ID: 1100645313

View in Genome Browser
Species Human (GRCh38)
Location 12:96523087-96523109
Sequence ATATCCATCTAGAACAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100645313_1100645322 28 Left 1100645313 12:96523087-96523109 CCCTGACTGTTCTAGATGGATAT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1100645322 12:96523138-96523160 AGATTGAAAATGAATCTGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 291
1100645313_1100645319 25 Left 1100645313 12:96523087-96523109 CCCTGACTGTTCTAGATGGATAT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1100645319 12:96523135-96523157 TAGAGATTGAAAATGAATCTGGG 0: 1
1: 0
2: 1
3: 26
4: 405
1100645313_1100645321 27 Left 1100645313 12:96523087-96523109 CCCTGACTGTTCTAGATGGATAT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1100645321 12:96523137-96523159 GAGATTGAAAATGAATCTGGGGG 0: 1
1: 0
2: 0
3: 49
4: 281
1100645313_1100645320 26 Left 1100645313 12:96523087-96523109 CCCTGACTGTTCTAGATGGATAT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1100645320 12:96523136-96523158 AGAGATTGAAAATGAATCTGGGG 0: 2
1: 0
2: 2
3: 26
4: 474
1100645313_1100645318 24 Left 1100645313 12:96523087-96523109 CCCTGACTGTTCTAGATGGATAT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1100645318 12:96523134-96523156 GTAGAGATTGAAAATGAATCTGG 0: 1
1: 0
2: 0
3: 17
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100645313 Original CRISPR ATATCCATCTAGAACAGTCA GGG (reversed) Intronic
905306075 1:37019182-37019204 CCATCCATCTAGAAAAGTTAAGG + Intronic
910062388 1:83109617-83109639 ATTTCCATCTAGACAAGTAAAGG - Intergenic
911194614 1:94981163-94981185 CTTTCTTTCTAGAACAGTCAAGG + Exonic
915193391 1:154170922-154170944 AGATCCATCTTAAAAAGTCATGG - Intronic
915246102 1:154557570-154557592 ATATCCATAGGGAACAGGCAGGG + Intronic
916405161 1:164491047-164491069 ATATGCATCAAGAAAAGTCTGGG + Intergenic
916468307 1:165094058-165094080 ACATCCATCAAGAACAATCAGGG + Intergenic
917843603 1:179002504-179002526 AAATCCCTCTGGAACATTCAGGG - Intergenic
918103311 1:181395392-181395414 ATATCCAAGTAGAGAAGTCATGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG + Intergenic
918917190 1:190658357-190658379 TTATCCATCTAGAATTGTTATGG + Intergenic
1063023369 10:2153361-2153383 ATATTCATCTAGGCCAGTCATGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1069270377 10:66519327-66519349 ATATCTAACTACAACAGACAAGG - Intronic
1071171071 10:82864713-82864735 ATATGCACGTAGAACAGACATGG + Intronic
1072776114 10:98196300-98196322 ATATCCCACTGGAACAGTCTAGG - Intronic
1077601825 11:3580066-3580088 ATATCCATCAAAAACCATCAAGG + Intergenic
1077987007 11:7362841-7362863 AAATCCATATATATCAGTCATGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087000466 11:93414619-93414641 GTATCTATTTAGAACTGTCAAGG + Intronic
1087090407 11:94265138-94265160 ATCTACCTCTGGAACAGTCATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087401283 11:97669435-97669457 ATACCCATGTAAAACAGGCATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1094767585 12:33615250-33615272 ATTTCCATTTAGAACCATCACGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101827191 12:108229613-108229635 GTTTCCATCCAGAACTGTCATGG - Intronic
1102715771 12:114971155-114971177 ATATTCTTCTAGAACAGTATTGG - Intergenic
1103495160 12:121356245-121356267 ATATACATATAGAAAAGTCTAGG - Intronic
