ID: 1100620959

View in Genome Browser
Species Human (GRCh38)
Location 12:96272480-96272502
Sequence CTGGAGAAACGGCTGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100620954_1100620959 25 Left 1100620954 12:96272432-96272454 CCTTAAGACTATTTTGACTGTTA 0: 1
1: 0
2: 0
3: 22
4: 238
Right 1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100620959 Original CRISPR CTGGAGAAACGGCTGGAGAG TGG Intergenic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900561558 1:3309610-3309632 CTGGAGAAGGTGCTGGAGCGGGG + Intronic
900849483 1:5130934-5130956 TTGGAGAGAGGGCAGGAGAGGGG - Intergenic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902824044 1:18960457-18960479 CAGGTGAAATGGCTGGGGAGTGG - Intergenic
902883820 1:19390676-19390698 CTGGAAAGACGGGTGGGGAGTGG + Intronic
903288469 1:22291913-22291935 ATGGAGAATGGGCTGGAAAGGGG + Intergenic
903779790 1:25813979-25814001 CTGGAGGAACTGCAGGTGAGCGG + Exonic
904683143 1:32242513-32242535 CTGGTGGAAGGGCTGGAAAGTGG + Intergenic
906213953 1:44028408-44028430 GTGGAGAAAGGACTGGAGGGAGG + Intronic
910189699 1:84583082-84583104 CTGGAGAAAAGGCTGCAGTCAGG - Intergenic
910268349 1:85365380-85365402 CTGGAGAAATGGAAGGATAGAGG + Intronic
910288854 1:85581084-85581106 CAGGGGAAGGGGCTGGAGAGCGG - Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911105541 1:94128613-94128635 ATGGAGAAAAGTCTGGAAAGAGG + Intergenic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
915839624 1:159203825-159203847 CTGGGGAAACAGCTGAGGAGGGG + Intronic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918682714 1:187374856-187374878 CTGGAGAAAGAACTGGAAAGTGG - Intergenic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920557396 1:206914161-206914183 TTGGAGAGACGGCTGGAGCTGGG - Intronic
920965260 1:210696019-210696041 CCAGAGAAACTGCTGGAGAGTGG - Intronic
923385815 1:233464345-233464367 CATGAGAAACGTCTGGAGATAGG - Intergenic
923436155 1:233969892-233969914 CAGGAGAAATGGCTGGGGAACGG + Intronic
924440620 1:244082521-244082543 TTGGAGAAAAGATTGGAGAGAGG + Intergenic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
1063368362 10:5505044-5505066 CTGGAGAAGTGTCTTGAGAGAGG + Intergenic
1063502341 10:6566613-6566635 TAGGAGAAAAGACTGGAGAGAGG - Intronic
1063799144 10:9552686-9552708 CTAGAAAAATGGCTGGAAAGTGG + Intergenic
1064115860 10:12576977-12576999 CTGGGGAAAGGGGTGGAGAGAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1067440831 10:46308447-46308469 CTTAAGAGAAGGCTGGAGAGGGG - Intronic
1067772643 10:49138439-49138461 CTGGAAAACCCACTGGAGAGTGG - Intergenic
1069498041 10:68924773-68924795 GAGGAGAAACTGCTGGACAGAGG - Intronic
1069875499 10:71560479-71560501 CCAGAGAAAAGGGTGGAGAGTGG - Intronic
1070380454 10:75876355-75876377 AGGGAGAAAAGGCTGGAGAAGGG + Intronic
1071565997 10:86671573-86671595 CTGGAGAACTGGCTGGGGTGGGG - Intronic
1071693254 10:87844586-87844608 GTGGAGGAACAGGTGGAGAGTGG - Intergenic
1072139214 10:92574568-92574590 CTGGAGACAAGGCTCGAGTGCGG + Intergenic
1072306870 10:94116107-94116129 TTGAAGAAAAGGATGGAGAGAGG - Intronic
1072617128 10:97057282-97057304 CTGGAGAAAAGGCAGCAGAGAGG + Intronic
1073099500 10:100999454-100999476 CTGGAGAAGCGGAGGGGGAGGGG + Exonic
1073194980 10:101683197-101683219 ATGGAGAAATGGCTGGCCAGAGG - Intronic
