ID: 1100632138

View in Genome Browser
Species Human (GRCh38)
Location 12:96399946-96399968
Sequence GTCCGCGCCGCGCTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100632138_1100632148 24 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632148 12:96399993-96400015 AGCGGGGACCGCGGGTCCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1100632138_1100632144 8 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632144 12:96399977-96399999 CCAACTCACCAGCAAGAGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 76
1100632138_1100632141 6 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632141 12:96399975-96399997 CGCCAACTCACCAGCAAGAGCGG 0: 1
1: 0
2: 1
3: 6
4: 73
1100632138_1100632149 29 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632149 12:96399998-96400020 GGACCGCGGGTCCCGAGGCGAGG 0: 1
1: 0
2: 1
3: 8
4: 116
1100632138_1100632145 15 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632145 12:96399984-96400006 ACCAGCAAGAGCGGGGACCGCGG 0: 1
1: 0
2: 1
3: 9
4: 94
1100632138_1100632142 7 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632142 12:96399976-96399998 GCCAACTCACCAGCAAGAGCGGG 0: 1
1: 0
2: 2
3: 9
4: 157
1100632138_1100632147 16 Left 1100632138 12:96399946-96399968 CCAGGGGAAAGCGCGGCGCGGAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1100632147 12:96399985-96400007 CCAGCAAGAGCGGGGACCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100632138 Original CRISPR GTCCGCGCCGCGCTTTCCCC TGG (reversed) Intronic
901875960 1:12167242-12167264 GCCCGGGCCGCGCTCTCCCGGGG + Intronic
905886900 1:41496534-41496556 ACCCGCGCCTCGCCTTCCCCTGG + Intergenic
906379993 1:45326755-45326777 CGCCGCGCTGCTCTTTCCCCGGG - Intergenic
906551381 1:46668650-46668672 GTCCTCGCGGTGCTTGCCCCTGG + Intronic
1062843711 10:689451-689473 GGCCGGGCCGCGCTGTCACCGGG - Intronic
1067019527 10:42782630-42782652 GTCCGCGCAGTGCGTTCCACCGG - Intergenic
1070570702 10:77637905-77637927 GCCCGCGCCCCGCTCGCCCCGGG + Intronic
1073292392 10:102419655-102419677 GTCCGCGCCGCCCCTCCCCGCGG - Intronic
1083674351 11:64317212-64317234 GTGCCCGCCCCGCATTCCCCGGG + Intronic
1083849022 11:65354755-65354777 GCCCGCGCCGGGCTCTCTCCCGG - Exonic
1083883181 11:65558274-65558296 GCCCGCTCCGCGCCTCCCCCTGG + Intronic
1100632138 12:96399946-96399968 GTCCGCGCCGCGCTTTCCCCTGG - Intronic
1103509791 12:121466803-121466825 GGGCGCGCCGCGCCCTCCCCCGG - Intronic
1104658346 12:130590943-130590965 GTCTGCATCCCGCTTTCCCCTGG - Intronic
1108727631 13:53200391-53200413 CCACGCGCCGCGCTTCCCCCGGG + Intergenic
1113681706 13:112249070-112249092 GTCGGCGGCGCGCTGGCCCCCGG - Intergenic
1113806190 13:113110968-113110990 GCCCGCGCGGCGCTTTCTGCGGG + Intronic
1119046320 14:71321117-71321139 GTCCGCCGCGCGCTCTCCCTGGG - Intronic
1121127438 14:91417395-91417417 GACCCCGCCGCGCTTTCGGCCGG - Intronic
1128774444 15:70309013-70309035 ATCCGCGCCTCAGTTTCCCCTGG - Intergenic
1132482371 16:172953-172975 GTGCGCGCCGACCTTACCCCAGG - Exonic
1132483219 16:176757-176779 GTGCGCGCCGACCTTACCCCAGG - Exonic
1134519243 16:14911268-14911290 CTCCGCCCCACGCTTTCCCGGGG - Intronic
1134706913 16:16309923-16309945 CTCCGCCCCACGCTTTCCCGGGG - Intergenic
1134960627 16:18402201-18402223 CTCCGCCCCACGCTTTCCCGGGG + Intergenic
1137668196 16:50263824-50263846 CTCCACGCCGCGCTTTCCTCAGG + Intronic
1141720018 16:85750885-85750907 GTGCCCGCCGCCCCTTCCCCGGG - Intronic
1142265232 16:89061377-89061399 GTGGGCTCCGCGCTTTCCCTTGG + Intergenic
1143510989 17:7394825-7394847 GCCCGGGCCGCGCTGGCCCCTGG + Exonic
1145197423 17:20907181-20907203 GTGCACGCGGCGCTTTTCCCTGG + Intergenic