1103609371 12:122112882-122112904 ATTTCCTTCTAGAACTTTCACGG - Intronic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107286264 13:38796188-38796210 ATATCCAGCTCCAACAGTGATGG - Intronic
1110309147 13:74026925-74026947 ATCACCACCTAGAAAAGTCAGGG + Intronic
1110413992 13:75232513-75232535 ATATCAATCTAGGCCAGGCACGG + Intergenic
1114793193 14:25682096-25682118 ATATCCATGTATATTAGTCAGGG + Intergenic
1116183656 14:41568627-41568649 ATATTCATAGAGAACAGTGAGGG - Intergenic
1118681433 14:68245753-68245775 ATACCAATCTTGAACAGTCTTGG - Intronic
1120723444 14:87912400-87912422 GTATACATCAACAACAGTCAAGG - Intronic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1123935287 15:25191108-25191130 AGATCCATGTAAAACAGTGATGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128977675 15:72165438-72165460 TTGTCCATCTGGAACAGGCAAGG + Intronic
1129556910 15:76519939-76519961 ATGTCCATCAAGAACATTAAGGG - Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1135375334 16:21941870-21941892 ATATCCATCTACATGTGTCAAGG - Intergenic
1139152005 16:64393748-64393770 CTATCTATCTAATACAGTCATGG + Intergenic
1139375265 16:66492947-66492969 GTGTACATCTAGAACAGACAAGG - Intronic
1140276888 16:73517373-73517395 ATATCCATCTACAAAATTCATGG + Intergenic
1140317073 16:73908843-73908865 ATATCCCTCTAGACCAGGCATGG + Intergenic
1140606006 16:76538620-76538642 ATAGCCATATGGAATAGTCAAGG - Intronic
1149754156 17:59173784-59173806 AGCTCCGTCTAGAACAGTCCAGG + Intronic
1150196649 17:63305768-63305790 ATGTCCATATATTACAGTCAAGG - Intronic
1159655417 18:71026390-71026412 ATATCCAGAAAGAACATTCAGGG + Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1166756879 19:45197959-45197981 ATATCCAACTATCAGAGTCATGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926758738 2:16257663-16257685 ATATCCCTCTAGAAACTTCAGGG + Intergenic
929897109 2:45970539-45970561 TTATGTATCTAGAACAGTAAAGG + Intronic
932115907 2:69046821-69046843 ATATCCCTATAAAACAGTAAAGG + Intronic
937101182 2:119270701-119270723 AGAACCATCTAGAACAGCCTGGG - Intergenic
937795764 2:126018081-126018103 ACATCTATCTATAACATTCATGG + Intergenic
938380814 2:130835629-130835651 ACATGCTTCTAGCACAGTCATGG + Intergenic
939096472 2:137838517-137838539 GAGTCCATCTAGAACAGTCCTGG + Intergenic
941499808 2:166259260-166259282 ATATCAAACTGGATCAGTCAAGG - Intronic
941555568 2:166976043-166976065 TTATCTATCTGGGACAGTCAAGG - Intronic
941971608 2:171356799-171356821 TCATCCATCTGGAACAGGCAAGG + Intronic
942122669 2:172793618-172793640 ATATCCATCAAGAACAGCAGTGG + Intronic
947930861 2:233964204-233964226 ATGTCCAACAAGAACATTCATGG - Intronic
1178436610 21:32565356-32565378 ATATATATTTAGAACAGTTAGGG + Intergenic
1179283439 21:39954441-39954463 ATATCCCTCTAGAATAGTAGTGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184144304 22:42599845-42599867 ACAGACATCTAGAACAGGCATGG + Intronic
1184465223 22:44665063-44665085 ATATCTATCTGTTACAGTCAGGG + Intergenic
1184888126 22:47359690-47359712 AAATCCATCTAGAAGAGCAAAGG - Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952506273 3:34009287-34009309 ATATCCATCTAGCATAGATATGG + Intergenic
955002318 3:54938821-54938843 ATATGATTCTAGAAAAGTCAGGG + Intronic
955033262 3:55241321-55241343 TTATGCATCTGGTACAGTCAGGG + Intergenic
956369104 3:68538826-68538848 ACATCCATCCAGAATTGTCAGGG - Exonic
956596156 3:70969847-70969869 ATATGCTTCTCGAACAGTCTGGG + Intronic
957778463 3:84787062-84787084 ATATCTATCTACCACAGTAATGG - Intergenic