1074191741 10:111144082-111144104 TTGGGGAAAGGGCAGGAGAGAGG - Intergenic
1074518795 10:114198194-114198216 CTAGTGACACGGGTGGAGAGAGG + Intronic
1075390329 10:122086780-122086802 CTGGAGAAAAGGCAGGAGCTGGG + Exonic
1076631288 10:131853576-131853598 CAGGAGAAATGGAGGGAGAGGGG - Intergenic
1077138510 11:1013291-1013313 CTGGGGCACCGGTTGGAGAGGGG - Exonic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077961971 11:7084975-7084997 CTGGAGAATTGGTTGGTGAGGGG + Intergenic
1078609981 11:12811606-12811628 CAGGAGTCAGGGCTGGAGAGGGG + Intronic
1079024326 11:16934058-16934080 CTGGAGGAGAGGCTGGAGACAGG + Intronic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1079204142 11:18399214-18399236 GGGGAGACAGGGCTGGAGAGAGG + Intronic
1080369076 11:31613101-31613123 CTGCAGCAATGGCTGTAGAGAGG + Intronic
1080702609 11:34657138-34657160 TTTGAGAAACAGCTGCAGAGGGG - Intronic
1081574323 11:44309824-44309846 CTGGCGACACCCCTGGAGAGTGG - Exonic
1082852166 11:57775059-57775081 CTGTAGAAACTGATGTAGAGGGG + Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1085100647 11:73797112-73797134 CGGGACAACCGGCTGCAGAGAGG + Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1086392030 11:86375060-86375082 GTGGAGAAGGGGCTGGAGGGTGG + Exonic
1086804260 11:91220439-91220461 GTGGAGAAACCACTGGTGAGAGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1089195578 11:116692452-116692474 CTGGGGGGACGGCTGGGGAGGGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089622430 11:119729426-119729448 CTGGGGAGCCGGCTGGAGCGCGG + Intergenic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1091281916 11:134386573-134386595 GTGGAAATAGGGCTGGAGAGAGG - Intronic
1091400443 12:177736-177758 CTGGGGACAGGGATGGAGAGGGG - Exonic
1092284688 12:7121950-7121972 GTGGAGAAAGGGCAGGGGAGGGG - Intergenic
1093091763 12:14929312-14929334 CTGGAGAGACTGCAGGAGAGTGG - Intronic
1093485980 12:19653043-19653065 CTGGAAAAATGCCTGGAGTGAGG + Intronic
1094395197 12:29998175-29998197 CTTGAGAAAGGTCTGGAGAAGGG - Intergenic
1095166079 12:38973644-38973666 CTGGAGGAATTGCTGGAGAGAGG - Intergenic
1095496815 12:42793854-42793876 ATGGAGAGAGGGATGGAGAGAGG - Intergenic
1096361036 12:50987175-50987197 CTGAGGAAACAGCTGTAGAGAGG + Exonic
1096418602 12:51435869-51435891 CTGGAGAAATGGCTGGTCATAGG - Intronic
1096849891 12:54428734-54428756 CTGGGGAGACTGCTGGTGAGGGG - Intergenic
1096870793 12:54590860-54590882 CTGGAGAGATGGCTGATGAGGGG + Intergenic
1098141690 12:67456641-67456663 CTTCAGAAACTGCTGGAGGGTGG - Intergenic
1098429832 12:70407425-70407447 CTGGAGAGGTGGCTAGAGAGAGG + Intronic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1100183196 12:92107635-92107657 CTGGGCAAACGGCTGTGGAGGGG - Intronic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1101320773 12:103671104-103671126 GTGGAGAAACTTTTGGAGAGTGG - Intronic
1101434073 12:104650261-104650283 GTGGAGGATGGGCTGGAGAGTGG + Intronic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1102227653 12:111240333-111240355 CTAGAGAGAGGGCTGGAGGGGGG - Intronic
1102476519 12:113192040-113192062 GTTGAGACAGGGCTGGAGAGAGG - Exonic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1103764824 12:123272157-123272179 CTGGAGAAAATGGTGGCGAGTGG + Intronic