1146057657 17:29589310-29589332 GGCCCCGCCGCGCTTACCCGGGG + Exonic
1147132884 17:38419350-38419372 GTCCTCGCCGCGCCGGCCCCGGG - Intergenic
1147153624 17:38532447-38532469 GTCCGGGCCGCCCTCTCCCAAGG + Exonic
1148206496 17:45783444-45783466 ATGCGCGCCCGGCTTTCCCCTGG + Intergenic
1148218112 17:45844965-45844987 GGCCACGCCGTACTTTCCCCCGG - Exonic
1152654237 17:81512628-81512650 GGCCTCGTCGCGCCTTCCCCGGG - Exonic
1158893443 18:61893762-61893784 GCCCGCGCCGCGCGCGCCCCTGG - Intronic
1160499942 18:79396483-79396505 GTCCGCGCCGCGCCCCTCCCTGG - Intronic
1160575642 18:79852254-79852276 GCCCACGCCACGTTTTCCCCGGG - Intergenic
1161068994 19:2251198-2251220 CTCCGCGCCGCGCCTGGCCCTGG + Exonic
1161495051 19:4581848-4581870 CTCCGCGCCGCGGTTGCTCCGGG - Intergenic
1161925211 19:7294390-7294412 ATCCGCGCCGCCTTTTCCCGCGG - Intergenic
1166546918 19:43639581-43639603 GCCCGCGCTGCGCTTTGTCCCGG + Intronic
1167593846 19:50417554-50417576 GGCGGGGCCGGGCTTTCCCCAGG + Intronic
1167752009 19:51387216-51387238 GTCCGCCCTGCTCTTTCCCCAGG + Exonic
928303482 2:30147185-30147207 TTCCTCGCCGCGCTCTTCCCGGG + Intronic
932126120 2:69146862-69146884 GTCCTGGCCACCCTTTCCCCTGG + Intronic
939898876 2:147826880-147826902 GCAAGCGCCGCGCTTACCCCCGG - Intergenic
948661026 2:239506454-239506476 GCCCGCGCCTAGTTTTCCCCGGG + Intergenic
954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG + Intergenic
956141190 3:66148410-66148432 GTCAGCCCCAAGCTTTCCCCAGG - Intronic
963252931 3:143119374-143119396 GTCCGCTCCACGCTTCCCTCGGG - Exonic
963882628 3:150545969-150545991 GGCCGCGTCGCGTTTTCTCCCGG - Intronic
968051707 3:195658686-195658708 GGGCGCGCCGCGCTTCCCACCGG - Intergenic
968104108 3:195989647-195989669 GGGCGCGCCGCGCTTCCCACCGG + Intergenic
968302410 3:197627237-197627259 GGGCGCGCCGCGCTTCCCACCGG + Intergenic
968845811 4:3041063-3041085 GGCCGGGCCTCCCTTTCCCCAGG + Intergenic
983576907 4:169270624-169270646 CTCCGTGCCGCGGTCTCCCCGGG - Intronic
997965575 5:138353173-138353195 GTGTGCGCCCCGGTTTCCCCCGG + Intronic
1001314312 5:170631827-170631849 GTCGGCGCTACTCTTTCCCCTGG - Intronic
1002784996 6:393456-393478 GTCCGCCCCGCGCGGTCCCCTGG - Intronic
1003076762 6:2989151-2989173 GTCGGCGCCGCACTGTCCCCTGG + Intronic
1006114167 6:31766432-31766454 GCCCCAGCCGCACTTTCCCCTGG + Intronic
1007447829 6:41920851-41920873 GTCCGGGCTGCGGGTTCCCCGGG - Intronic
1019414860 7:922499-922521 GACCCCTCCCCGCTTTCCCCAGG + Intronic
1021086050 7:16421600-16421622 GCCCGCTCTGCGCTTCCCCCGGG + Intergenic
1024920275 7:54546712-54546734 GCCGTCCCCGCGCTTTCCCCGGG - Intronic
1030048952 7:105521732-105521754 CCCCGCGCGGCGCTGTCCCCCGG - Intronic
1031531775 7:122885713-122885735 GGCCGCGCCGCGGTTGCACCCGG - Intronic
1033159262 7:138981733-138981755 GGTCCCGCCGCGCGTTCCCCGGG + Intergenic
1038963638 8:32548550-32548572 GTCCGCGCCGCGCTCCCTGCAGG + Intronic
1039868915 8:41529145-41529167 GACCGCCCCGCTCTTCCCCCCGG + Intergenic
1043053326 8:75407845-75407867 TCCCGCGCCGCACTTTTCCCAGG - Intergenic
1044999773 8:97869290-97869312 GAGCGCGGCGCGCTTTCCCCCGG + Intronic
1045115321 8:98974232-98974254 GCGCGCGCCGCGCCTTCCCTCGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1060480434 9:124013982-124014004 GACCGCGCCGCGCTGTGCGCCGG + Exonic
1060535939 9:124388265-124388287 GTCCTGGCCACGCTGTCCCCTGG - Intronic
1062162456 9:135087800-135087822 GCCATCGCCGCGCCTTCCCCGGG - Exonic
1062234353 9:135500848-135500870 GTCCCCTCCGCGCTCGCCCCGGG - Intronic
1062346698 9:136118421-136118443 TCCCGCGCCGCGCGTTGCCCTGG + Intronic
1062633764 9:137479074-137479096 GCCCGCGCCGCGTCTTCTCCAGG - Exonic
1189821630 X:44874029-44874051 GCCGGCGCCGCGCTCGCCCCGGG + Intronic