ID: 1100628146

View in Genome Browser
Species Human (GRCh38)
Location 12:96358302-96358324
Sequence ACAGATATGCAGATTATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100628146 Original CRISPR ACAGATATGCAGATTATGCA GGG Intronic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
906513737 1:46425908-46425930 AGAGCTGTGCAGACTATGCAGGG + Intergenic
906996004 1:50795091-50795113 ACAGAGATGGAGGTTAAGCATGG + Intronic
909263451 1:73525913-73525935 ACAGATATGTAGAATAAACAAGG - Intergenic
910155888 1:84219016-84219038 ACTAATATGCAGAATATACAAGG - Intronic
910762542 1:90748486-90748508 ACACATATTCAGATTATTCTTGG - Intergenic
914533258 1:148542182-148542204 ACAAATACGCAGATTGTTCATGG + Intronic
917242444 1:172963330-172963352 GAAGATATACAGATTAAGCAGGG + Intergenic
917452011 1:175155115-175155137 GCAGATTTGCAGATTAGGCAAGG - Intergenic
919430293 1:197484105-197484127 ACAGGTATTAAGATTATGCATGG - Intergenic
920448291 1:206037016-206037038 ACAGATTTCTAGATTGTGCAAGG + Intergenic
921063964 1:211609670-211609692 ACAGCTATGCAGAGAAGGCAGGG - Intergenic
921957720 1:221001417-221001439 ACAAATATACACATTATGCCTGG + Intergenic
922662926 1:227446008-227446030 AGAGAACTGCAGGTTATGCAAGG + Intergenic
923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG + Intergenic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
923909497 1:238425063-238425085 TCGGATATACAGATCATGCATGG - Intergenic
924064878 1:240210720-240210742 ACAACTTTGCAGATTATTCATGG - Intronic
924425486 1:243946286-243946308 AGAGAAATGCAGATTCTCCATGG + Intergenic
1063259494 10:4369662-4369684 ACAGAAATGCAAATAATCCAAGG + Intergenic
1063279497 10:4610648-4610670 ACAGATAGAAATATTATGCAAGG + Intergenic
1066284777 10:33954083-33954105 TCACATATGCAGAATATGAAAGG + Intergenic
1067807855 10:49405689-49405711 ACAGATATGCAGATGTGGAAGGG - Intergenic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1068252813 10:54466084-54466106 ACTAATATCCAGATTATACAAGG - Intronic
1068873270 10:61968495-61968517 AAAGAAATGCAAATTCTGCAGGG - Intronic
1068924672 10:62523505-62523527 ACAGAAATACAGATAATTCAGGG - Intronic
1069790707 10:71018713-71018735 ACAGGGATGGAGGTTATGCATGG - Intergenic
1073508703 10:104027377-104027399 ACATATATACATATTATGTATGG + Exonic
1073689207 10:105788707-105788729 ACTAATATCCAGAATATGCAAGG + Intergenic
1074632408 10:115273199-115273221 GCAGGGATGGAGATTATGCATGG - Intronic
1075253873 10:120908571-120908593 CTATATATGCAGATTATGCCCGG + Exonic
1076482845 10:130796174-130796196 ACAGATATGAAGTCTCTGCAGGG - Intergenic
1078527880 11:12114136-12114158 ACAGTTATTGAGATTATGCCTGG + Intronic
1079685019 11:23348588-23348610 ACACAAATTCAGATTATGCGTGG + Intergenic
1079856135 11:25607717-25607739 ACAGAAATACAGATTATTCAAGG - Intergenic
1079949088 11:26779615-26779637 ACAGTTACTCAGTTTATGCAGGG - Intergenic
1080394687 11:31879105-31879127 ACAGATATAGAGCATATGCATGG - Intronic
1080894270 11:36436076-36436098 AAAGATGTGCAGATTTTGAAAGG - Intronic
1081271528 11:41090209-41090231 AGAGATATAAAGAGTATGCATGG + Intronic
1081512522 11:43790319-43790341 AAAAATATGCAGCTGATGCAAGG + Intronic
1082728219 11:56763080-56763102 ACAAATATATATATTATGCAAGG - Intergenic
1083557352 11:63641308-63641330 ACATATATGTAGATTATGAATGG - Intronic