1104423999 12:128659801-128659823 CTGGAGAAGCCACTGGACAGTGG - Intronic
1105070134 12:133229409-133229431 CTGGGGAAAAGTCTGGAGAGGGG - Intronic
1105612288 13:21978872-21978894 CTGGAGAAAGTGCAGGTGAGTGG - Intergenic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106181306 13:27371900-27371922 CTGGAGTGAGGGCTGGAGGGCGG + Intergenic
1106200239 13:27530266-27530288 CTGGAGAAAGGGGTGGGGAGTGG - Intergenic
1106549403 13:30758462-30758484 CTGGAGCAACTTCTGGAAAGGGG - Intronic
1111450067 13:88403818-88403840 ATGAAGAAACCTCTGGAGAGGGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113672983 13:112187645-112187667 CAGCAGAAAGGCCTGGAGAGGGG - Intergenic
1113751455 13:112779238-112779260 CTGGAGTAGCCGCTGGAGTGAGG + Intronic
1113919940 13:113901573-113901595 CAGGAGAAAAGGCTGGACAGGGG - Intergenic
1114111814 14:19483320-19483342 ATGGGGAAAAGGCTGGTGAGCGG + Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1118471166 14:66076688-66076710 CTGGAGAAATGTCAGGAGAGAGG - Intergenic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1118869317 14:69727923-69727945 ATGGAGGAAGGGCAGGAGAGAGG + Intronic
1119562661 14:75603374-75603396 TTAGAGAGACGGCTGGACAGCGG + Intronic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1120952184 14:90051443-90051465 GGGGAGAAGTGGCTGGAGAGAGG + Intergenic
1120979128 14:90275570-90275592 CTGGAGAAGCAGCTGGGGTGGGG - Exonic
1121254414 14:92520602-92520624 CTGGAGAGAGGGGTGGACAGAGG + Intronic
1121271236 14:92639497-92639519 CGGGAGACATGGCTGGAAAGGGG + Intronic
1122386842 14:101354667-101354689 CTAGAGAAAGCCCTGGAGAGGGG - Intergenic
1122439419 14:101719790-101719812 CTGGATAAACACCTGAAGAGGGG + Intergenic
1122509598 14:102255652-102255674 CTGGAGAAGCTTATGGAGAGTGG - Intronic
1122578747 14:102757989-102758011 CTGGGGAAAGGGCAGGACAGAGG + Intergenic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125726197 15:41869459-41869481 CTGAAGCCACGGGTGGAGAGAGG - Intronic
1128036042 15:64527657-64527679 CTGGAGAAAGGAATGGAGAGAGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1128532743 15:68465636-68465658 CTGGAGAACTGGCTGAAGACTGG - Intergenic
1128683403 15:69667292-69667314 CTTGAGAACCGGCTGCAGGGTGG - Intergenic
1129673125 15:77617946-77617968 CTGCAGAAGAGCCTGGAGAGAGG - Intronic
1129703686 15:77782683-77782705 CTGGGGAAGGGGTTGGAGAGTGG - Intronic
1129705604 15:77792375-77792397 CTGGAGAAAGGACTGTAGGGTGG - Intronic
1129708509 15:77808236-77808258 CTGCAGATGAGGCTGGAGAGGGG - Intronic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1130461778 15:84164633-84164655 CTGGAGAAAAGGAGGGGGAGAGG - Intergenic
1130595333 15:85245134-85245156 CAGGAGAGGCTGCTGGAGAGGGG + Intergenic
1130872487 15:87982373-87982395 GTGAAGAAAAGGCTGAAGAGGGG + Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134908597 16:18003881-18003903 GTGCAGAAACTGCTGGAGTGCGG - Intergenic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136496969 16:30650839-30650861 CTGGAGAGAGGGCGGGAGTGGGG + Intronic
1139516423 16:67454950-67454972 CTGGAGAAGCCTCTGAAGAGGGG - Intronic
1139596209 16:67959813-67959835 CTGGAGCAGCTGCTGGGGAGAGG + Intronic
1140354802 16:74296701-74296723 GCGGAGAAAGGGCTGGAGAAAGG - Intergenic
1140545664 16:75806216-75806238 CTGGAGAATCGGTTGGTGTGGGG + Intergenic
