGGAGGAGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100620870 12:96271455-96271477 CACACGCGCCACTGGGGAGTGGG - Intergenic
1105405730 13:20131204-20131226 CACAGGCGCCACTGGGGAAGTGG + Intergenic
1108168672 13:47718906-47718928 TACATGCACCGCTGGGGAGTTGG - Intergenic
1115196244 14:30803060-30803082 CACACGCTGCAATGGAGAGTTGG - Intergenic
1128886258 15:71290985-71291007 GACACTTGCCTCTGGGGAGTGGG - Intronic
1128944468 15:71811491-71811513 CACACGCGGCACTGGAGCGAGGG - Exonic
1134441749 16:14302780-14302802 CACACGCCCCTCTGGGGAGCGGG - Intergenic
1136247678 16:28984963-28984985 CCCACCCGCCAGTGGGGAGGGGG - Intronic
1141162367 16:81638026-81638048 CACCCCCCCCACTGGGGATTAGG + Intronic
1141519991 16:84572109-84572131 TGCAAGCACCACTGGGGAGTGGG + Intronic
1144853985 17:18258230-18258252 CACACCCGCCCCTGGGCAGCCGG + Intronic
1151487789 17:74412356-74412378 CGCACCCGGCACTGTGGAGTTGG + Intergenic
1157564123 18:48668284-48668306 CACAGGAGACACTGGGGAGGTGG + Intronic
1157818910 18:50751210-50751232 CACACATGTCAGTGGGGAGTGGG + Intergenic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1160358260 18:78246933-78246955 CACACGTGCTGCTGGGGAGGGGG + Intergenic
1163004157 19:14387114-14387136 CACACACTACACTGGGGAGTGGG + Intronic
1163476139 19:17527165-17527187 AACACGGGCCCCAGGGGAGTGGG + Intronic
1167281926 19:48574346-48574368 CACCCTGGCCTCTGGGGAGTGGG + Intronic
931990407 2:67784389-67784411 CACAAGCGTCACTCTGGAGTGGG - Intergenic
937244832 2:120485933-120485955 CACACGTGCCACTCGGCAGAAGG - Intergenic
942274586 2:174310773-174310795 CACATGTGCCACTGTGGAGGAGG - Intergenic
942769994 2:179504939-179504961 CACATGCAACACTGGGGATTAGG + Intronic
948588959 2:239037479-239037501 CACACGCACCACGGGAGAGTGGG - Intergenic
1171338629 20:24409773-24409795 CACAGGCGGTGCTGGGGAGTGGG - Intergenic
1172736377 20:37128956-37128978 AACACTCTCCACTGGGGTGTGGG + Intronic
1173663998 20:44752600-44752622 CACAAGAGCCCCTGGGGAGTAGG - Intronic
1175860701 20:62148671-62148693 CCCAAGCGCCACGGGGGAGGTGG + Intronic
1179973731 21:44851179-44851201 CACACGCAACACAGGGAAGTCGG - Exonic
1180745803 22:18088150-18088172 CACAGGCGCCCCTGGGGAAATGG + Exonic
1181257563 22:21573747-21573769 CGCAAGCAGCACTGGGGAGTAGG - Intronic
1181745412 22:24952564-24952586 CCCAGGCGCCACTGCGGACTCGG + Intergenic
1183951974 22:41357408-41357430 CACCGCCACCACTGGGGAGTAGG + Exonic
950217599 3:11170431-11170453 CACACCCCACACTGGGCAGTGGG + Intronic
953839047 3:46373919-46373941 CACCCGATCCACTGGGGAGCAGG + Exonic
961569720 3:127789066-127789088 CAAACGCTCCACTGGAGAGGTGG + Intronic
985560987 5:585683-585705 CAAACGCAGCACTGGGGGGTGGG + Intergenic
985580920 5:694654-694676 CACACTCGCAGCTGGGAAGTCGG + Intergenic
985595545 5:785986-786008 CACACTCGCAGCTGGGAAGTCGG + Intergenic
987647014 5:20686747-20686769 CACAGGTGCCACTGCAGAGTAGG - Intergenic
992781497 5:80132241-80132263 AGCACGGGCCACAGGGGAGTAGG + Intronic
995106481 5:108381833-108381855 CACACGCGACGGTGGGGGGTGGG + Exonic
996455166 5:123673328-123673350 CACACACACCACTGGGTAATTGG - Intergenic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1000505040 5:162106068-162106090 CACACGAGACATTGGGGAGGTGG - Intronic
1001056611 5:168455133-168455155 CACACGTGCCACGGAGGGGTAGG + Intronic
1002188987 5:177469174-177469196 CACCCGCTCCACTGGGTTGTAGG - Intronic
1002450503 5:179315740-179315762 CACAAACGCCACTGGAGAGAGGG + Intronic
1010925978 6:81746732-81746754 CACAGGCGCTAATAGGGAGTCGG + Exonic
1015842483 6:137489505-137489527 CTCACCCTCCACTGGGGAGGAGG - Intergenic
1023497900 7:40817350-40817372 CACCCAAGTCACTGGGGAGTCGG + Intronic
1024456914 7:49618869-49618891 CACAAGTTTCACTGGGGAGTTGG - Intergenic
1032187367 7:129738416-129738438 CACACGCCCCCCTGGGAAATAGG + Intronic
1035008809 7:155692568-155692590 CACACGGCCCAGTTGGGAGTGGG + Intronic
1035057590 7:156046330-156046352 CACACGCCCCACAGGGCAGGGGG + Intergenic
1036693228 8:10957776-10957798 AACAAGCGAAACTGGGGAGTGGG + Intronic
1041282611 8:56226522-56226544 CACAGGAGAAACTGGGGAGTGGG - Intergenic
1049710972 8:144063137-144063159 CAGAGGCGCCACTAGAGAGTAGG - Intronic
1057851817 9:98571950-98571972 CACATGGGGCACTGGGGAGGAGG - Intronic
1058417307 9:104802441-104802463 CACACGAGCCACTGGGTTGGAGG - Intronic
1059900493 9:118920625-118920647 CACAAGCACCTCTGGGGAGGGGG + Intergenic
1061922129 9:133788078-133788100 CAGTCGCCTCACTGGGGAGTGGG + Intronic
1195023893 X:100856179-100856201 CACATACGCCACTGTGGAGGAGG - Intronic
1197773530 X:130105838-130105860 CACACAGGCCCCTGGGGAGTGGG - Intronic
1199700156 X:150369779-150369801 CACGTGCACCACTGGGGTGTGGG + Intronic
1199845476 X:151689880-151689902 CAAAAGCACCACTGGAGAGTAGG - Intergenic