1083689926 11:64401308-64401330 GCAGAGATGGAGGTTATGCAGGG + Intergenic
1086141511 11:83505356-83505378 GCAGGGATGGAGATTATGCATGG - Intronic
1087341614 11:96914304-96914326 ACAGAAAAGCAGATGAGGCATGG - Intergenic
1087526620 11:99321854-99321876 GCAGAGATGGAGGTTATGCATGG - Intronic
1092715710 12:11388147-11388169 ACTAATATGCAGAGTATACAAGG + Intronic
1093698605 12:22191860-22191882 ACAGGCATGGAGGTTATGCATGG + Intronic
1093796019 12:23312114-23312136 ACAGCTATGTAGAGTTTGCATGG - Intergenic
1094795660 12:33969162-33969184 ACTGATATCCAGAATATACAAGG + Intergenic
1095911897 12:47436028-47436050 ACTAATATCCAGAATATGCAAGG + Intergenic
1097114289 12:56686274-56686296 ACAGATTTTCAGAGTATGAAAGG + Intronic
1097698076 12:62794036-62794058 ACAAATAATCAGATTCTGCATGG + Intronic
1097833241 12:64247719-64247741 ACTGATATCCAGAATATACAAGG - Intergenic
1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG + Intronic
1098714497 12:73812752-73812774 ACACAGATGGAGGTTATGCATGG + Intergenic
1098937908 12:76501643-76501665 ACAGGGATGGAGGTTATGCATGG + Intronic
1099275981 12:80576618-80576640 ACAGATAAGCATATAATGCCTGG - Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1101502426 12:105316597-105316619 TCATATAAGCAGATTCTGCAGGG + Intronic
1101852533 12:108415601-108415623 GCAGAGATGGAGATGATGCATGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105810564 13:23991646-23991668 ACAAATGTGCACAATATGCACGG - Intronic
1107415486 13:40196100-40196122 ACAGATTTGGAGAAAATGCAGGG + Intergenic
1107983458 13:45755115-45755137 GCAGAGATGGAGGTTATGCATGG - Intergenic
1111043027 13:82776089-82776111 ACAGATTTTCAGTTTATGAAAGG + Intergenic
1111109098 13:83684306-83684328 ACAAATGTGCAGATTCTGCCAGG - Intergenic
1111347852 13:86985286-86985308 ACATATATCCTGATTATACAAGG + Intergenic
1113803353 13:113097737-113097759 ACAAAGATGCAGTTTCTGCAGGG + Intronic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1114965524 14:27954831-27954853 ATAGAAATGGAGATTATACATGG - Intergenic
1115614421 14:35080188-35080210 ACAGATGTACAGATTTTGAAAGG - Intronic
1116159255 14:41247913-41247935 ACAGAAATGCTAATTATGTAGGG + Intergenic
1116249165 14:42458481-42458503 GCAGAGATGGAGATTATGCATGG + Intergenic
1116747384 14:48837975-48837997 ACTAATATCCAGAATATGCAAGG + Intergenic
1116928047 14:50661327-50661349 ACTAATATCCAGAATATGCAAGG - Intronic
1117216971 14:53561021-53561043 ACAGGGATGGAGGTTATGCATGG + Intergenic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1117965528 14:61203401-61203423 ACAGAGAAGCAGATAATGCCAGG + Intronic
1118338079 14:64871777-64871799 ACATATATCCATATTATACAAGG - Intronic
1120031161 14:79642612-79642634 ACAGATAAGGAGATCTTGCAGGG - Intronic
1120896021 14:89533365-89533387 TCAGATATGCAGATTCTGGCTGG + Intronic
1121784267 14:96643642-96643664 ACTAATATCCAGAATATGCAAGG - Intergenic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1126757812 15:51941375-51941397 ACAGTTATGAAGATAAGGCAGGG + Intronic
1126897885 15:53279523-53279545 ATACATGTGCAGAATATGCAGGG + Intergenic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1129071150 15:72952671-72952693 ACAGATGTGCAGCTTCTCCAGGG - Intergenic
1131005700 15:88976004-88976026 ACTAATATGCAGAATATACAAGG - Intergenic