1142493669 17:294572-294594 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493708 17:294820-294842 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493723 17:294929-294951 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493763 17:295178-295200 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493798 17:295397-295419 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493807 17:295452-295474 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493840 17:295670-295692 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493873 17:295888-295910 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493909 17:296107-296129 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493928 17:296217-296239 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493937 17:296272-296294 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493946 17:296327-296349 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493955 17:296382-296404 CTGCAGAAATGGATGGACAGAGG + Intronic
1143448929 17:7024209-7024231 CTGGTGCAGTGGCTGGAGAGAGG - Exonic
1143987744 17:10929779-10929801 ATGGAGAATAGGTTGGAGAGAGG + Intergenic
1144284935 17:13764696-13764718 CTTGAGAAACTGCTCTAGAGCGG - Intergenic
1146159569 17:30552635-30552657 CTGGAGAGCTGGCTGGAGGGAGG + Intergenic
1146645801 17:34576912-34576934 CTGGAGCCCGGGCTGGAGAGAGG - Exonic
1146815543 17:35939181-35939203 GAGGAGAAATGGCTGGGGAGGGG + Intronic
1147330488 17:39696321-39696343 CTGGAGAGGGGGCTGGAGTGGGG - Intronic
1147948846 17:44095851-44095873 ACGGAGAACCGGCTGGGGAGAGG + Intronic
1148287744 17:46410703-46410725 CTGGAGCAAAGGCTGGAGCATGG - Intergenic
1148309913 17:46628283-46628305 CTGGAGCAAAGGCTGGAGCATGG - Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1148451822 17:47783543-47783565 CTGGAGAGGCGGTGGGAGAGAGG - Intergenic
1148725580 17:49787711-49787733 CTTAAGAAAAGGCTGGAAAGTGG - Intronic
1148878523 17:50707557-50707579 GTGCAGAAACTGGTGGAGAGCGG - Exonic
1148966506 17:51440433-51440455 CTGAAGAAACCCATGGAGAGAGG + Intergenic
1149394601 17:56226729-56226751 TTGGAGAGAGTGCTGGAGAGAGG + Intronic
1149866671 17:60154934-60154956 CTGGAAAAGAGGCTGGTGAGAGG - Intronic
1150338474 17:64346706-64346728 CTGGGGAAATGGATGCAGAGTGG - Intronic
1150780978 17:68121992-68122014 CTGGAGAGTCGGCTGCTGAGGGG - Intergenic
1151345901 17:73500935-73500957 CTGGAGAAATGACAGGACAGGGG - Intronic
1151512108 17:74567200-74567222 CATGAGAAAAGGCTGGCGAGGGG - Intergenic
1151887793 17:76933344-76933366 CTGGAGTGGCTGCTGGAGAGGGG - Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1156185602 18:34659728-34659750 CTTCAGAAAGGGCTGGTGAGAGG - Intronic
1156274991 18:35575844-35575866 CTGGACCAAGTGCTGGAGAGTGG + Intergenic
1157078264 18:44492526-44492548 GTGGAGAATGGGCTGGAGGGTGG + Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1157624264 18:49036844-49036866 AAGGAGAAAGGGCAGGAGAGAGG - Intergenic
1158889359 18:61858704-61858726 ATGGAGAAGAAGCTGGAGAGTGG + Intronic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1160827043 19:1085424-1085446 GGGGAGAAACGGAAGGAGAGAGG - Intronic
1161197752 19:2996473-2996495 CTGGAGACACCGCAGGAAAGGGG - Intergenic
1161850524 19:6735862-6735884 CGGGAGAAGGGGCTGGAGGGAGG - Intronic