959726218 3:109544584-109544606 ATATCCAAGTAGAACAGAAATGG - Intergenic
961281406 3:125767651-125767673 TTATCCATCAAAAACCGTCAAGG - Intergenic
961872956 3:130001928-130001950 TTATCCATCAAAAACCGTCAAGG + Intergenic
963145117 3:141985874-141985896 ATTTCCATCTAGAATATACAAGG + Intronic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
974063464 4:57055735-57055757 ATCTCCATACAGAACAGTCAAGG - Intronic
975774192 4:77766090-77766112 ATATCTGTCTAGAACTGTAAAGG - Intronic
977363807 4:96040714-96040736 ATTCCAATCTAGAACAGTTAGGG + Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
983396892 4:167210001-167210023 ATATCCATCAAAATCTGTCAAGG + Intronic
985122595 4:186659315-186659337 TTATGCATCAAGTACAGTCATGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
997607188 5:135183522-135183544 AAAACCATTTAGAACAGTCCTGG + Intronic
1010441379 6:75898902-75898924 ATATCCATTTATAAAAGTAATGG - Intronic
1010848290 6:80739795-80739817 ATATCCATCCAGAACAGACAAGG - Intergenic
1012299832 6:97572437-97572459 CTATACATCAACAACAGTCAAGG + Intergenic
1012622146 6:101358474-101358496 ATTTCTATCTAGAACACTAAAGG - Intergenic
1012768546 6:103399571-103399593 ATATTCATCTGGCACAGTGAAGG - Intergenic
1013299247 6:108787685-108787707 ATATCCATCCAGAAAAATAAAGG - Intergenic
1015095691 6:129412608-129412630 AAATCCATATACAACAATCAGGG + Intronic
1016727002 6:147383357-147383379 ATATCTATCTGGAAGACTCAAGG - Intronic
1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG + Intronic
1018825125 6:167403130-167403152 ATATACACCTAGAACAATTAAGG - Intergenic
1020289781 7:6714595-6714617 AGCTCCGTCTAGAACAGTCCAGG + Intergenic
1022787509 7:33653217-33653239 ATAGCCATGTAGAACTGTGATGG + Intergenic
1028187657 7:87806800-87806822 ACTTCCATCAAAAACAGTCATGG + Intronic
1029418401 7:100458277-100458299 GTATCCAACTACCACAGTCAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030085890 7:105815352-105815374 ATCTCAATGTAGAACAGTTAGGG - Intronic
1031247703 7:119337730-119337752 CTATCCAGCTAAAACAGTAAGGG - Intergenic
1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG + Intergenic
1035488277 7:159248356-159248378 ATTTCCACCTATAACATTCAAGG - Intergenic
1037390755 8:18389079-18389101 ATGTCCAGCAAGAACCGTCATGG - Intergenic
1037605364 8:20433684-20433706 AGAACAAGCTAGAACAGTCAAGG - Intergenic
1038377116 8:27051798-27051820 ATAACAAACTAGAACAATCAGGG + Intergenic
1038377496 8:27057146-27057168 AGATCTAACTAGAACAGTGATGG + Intergenic
1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG + Intergenic
1043158678 8:76818619-76818641 AAATGAATCTAGAACAGTCACGG + Intronic
1045314083 8:101028049-101028071 AAAGCCATCTGGAGCAGTCATGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050491254 9:6190298-6190320 TTATCCTTCTGGAACAGTCTTGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051447462 9:17155618-17155640 AGATCCACCTGGGACAGTCAAGG - Intronic
1053566967 9:39263222-39263244 TTTTCCATCTCAAACAGTCATGG + Intronic
1053832742 9:42101064-42101086 TTTTCCATCTCAAACAGTCATGG + Intronic
1054130176 9:61355785-61355807 TTTTCCATCTCAAACAGTCATGG - Intergenic
1054597811 9:67086346-67086368 TTTTCCATCTCAAACAGTCATGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1188989436 X:36799894-36799916 TTTTCCATCAGGAACAGTCAGGG + Intergenic
1196340275 X:114586641-114586663 ATCTCCATCTAGAGGTGTCATGG + Intronic
1200035229 X:153322299-153322321 ATATCCCTCAAGAACAGTATAGG - Intergenic