1132315969 15:100890799-100890821 ACAGATATGCAGATACTGTCTGG + Intronic
1132364072 15:101243311-101243333 AGCGATATGCAAATTATGAAAGG - Intronic
1134812751 16:17181304-17181326 ACAGAAATGCAGATTGGGCAGGG - Intronic
1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG + Intronic
1137964372 16:52916091-52916113 ACAATTATGCAGATTAGGCCGGG - Intergenic
1140398715 16:74651963-74651985 ACAGCTCTGCAGAGTATGGAGGG - Exonic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1148763410 17:50021428-50021450 GCACATCTGCAGATTGTGCAAGG - Intergenic
1148985847 17:51620438-51620460 ACAGACATTCAGATTAGGCCAGG + Intergenic
1151243472 17:72776185-72776207 ACAGATGTTTAGATTCTGCAGGG + Intronic
1153269202 18:3302813-3302835 ACTAATATGCAGAATATACAAGG + Intergenic
1155834866 18:30568486-30568508 ACAAAGATAGAGATTATGCATGG + Intergenic
1156118558 18:33816567-33816589 GCAGGGATGGAGATTATGCATGG + Intergenic
1156686402 18:39652661-39652683 ATAGATAAGTAGATTATGGAAGG + Intergenic
1158026477 18:52903754-52903776 ACAGATATGAGGCTTATGTAGGG - Intronic
1159272379 18:66169151-66169173 ACAGGGGTGGAGATTATGCATGG - Intergenic
1159293415 18:66451147-66451169 ATAGATGTGCAGATTATGCATGG - Intergenic
1160127200 18:76186488-76186510 ACACATATGCAGACTATGAAAGG + Intergenic
1163177015 19:15571508-15571530 ATAGATATGTAGATGATGGATGG - Intergenic
1165155440 19:33784330-33784352 ACAGGGATGGAGGTTATGCATGG + Intergenic
1168612104 19:57809576-57809598 AGAGATGTGAAGATTATTCAGGG + Intronic
926473770 2:13295695-13295717 ACAAAAATGAAAATTATGCAAGG + Intergenic
927448119 2:23183824-23183846 ATAGATATGCAGATTATCACTGG + Intergenic
928052499 2:28013965-28013987 ACAAATATGCAGCTCATGCTTGG - Intronic
929052531 2:37850161-37850183 ACAGATAGCCTGATGATGCAAGG + Intergenic
929727734 2:44448175-44448197 TCATATATGCAGTTTCTGCAGGG - Intronic
930626798 2:53707663-53707685 AAAGAAATGCAGAGTATGCCGGG + Intronic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
933058959 2:77711151-77711173 TCAGATAAGAAGATCATGCATGG - Intergenic
933083287 2:78022187-78022209 ACTAATATTCAGAATATGCAAGG - Intergenic
933265572 2:80177531-80177553 ACAGAGATGGAGGTTATGCATGG - Intronic
934020291 2:87943518-87943540 ACTGATATCCAGAGTATACAAGG - Intergenic
935699861 2:105802099-105802121 TCAGATTTGCAGACGATGCATGG + Intronic
935764666 2:106354238-106354260 ACTAATATCCAGATTATACAAGG - Intergenic
936363134 2:111825404-111825426 ACCCATATGCAGGTTCTGCAGGG - Intronic
936785496 2:116089630-116089652 ACTAATATGCAGAATATACAAGG - Intergenic
937520250 2:122705351-122705373 GCGGAGATGGAGATTATGCATGG - Intergenic
937798665 2:126055792-126055814 ACAGAAATACAGATCATTCAAGG - Intergenic
937896901 2:126983592-126983614 ATAGTTTTGGAGATTATGCAAGG + Intergenic
938760570 2:134422034-134422056 ACAGATGTGCACATCATGCCTGG - Intronic
939213989 2:139213081-139213103 GCAGGGATGGAGATTATGCATGG + Intergenic
939276496 2:140004554-140004576 ACTAATATCCAGAATATGCAAGG + Intergenic
939444575 2:142292191-142292213 ACAAATATCCAAATTATGCCTGG - Intergenic
940206427 2:151207476-151207498 ACAGATTTGCAGATTTTCAAAGG - Intergenic
940521723 2:154759112-154759134 ACAGATATGAACATTATAAATGG - Intronic
941467647 2:165848850-165848872 ACTAATATCCAGAATATGCAAGG - Intergenic