1163783591 19:19262910-19262932 CTGGAGCAGTGGCTGGAGCGCGG + Intergenic
1163818002 19:19479039-19479061 ATGGAGAAGAGGTTGGAGAGTGG + Intronic
1164242135 19:23398726-23398748 CAGCAGAAAGGGCGGGAGAGAGG - Intergenic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1166102142 19:40577116-40577138 CTGGAAAAACGCCGGGGGAGGGG + Intronic
1167109117 19:47448410-47448432 CTGGAGGAAGGGCTGCAGAGCGG + Intronic
1167459107 19:49615076-49615098 CAAGAGAGAAGGCTGGAGAGTGG + Intronic
1168287266 19:55340974-55340996 CTGCAGAGACGGCTGTGGAGGGG - Intronic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
925266804 2:2571524-2571546 CAGGAAACGCGGCTGGAGAGGGG + Intergenic
925825843 2:7847686-7847708 CTGGAGAAAAGGCCTGAAAGAGG - Intergenic
926409278 2:12585235-12585257 ATGGAGAGAGGGTTGGAGAGTGG - Intergenic
927851569 2:26503260-26503282 CCGGAGGAGCGACTGGAGAGGGG - Intronic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
930093052 2:47545329-47545351 CTGGAGGAAAGGCTGCAGTGAGG + Intronic
931964073 2:67514184-67514206 ATGGAGAATGGGCTGAAGAGTGG + Intergenic
932211596 2:69936021-69936043 CTGGAAGAAGGGCTGGAGAAAGG - Intronic
932486656 2:72088042-72088064 ATGGAGGATGGGCTGGAGAGGGG - Intergenic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
935070433 2:99689164-99689186 CTGGAGAAGGGACTGAAGAGAGG - Intronic
935514983 2:104024910-104024932 CTTGATAACCTGCTGGAGAGGGG - Intergenic
937988477 2:127649379-127649401 CTGAAGCAGAGGCTGGAGAGAGG - Intronic
938125447 2:128667642-128667664 CAGGAGAGACGGCTGGGGTGAGG + Intergenic
938752366 2:134344907-134344929 CTAGAGAAACGGCAAAAGAGAGG - Intronic
939313248 2:140511655-140511677 CTGGAGGAAAGGATGAAGAGTGG + Intronic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
943058746 2:183015948-183015970 CTGGGAAAAAGGCTTGAGAGGGG + Intronic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943820368 2:192314454-192314476 CGGGAAGAACAGCTGGAGAGAGG - Intergenic
945978529 2:216289538-216289560 ATGGAGAAACAACTGGAGACTGG - Intronic
946068507 2:217010776-217010798 CTATAGAAAAGGGTGGAGAGCGG + Intergenic
946161971 2:217840937-217840959 AGGGAGAGAGGGCTGGAGAGAGG + Intronic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
948595190 2:239075443-239075465 CAGGAGAAATGGGTGGAAAGAGG + Intronic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
948643003 2:239387279-239387301 CTGCAGCAGGGGCTGGAGAGTGG + Intronic
1169636162 20:7694151-7694173 AGGGAGAAATGGCTGGTGAGTGG + Intergenic
1170029687 20:11931860-11931882 CTAGAGAACAGGCTGGACAGGGG - Intergenic
1172049183 20:32103295-32103317 CTGGAGATATGGCTGCTGAGAGG + Intergenic
1172327189 20:34045464-34045486 CAGGAGATAAGGTTGGAGAGTGG + Intronic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1172957436 20:38771108-38771130 CAGGAGAAATGGCAGCAGAGAGG - Intronic
1173193904 20:40897809-40897831 ATGGAGAATCGGTTGGACAGAGG + Intergenic
1173777787 20:45725341-45725363 CAGGAGAACTGGCTGGAGAGTGG + Intronic
1174509009 20:51036996-51037018 ATGGAGAAAGGGCTGTGGAGGGG + Intergenic
1174893251 20:54420809-54420831 GTGGTGTAATGGCTGGAGAGAGG + Intergenic
1175696422 20:61106198-61106220 CTGGCAGAAAGGCTGGAGAGAGG + Intergenic
1175872335 20:62214401-62214423 CTGGACAAAGGCCTGGAGGGGGG - Intergenic
