ID: 1100647142

View in Genome Browser
Species Human (GRCh38)
Location 12:96543469-96543491
Sequence CTGGGGGTAAGAAGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 487}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100647142 Original CRISPR CTGGGGGTAAGAAGCCAGGA GGG Intronic
900294874 1:1943795-1943817 CTGGAGGTCAGAAGCCAAGACGG + Intronic
900358204 1:2274865-2274887 CTGAGAGCAAGAAGCCAGGAGGG - Intronic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
902398225 1:16143878-16143900 CTGGGAGCAAGAAGCCACCAGGG - Intronic
903028903 1:20448817-20448839 CTGGGGGCGAGAGGCCAGGCCGG + Intergenic
903132973 1:21291061-21291083 GGGGGAGTCAGAAGCCAGGAAGG + Intronic
903798172 1:25946063-25946085 CTGGTGAATAGAAGCCAGGAAGG + Intergenic
904179459 1:28655680-28655702 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
904254836 1:29248291-29248313 CTGGGGTGGAGAACCCAGGATGG + Intronic
905032690 1:34898290-34898312 CTGAGGATAAGCAGCCAGGGAGG + Intronic
905285628 1:36878306-36878328 CTGGGGTGAATAAGCCAGGCTGG + Intronic
905354098 1:37369071-37369093 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905409515 1:37758711-37758733 TGTGGGGTAAGAAGCCAAGAGGG - Intronic
905465257 1:38148390-38148412 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
905880407 1:41459729-41459751 CTGGGGCTCAGAGGCAAGGATGG - Intergenic
905885916 1:41491889-41491911 CTGAGGGTCAGAACCCAGGCAGG - Intergenic
906050519 1:42867705-42867727 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
906147516 1:43568818-43568840 CTGGGAGAAGGCAGCCAGGAGGG + Intronic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
908867020 1:68559806-68559828 CTAGAGGTAAGAAGCCTGAAGGG - Intergenic
909172577 1:72315175-72315197 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
910265526 1:85333129-85333151 CTGGGGATAGGACGCCAGGTGGG - Intronic
910630254 1:89346543-89346565 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
910638955 1:89439683-89439705 CTGGGGGAGAGCAGGCAGGATGG + Intergenic
911481231 1:98443375-98443397 CTAGGGGTTAGAAGGAAGGAGGG + Intergenic
911712448 1:101089575-101089597 CTGGTGGTAAGAAATTAGGAAGG - Intergenic
911738364 1:101361628-101361650 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
911981869 1:104578973-104578995 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
912385095 1:109267525-109267547 CTGGGGGAAGGAAGCCAAAAGGG - Intronic
912428852 1:109617994-109618016 CTGGGGTTAAGACCCCGGGAAGG + Exonic
912711616 1:111953994-111954016 CATGGGCTAACAAGCCAGGATGG + Intronic
913293499 1:117296894-117296916 CTGGGGGTAAAATGACAGGGTGG - Intergenic
913979550 1:143497355-143497377 CTGGGGGTAAAAAGCCGAGGCGG - Intergenic
914418897 1:147510254-147510276 CTGGGGAAAAGAAGCCGGGAAGG + Intergenic
914965476 1:152253615-152253637 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
915089869 1:153416843-153416865 CAGGGAGGAAGAAGACAGGAAGG - Intronic
915637365 1:157195995-157196017 CTGGGGGTATGAAGGCAGCAGGG - Intergenic
915709693 1:157883934-157883956 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
916106297 1:161435039-161435061 CTGGGGGAAAGAAGGCAGGGTGG + Intergenic
916985350 1:170185375-170185397 CAGAGGGTGTGAAGCCAGGAGGG - Intergenic
917640644 1:176980250-176980272 CAGGGAGTAAGATGACAGGAAGG + Intronic