941724254 2:168844249-168844271 ACAGCCACGCAGCTTATGCACGG + Intronic
942478094 2:176350696-176350718 ACTAATATTCAGAATATGCAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944437550 2:199706390-199706412 ACAGAGATAGAGGTTATGCATGG - Intergenic
944964984 2:204920928-204920950 ACATATAGGAATATTATGCATGG - Intronic
945313472 2:208343297-208343319 AAAGATATTCAGATTGTACAAGG - Intronic
948028489 2:234797748-234797770 ACAGCAATGGAGACTATGCATGG + Intergenic
1170896092 20:20415841-20415863 ACAGCTCTGCAGATTCAGCAGGG - Intronic
1173066524 20:39718356-39718378 ACAGCTATGCAGACTACTCAGGG - Intergenic
1173215360 20:41076910-41076932 ACAGATATACAGAGTATCTATGG - Intronic
1173407124 20:42776086-42776108 ACAGATTTGTAGCTTAAGCAAGG - Intronic
1175780315 20:61678222-61678244 ACAGATACATAGATTATGGATGG + Intronic
1176918762 21:14660238-14660260 AGAGATATCCAGAATATGTAAGG - Intergenic
1177731030 21:25026585-25026607 GCAGAGATGGAGGTTATGCATGG + Intergenic
1179308947 21:40180021-40180043 ACACAGATTCAGATTATCCATGG - Intronic
1179457977 21:41512739-41512761 GCAGGGATGGAGATTATGCATGG - Intronic
1183065694 22:35361213-35361235 AAAGAAATGGAGATTTTGCAGGG + Intergenic
1183814646 22:40289464-40289486 ACAGATCATCATATTATGCAAGG - Intronic
1183822999 22:40362045-40362067 ACAGATAGCCAGTTTATGAAAGG + Intronic
950921028 3:16695013-16695035 ACAGAGCTGCAGATAAGGCATGG - Intergenic
951873142 3:27388980-27389002 AGAGATATGGAGATGATTCAAGG - Intronic
951947988 3:28164069-28164091 ACAAATATCCAGAATATACAAGG + Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
955418517 3:58715016-58715038 ACAGGGATGGAGGTTATGCATGG - Intergenic
955702364 3:61694566-61694588 AGAGATATGCAGTTTTTCCATGG - Intronic
957476468 3:80731464-80731486 ACATATAAGCAGATAATACAAGG - Intergenic
957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG + Intergenic
958062187 3:88497581-88497603 ACAGAAATGCACATTAAACAAGG - Intergenic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
960013864 3:112863105-112863127 ACTAATATGCAGAATATACAAGG - Intergenic
961089723 3:124100259-124100281 ACTGATATCCAGAATATACAAGG - Intronic
962823520 3:139076560-139076582 ACAAATATTCAGAATATACAAGG + Intronic
963369182 3:144376209-144376231 ATAGAAATGAAGATAATGCATGG - Intergenic
963688697 3:148471409-148471431 GCAGAAATGGAGATTATGCATGG - Intergenic
965075512 3:163969913-163969935 ACTGATATTCAGAATATACAAGG + Intergenic
966457938 3:180139455-180139477 ACAGTTCTGCAGATTATACAAGG + Intergenic
969262863 4:6044548-6044570 ACAGATAAGCATATTTTGGATGG + Intronic
969382283 4:6810691-6810713 ACTGATATCCAGAATATACAAGG + Intronic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
974336546 4:60553805-60553827 AGAGCTATGCAGTTTATCCAAGG + Intergenic
976105435 4:81612354-81612376 AGAGGTATGCAGAAGATGCAGGG + Intronic
978142668 4:105335412-105335434 ACAGGTCTGCAGATCATGGAAGG + Intergenic
978758646 4:112331146-112331168 ACAAAGATGAAGGTTATGCATGG - Intronic
979035694 4:115713987-115714009 AAAAATATGCAGATTATTCTAGG - Intergenic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
980569849 4:134600440-134600462 ACAGATTTGCAGAGTGAGCAGGG + Intergenic
981140948 4:141268584-141268606 ACACATAAGCAGAATATGTATGG + Intergenic
983542209 4:168923789-168923811 ACAAATATTCAGAATATTCATGG + Intronic