1175890532 20:62313947-62313969 ATGGAGAGACGGGTGGCGAGTGG + Intronic
1177867035 21:26524844-26524866 CTGGAAATAAGGCTGTAGAGGGG - Intronic
1178826826 21:36024319-36024341 CAGGGGAAACGACTGGAAAGAGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1180857763 22:19059093-19059115 CTGGAGAAGAGGCTGGGGAGTGG + Intronic
1182250690 22:28997661-28997683 ATGGAGAAACGGAGGCAGAGAGG - Intronic
1182500282 22:30741690-30741712 CTGGGGAAACGGCTGGCTTGAGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183041046 22:35178270-35178292 CTGGGGACACGGCAGTAGAGGGG - Intergenic
1183464575 22:37973275-37973297 CAGGAGAACAGGCTGGACAGAGG - Exonic
1183588253 22:38765693-38765715 CTGGAGAAAAGGTAGGAAAGGGG + Intronic
1183730228 22:39614439-39614461 CTGAAGCAAGAGCTGGAGAGAGG - Intronic
1183960320 22:41407706-41407728 CTGTTGACACGGCTGGAGTGTGG + Intergenic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1184173892 22:42775120-42775142 ATGGAGAAACAACTGGAGACTGG + Intergenic
951810143 3:26689609-26689631 ATGGAGAAAGAGCAGGAGAGAGG - Intronic
952123276 3:30270072-30270094 ATGGAGAAACTTTTGGAGAGCGG + Intergenic
952762062 3:36923674-36923696 CTGGAGAAAGGGAAAGAGAGAGG - Intronic
952989812 3:38821839-38821861 CTGGAGAATGTGCTGCAGAGTGG - Intergenic
953007073 3:38988519-38988541 ATGGAGTAAGGGCTGGACAGGGG - Intergenic
953211875 3:40883042-40883064 ATGGAGGAACAGCTGGTGAGTGG + Intergenic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953871748 3:46633041-46633063 CTGCAGCCAAGGCTGGAGAGGGG - Intergenic
954852372 3:53614448-53614470 CTGGAGAAAGTGCTGGCCAGTGG + Intronic
955144320 3:56300871-56300893 CAGGAGAAAAGGATGGGGAGGGG + Intronic
956641204 3:71417142-71417164 GTGGAGCTGCGGCTGGAGAGAGG + Intronic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960484525 3:118235295-118235317 CATGAGCAAGGGCTGGAGAGAGG - Intergenic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961490558 3:127254210-127254232 CTGGAGACACTGCTGAAAAGGGG + Intergenic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961513381 3:127418168-127418190 CTGGAGACTTGGCTGGAAAGGGG + Intergenic
964748401 3:160032858-160032880 CTGGAGAACCTGCTGGAAAACGG - Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966516882 3:180829194-180829216 GTGGAGGAGCCGCTGGAGAGGGG - Intronic
966961262 3:184941645-184941667 CTGGAGAAAGGGCTGAGAAGTGG - Intronic
967220821 3:187246587-187246609 ATAGAGAAAGGGCTGGGGAGTGG - Intronic
967220970 3:187247847-187247869 ATAGAGAAAGGGCTGGGGAGTGG - Intronic
967236254 3:187386287-187386309 ATGGAGAAACTGTTGGGGAGTGG - Intergenic
974471632 4:62326171-62326193 ATGGAGAAACAGCTGGCCAGTGG - Intergenic
981728632 4:147873906-147873928 CTGGAGAAATGGAAGGCGAGAGG + Intronic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
984610944 4:181836340-181836362 CTGGAGGTAGGGGTGGAGAGTGG - Intergenic
984899141 4:184569205-184569227 ATGGAGAAATGGCTGGGCAGGGG + Intergenic
985706426 5:1403823-1403845 CAGGAGAAGCCTCTGGAGAGTGG - Intronic
985956247 5:3268268-3268290 CAGGAGGCAGGGCTGGAGAGAGG - Intergenic
992881481 5:81114629-81114651 CAGGAGCAGGGGCTGGAGAGGGG - Intronic
993787312 5:92159247-92159269 GTGGGGAAACGGCTGGTCAGTGG - Intergenic
997672018 5:135683037-135683059 CTGGAGAAGCCTCTGGAGGGTGG + Intergenic