917764558 1:178202300-178202322 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
918543268 1:185654444-185654466 ATAGGGGTAAGAAGGGAGGAAGG - Intergenic
919131325 1:193454578-193454600 ATGGGGGTAAGAGGAGAGGAGGG + Intergenic
919317032 1:195984438-195984460 CTGGTGTTAACAAGCCAGCATGG + Intergenic
919976388 1:202615701-202615723 CTGGTGGCAAGAGGCCAGCATGG - Intronic
920177697 1:204113251-204113273 CTAGGGGTAAGACGCCATGTAGG + Intronic
922771000 1:228182827-228182849 CTGGGGGTAGGCAGTCTGGAGGG + Intergenic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
923121823 1:230999130-230999152 CTGGAGGTATGAGGCCTGGAAGG - Intronic
924847102 1:247784846-247784868 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
924945239 1:248842081-248842103 ATGGGGGAAGGAAGCAAGGAGGG + Intronic
1064424709 10:15220533-15220555 CTGGGGGCAAAAAGCCTGGTGGG - Intronic
1065484556 10:26225254-26225276 CTGGTGATAAAAAGGCAGGATGG - Intronic
1066046290 10:31598356-31598378 ATGTGGGAGAGAAGCCAGGATGG + Intergenic
1067532051 10:47081099-47081121 CTAGGGGTAGGAAGCCAGACAGG + Intergenic
1067809657 10:49417362-49417384 CTGTGGGGGAGAAGCCACGAGGG - Intergenic
1068007642 10:51409287-51409309 CTGGGGGAGAGAAGACAGGGTGG + Intronic
1068116140 10:52739675-52739697 CTGGGGCTCAGAAGCCTGGGAGG + Intergenic
1068447237 10:57138885-57138907 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1069790798 10:71019293-71019315 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1070751250 10:78965278-78965300 GTGGAGGTGAGAGGCCAGGAAGG + Intergenic
1071501269 10:86205958-86205980 ATGGAGGCAAGGAGCCAGGAAGG + Intronic
1071937720 10:90549566-90549588 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1072360498 10:94654439-94654461 CTGGAGGAAAGAAGGCAGGGTGG - Intergenic
1072983387 10:100118335-100118357 CCGGGGATGAGAAGCCAGCATGG + Intergenic
1073070104 10:100787837-100787859 ATGGGGGAAGGAAGCCAGGAGGG + Intronic
1073471217 10:103723477-103723499 CTGGGTGTGAGAAACCAGCATGG + Intronic
1075091989 10:119448975-119448997 CAGGGAGTCAGAAGCCAGGAAGG + Intronic
1075333956 10:121596106-121596128 CTGGGGCTCAGACTCCAGGAAGG - Intronic
1075344688 10:121673504-121673526 GGGGAGGAAAGAAGCCAGGAAGG - Intergenic
1075606818 10:123817689-123817711 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1077516215 11:3003566-3003588 CTAGGGAAAAGAAACCAGGAAGG + Intronic
1077663564 11:4089753-4089775 CTGAGGGTCAGAAGTTAGGAAGG - Intronic
1078386691 11:10899013-10899035 CTGAAGGTGAGAAGCCAGGCAGG + Intergenic
1079586123 11:22128502-22128524 CAGGGGGAAAGTAGCCAGGAGGG - Intergenic
1079766965 11:24406198-24406220 CTGAGGGGAACAGGCCAGGACGG + Intergenic
1081378319 11:42386208-42386230 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1083187677 11:61026985-61027007 CTGGGGGAAGGGAGCCAGGGAGG - Intergenic
1083744665 11:64728789-64728811 CTGGGGCAAAGAACGCAGGATGG - Intronic
1083940232 11:65891606-65891628 TTGGGGGTAATAAACCCGGACGG + Exonic
1084748727 11:71189873-71189895 CTGGGGCTTTGAAGCCAGGCTGG - Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1085685987 11:78622455-78622477 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1085748737 11:79140308-79140330 TTGGGGGTAGGGAGCCCGGAGGG - Intronic
1086278638 11:85160717-85160739 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1086361793 11:86068333-86068355 TAGGGGGTGAGAAGCCAGGTGGG + Intronic