984077063 4:175196697-175196719 GTAGATATGCATATAATGCAAGG - Intergenic
984473727 4:180211649-180211671 ACAGATATCTAGAATATACAAGG + Intergenic
985991157 5:3562855-3562877 ACTAATATCCAGAATATGCAAGG - Intergenic
986759272 5:10865048-10865070 ACTGATATACACATTAAGCAAGG - Intergenic
986917760 5:12644101-12644123 ACTAATATCCAGATTCTGCAAGG + Intergenic
987153305 5:15062511-15062533 GCAGGGATGGAGATTATGCATGG + Intergenic
987349512 5:17009372-17009394 ACAGATACACAGATGATGGATGG - Intergenic
988153778 5:27422341-27422363 ACAGAAATGGACGTTATGCATGG - Intergenic
989080152 5:37609998-37610020 ACAGATATATAGATTGGGCACGG + Intronic
989210987 5:38858980-38859002 ACTAATATCCAGAATATGCAAGG - Intronic
989307383 5:39973779-39973801 ACAGGGATGGAGGTTATGCATGG - Intergenic
990132054 5:52597787-52597809 ATGAATATTCAGATTATGCATGG + Intergenic
993035841 5:82756391-82756413 AATGATCTGCAGATGATGCAGGG + Intergenic
993841929 5:92890686-92890708 ACAGACATGCTTATTATGGATGG - Intergenic
994146253 5:96399083-96399105 GCAGATATGCATAAAATGCAAGG - Intronic
994271981 5:97788737-97788759 TCAGATAGGTAGATTATGAAAGG + Intergenic
994765910 5:103918331-103918353 ACAGATTTGTACATTATGTAAGG - Intergenic
995188144 5:109292269-109292291 ACACATAATCAGATTATCCAAGG + Intergenic
996561509 5:124834577-124834599 ACAGAAATACAGATCATTCAAGG + Intergenic
997215206 5:132104198-132104220 ACAGAGATGCAGATGCTCCAAGG - Intergenic
1001364929 5:171127476-171127498 ACTTATATCCAGAATATGCAAGG + Intronic
1004729002 6:18339605-18339627 ACAGATTTGCAGATAAATCATGG + Intergenic
1004781474 6:18913320-18913342 ACAGATGTGAGGATCATGCAGGG + Intergenic
1005126446 6:22451500-22451522 ACAGATATCCAAACTATACAAGG + Intergenic
1005778603 6:29164565-29164587 ACATGTATGCAGTTTATTCAAGG - Intergenic
1009500665 6:64408603-64408625 ACAGAAATACATGTTATGCAGGG - Intronic
1012563645 6:100618561-100618583 AAAGAGATGAAAATTATGCATGG + Intronic
1014446529 6:121534555-121534577 ATAGGGATGGAGATTATGCATGG - Intergenic
1015862160 6:137692326-137692348 GCAGGGATGGAGATTATGCATGG + Intergenic
1015987752 6:138901591-138901613 ACAGATATGCAAAGGATGCTTGG + Intronic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1018422889 6:163654646-163654668 GCAGAGATGGAGACTATGCATGG - Intergenic
1018497626 6:164366163-164366185 CCAGTTCTACAGATTATGCAGGG + Intergenic
1019967968 7:4515705-4515727 ACATATATGCAGATGATTCTGGG + Intergenic
1020775491 7:12449507-12449529 ACTGATATTCAGAATATACAAGG + Intergenic
1021226128 7:18028342-18028364 ATAAATATGTAGATTTTGCATGG + Intergenic
1021496673 7:21282744-21282766 AAAGATTTCCAGAGTATGCATGG - Intergenic
1023303584 7:38799568-38799590 ACAGAAAGGCACATTATTCATGG + Intronic
1028529388 7:91821753-91821775 ACAGAAATACAGATCATTCAAGG - Intronic
1031238466 7:119208495-119208517 ACTAATATCCAGAATATGCAAGG + Intergenic
1032264042 7:130358287-130358309 ACACATATGCAGGTTGGGCATGG - Intronic
1033676861 7:143550193-143550215 ACTAATATCCAGAATATGCAAGG - Intergenic
1033694974 7:143779242-143779264 ACTAATATCCAGAATATGCAAGG + Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1036451109 8:8868514-8868536 ACAGATATGCACAGTAGGCCTGG + Intronic
1036997901 8:13680433-13680455 ATAGATATGTGGATAATGCATGG - Intergenic