998154546 5:139777107-139777129 CTGGAGAAAAGGCTGGAATGGGG - Intergenic
1000232893 5:159331809-159331831 CGAGACAAACGGCTGGAGGGAGG - Intergenic
1001781646 5:174374022-174374044 CCAGAGAAAAGGTTGGAGAGTGG + Intergenic
1001844532 5:174910291-174910313 CTGGGGAGTGGGCTGGAGAGTGG - Intergenic
1002433887 5:179219889-179219911 CTGCAGAGGCCGCTGGAGAGTGG - Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1002860017 6:1072035-1072057 GAGGAGAGAGGGCTGGAGAGTGG + Intergenic
1003707909 6:8555302-8555324 CTGGAGGACCGCATGGAGAGAGG + Intergenic
1003774953 6:9349929-9349951 CAGGAGAGAAGGATGGAGAGTGG - Intergenic
1004257692 6:14080098-14080120 CTGGGAAAAAGGCTGGGGAGTGG + Intergenic
1005224506 6:23626206-23626228 CTGGGGAAAGGGCTAGAGTGTGG - Intergenic
1007367112 6:41402685-41402707 GTGGAGAAATGACTGGATAGAGG - Intergenic
1008441237 6:51533976-51533998 CTGGAGCAATGGCTGGAATGGGG - Intergenic
1008541006 6:52546423-52546445 GTAGAGAAAGGGCTGGAGACGGG + Intronic
1011106821 6:83791224-83791246 CTGGAGAAACTGTTGGAAATGGG + Intergenic
1013500752 6:110748785-110748807 TTGGAGGAACTCCTGGAGAGGGG - Intronic
1013632965 6:112002678-112002700 ATGGAGAAGAAGCTGGAGAGAGG + Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1016194321 6:141314420-141314442 CTGAAGAAAACACTGGAGAGAGG - Intergenic
1016933413 6:149430321-149430343 CTGGAGAAAGCGCTGGAAAAGGG + Intergenic
1017815303 6:158011985-158012007 CTGCAGACAGGGCTGCAGAGAGG - Intronic
1018222355 6:161593644-161593666 CTGAGGAACCGGCTGGACAGTGG + Intronic
1018730563 6:166646840-166646862 CAGGAGAACTTGCTGGAGAGGGG - Intronic
1019191328 6:170252673-170252695 ATGGAGCAAAGGCTGGAGAAAGG - Intergenic
1019535905 7:1529908-1529930 GTGGAGGACAGGCTGGAGAGGGG - Intergenic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1022047503 7:26633873-26633895 CTGGAGGAAAGGCTGGGAAGGGG + Intergenic
1022325481 7:29327139-29327161 GTGGAGATAATGCTGGAGAGAGG + Intronic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1022960206 7:35419071-35419093 CTGCAGAAAGGGGTGGACAGAGG - Intergenic
1023161545 7:37301563-37301585 TGAGAGAAAGGGCTGGAGAGGGG - Intronic
1023488737 7:40714534-40714556 GGGGAGTAAGGGCTGGAGAGAGG - Intronic
1023820402 7:43977450-43977472 CTGGAGGAAGGGCTGGGGTGTGG + Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1026461404 7:70618377-70618399 AGGGAGAGACTGCTGGAGAGGGG - Intronic
1026846920 7:73703780-73703802 CTGGAGGACATGCTGGAGAGTGG - Exonic
1027219433 7:76204553-76204575 CTGGAGAATCGGGGGCAGAGTGG - Intronic
1028167607 7:87556606-87556628 CTGGAGCAGAGGCAGGAGAGGGG - Intronic
1029748686 7:102530971-102530993 CTGGAGGAAGGGCTGGGGTGTGG + Intergenic
1029766633 7:102630055-102630077 CTGGAGGAAGGGCTGGGGTGTGG + Intronic
1030898318 7:115089247-115089269 GGGGAGAAACGAGTGGAGAGGGG - Intergenic
1032017108 7:128387356-128387378 CTGCAGGAGTGGCTGGAGAGAGG - Intergenic
1032360398 7:131249819-131249841 CAGGAGATGCTGCTGGAGAGGGG + Intronic
1033411252 7:141119701-141119723 ATGGAGGAAAGGCTGGAGAAGGG + Intronic
1033543820 7:142381652-142381674 CTGGAGGAAACCCTGGAGAGAGG - Intergenic
1033764046 7:144468305-144468327 TTGGAGACAGGGATGGAGAGTGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033966891 7:146986148-146986170 ATGGAGAAAGGGTGGGAGAGGGG - Intronic