1037276182 8:17182085-17182107 ACAGATATATGGACTATGCAAGG - Intronic
1037747964 8:21661813-21661835 ACCGTTAGGCAGATTCTGCATGG - Intergenic
1037780318 8:21863975-21863997 ACAGAAGTGCAGATTAGACATGG + Intergenic
1038682566 8:29682829-29682851 ACTAATATCCAGAATATGCAAGG - Intergenic
1040409074 8:47136504-47136526 ACTAATATGCAGAGTATACAAGG - Intergenic
1041001030 8:53453550-53453572 ACAGATAAGTAGATTATTGATGG - Intergenic
1041887063 8:62822436-62822458 ACATACATGCTGATTTTGCATGG + Intronic
1042015882 8:64310554-64310576 ACAAATATCCAGAATCTGCAAGG + Intergenic
1042702391 8:71629989-71630011 ACAGATATACAGATAATATATGG - Intergenic
1046327600 8:112670559-112670581 AGAGATAGGCAGAATATACAAGG + Intronic
1047011836 8:120681202-120681224 ACCAATATGCAAATTATGCAAGG + Intronic
1047118966 8:121878884-121878906 AAAGATATTCAGATTATGTTTGG + Intergenic
1047552989 8:125897000-125897022 ACAGTTATGCAGTTTATGGTTGG - Intergenic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1048699067 8:137066309-137066331 ACTGAAATGCAGTTTATGTAAGG - Intergenic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1051803102 9:20959416-20959438 ACTAATATCCAGAATATGCAAGG - Intronic
1052634581 9:31085784-31085806 ACAGGACTGCAGATTTTGCAGGG - Intergenic
1055903819 9:81270350-81270372 ACAGGGATGGAGGTTATGCATGG - Intergenic
1056898705 9:90578136-90578158 GCAGGTTTGCAGATTATACACGG - Intergenic
1059361668 9:113747317-113747339 ATAGATATGTAGATAATGGATGG - Intergenic
1061374917 9:130218363-130218385 ACACATATGCACACAATGCATGG + Intronic
1061835047 9:133323295-133323317 AAAGACAAGCAGACTATGCATGG + Intergenic
1187007912 X:15250083-15250105 ACAGCTTTGCAAGTTATGCAGGG + Intronic
1187074004 X:15915987-15916009 CCAAATATGCAGGGTATGCAAGG - Intergenic
1187451303 X:19399058-19399080 ACAGAAGTGCAGCTTATACACGG + Intronic
1187660047 X:21534814-21534836 ACTAATATCCAGAATATGCAAGG - Intronic
1189274082 X:39772238-39772260 ACAGAGTTGCAGATTCTGCAAGG - Intergenic
1189372931 X:40444346-40444368 ACAGATAAGCAGATTAGGACTGG + Intergenic
1189964093 X:46353949-46353971 CCAGAGATGGAGTTTATGCATGG - Intergenic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1190616197 X:52235364-52235386 ACAGATATCCAGAATTTACAAGG - Intergenic
1190625241 X:52331031-52331053 GCAGGGATGCAGGTTATGCACGG - Intergenic
1191769382 X:64739256-64739278 GCAGAGATGGAGGTTATGCATGG - Intergenic
1193275949 X:79588344-79588366 ACAGATATCAATACTATGCATGG - Intergenic
1193876134 X:86864765-86864787 ACAGAGATTAAGATTATGCATGG + Intergenic
1194485223 X:94478167-94478189 GCAGGGATGGAGATTATGCATGG + Intergenic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1196856061 X:119985885-119985907 ACTAATATGCAGAATATACAGGG + Intergenic
1197002410 X:121453757-121453779 GCAGAGATGGAGGTTATGCATGG + Intergenic
1198170119 X:134097082-134097104 ACAGGGATGGAGGTTATGCATGG + Intergenic
1199124232 X:144095610-144095632 ACTGATATCCAGAGTATACAAGG + Intergenic
1199492356 X:148414519-148414541 AAAGATATGGAGATTAAGGAGGG - Intergenic
1200031562 X:153300746-153300768 ACTGATATCCAGAATATACAAGG + Intergenic
1200745937 Y:6904029-6904051 GCAGGTATGGAGGTTATGCAGGG - Intergenic
1200887974 Y:8290578-8290600 ACAGATATGCACAGTAATCAAGG + Intergenic
1202071481 Y:20996234-20996256 CCAAATATGCAAAATATGCAAGG + Intergenic