1034392824 7:150800098-150800120 CCAGAAAAACGGCTGGAGAGCGG - Intronic
1034686809 7:152979090-152979112 CTGGAGGAAGGGCCAGAGAGGGG + Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035312144 7:157976122-157976144 CTGGTGAAACGCCGGGAAAGGGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038053021 8:23831187-23831209 CGGGAGAAAGAGCTAGAGAGGGG + Intergenic
1038678720 8:29647139-29647161 CAAGGGAAATGGCTGGAGAGGGG + Intergenic
1038885547 8:31659053-31659075 CATGAGAAACATCTGGAGAGTGG - Intronic
1041170893 8:55141280-55141302 CAGGAGATGCGTCTGGAGAGGGG - Intronic
1049424745 8:142533024-142533046 CTGGGGCAAGGGCTTGAGAGGGG + Intronic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1051298241 9:15619084-15619106 TTGGAAGAACGGCTGGACAGAGG - Intronic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053010217 9:34628752-34628774 CGGGAAAAACAGCCGGAGAGAGG + Intergenic
1053086921 9:35232856-35232878 CTGGAGTAGAAGCTGGAGAGTGG + Intronic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1053440201 9:38109719-38109741 CTGGAGGACAGGCTGAAGAGAGG + Intergenic
1053549795 9:39064460-39064482 CTGGAGAAACAGCTAGACACAGG - Intergenic
1053813906 9:41884555-41884577 CTGGAGAAACAGCTAGACACAGG - Intergenic
1054616690 9:67302885-67302907 CTGGAGAAACAGCTAGACACAGG + Intergenic
1056455757 9:86757684-86757706 CTGGAGAAAGACCTGGGGAGGGG + Intergenic
1057250995 9:93501720-93501742 CAGGAGACAAGCCTGGAGAGAGG + Intronic
1059387392 9:113975126-113975148 TTGGAGAGAGGGCTGGAGGGAGG + Intronic
1059414978 9:114156701-114156723 CGGGAGACAGGGCCGGAGAGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059989440 9:119851268-119851290 CTGGAGAAAAGGCAAGTGAGGGG + Intergenic
1060804197 9:126564474-126564496 CTGGGGACATGGCTGGACAGTGG - Intergenic
1060972744 9:127748150-127748172 CTGGAGAATGGTCTGGGGAGAGG + Intronic
1061588416 9:131583243-131583265 CAGGAGAAGAGGCAGGAGAGGGG - Intronic
1061791338 9:133060839-133060861 CTGGGGAAAGGACTGGAGGGTGG - Intergenic
1061795016 9:133081406-133081428 CTGGGGAAAGGACTGGAGGGTGG - Intronic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1062539199 9:137034257-137034279 CTTGTGCAACGGCTGGAGGGAGG + Intronic
1188073601 X:25748317-25748339 CTGGAGAAAGGACTGGATAGAGG - Intergenic
1189097753 X:38158084-38158106 CTGGGGAAAGGGGTGCAGAGAGG + Intronic
1189850658 X:45173315-45173337 CCTGAGAAAAGGCTGGATAGAGG + Intronic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190474646 X:50814201-50814223 CTGGAGAAAGGGGGAGAGAGGGG + Intronic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1192495610 X:71615045-71615067 CTGCAGAAACGGCCGGAGATGGG - Intergenic
1192550919 X:72052801-72052823 GTGAAGAAAGGGGTGGAGAGAGG - Intergenic
1192554909 X:72081596-72081618 GTGGAGAATGGGCTGGAGAGTGG - Intergenic
1193144140 X:78059970-78059992 CTGGAGAAATACCTGGAGGGAGG - Intergenic
1195625039 X:106999250-106999272 CTGGGGAAAGGTCTGGAAAGCGG - Intronic
1199600924 X:149540598-149540620 TGGGAGAAACCGCTGGGGAGGGG - Intronic
1202358328 Y:24075251-24075273 GTGGAGAGACGGCTTTAGAGTGG - Intergenic
1202377489 Y:24250517-24250539 CTGGAGAAAAGGAGGGGGAGAGG + Intergenic
1202493292 Y:25419605-25419627 CTGGAGAAAAGGAGGGGGAGAGG - Intergenic
1202512450 Y:25594862-25594884 GTGGAGAGACGGCTTTAGAGTGG + Intergenic