1087374049 11:97320816-97320838 CTGGGGGAGAGAAGGCAGGGCGG - Intergenic
1087520816 11:99233096-99233118 CTGAGGGAAAGAAGCCTTGAAGG - Intronic
1088913463 11:114209520-114209542 CTCAGGGTCAGAGGCCAGGAGGG - Intronic
1089632647 11:119793366-119793388 CTGGGGATAAGAAGCAGAGACGG - Intergenic
1089903639 11:122013877-122013899 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1090053112 11:123397846-123397868 CTGAGGGTAAGAGGCCAGATGGG - Intergenic
1090119168 11:124006108-124006130 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1090490385 11:127155458-127155480 CTGAGGTTGAGAAGCTAGGAGGG + Intergenic
1090744581 11:129695943-129695965 CTGGGGGAAAGAAGCGAAGTGGG + Intergenic
1091051774 11:132379021-132379043 CTGGGGGAGAGAAGTCAGGGTGG - Intergenic
1091219627 11:133922397-133922419 GTGGGGGTAAGAAGCAGGGGTGG - Intronic
1091240252 11:134047299-134047321 CTGGGGGTAAGAATCAAGCCAGG - Intergenic
1091347856 11:134867224-134867246 CTGGGGGGATAAAGGCAGGAGGG + Intergenic
1091750709 12:3019799-3019821 CTGGGGGACAGAAGGCAGCAGGG - Intronic
1092496714 12:9003603-9003625 CTGGGGGTAAGAAGGTAGACCGG - Intronic
1093964570 12:25311219-25311241 CTGGGGGTGAGAAGGCAGGGTGG - Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1095083240 12:38031430-38031452 CTGGGGGCGAGGAGCCAAGACGG + Intergenic
1095856215 12:46863410-46863432 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1096096808 12:48940854-48940876 CTGGGGAGAAGAGGCCAGGTTGG + Intronic
1098704204 12:73665992-73666014 TTGGAGGTAAGAAGCCAGTTTGG - Intergenic
1098831874 12:75373763-75373785 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1099365959 12:81765650-81765672 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1099689808 12:85938286-85938308 CTGGGGGACAGAAGGCAGGGTGG - Intergenic
1100001496 12:89842467-89842489 ATGTGGGTAAGAAGGCTGGAGGG + Intergenic
1100016511 12:90017112-90017134 CTAGGAGAAAGCAGCCAGGATGG - Intergenic
1100241120 12:92711342-92711364 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1100775390 12:97967888-97967910 CTGGGGGTGAGAAGAGAGGGTGG - Intergenic
1100806370 12:98288593-98288615 CGGGGGGTAATAAGCCAAGTTGG + Intergenic
1101016866 12:100510901-100510923 CTGGGGGTAGAAACCCAGGTTGG - Exonic
1101277151 12:103215431-103215453 GATGGGGTAAGAGGCCAGGAGGG - Intergenic
1101519790 12:105470991-105471013 CTGGGGGTAACAGGGGAGGAAGG + Intergenic
1101543101 12:105682901-105682923 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1103001782 12:117390309-117390331 GAGGAGGTGAGAAGCCAGGAAGG - Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103408630 12:120694492-120694514 ATGGAGGGAAGTAGCCAGGAGGG - Intronic
1104441224 12:128794866-128794888 CTGGTGGCAAGAACACAGGAAGG - Intronic
1107097267 13:36550107-36550129 GTGGGAGAAGGAAGCCAGGAGGG + Intergenic
1108302404 13:49091731-49091753 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1108442358 13:50467792-50467814 TTGGGGGAAAGAGGGCAGGAAGG + Intronic
1108554867 13:51583051-51583073 CTGGGTGTAGGAAGGAAGGAAGG + Intergenic
1108674864 13:52727811-52727833 CTGGGGGAATGAAGACAGGTTGG + Intronic
1109712654 13:66180556-66180578 CTGGGGGAAAGAAGACAGGGTGG + Intergenic
1110377197 13:74806735-74806757 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1111198566 13:84905149-84905171 CTGGGGGAGAGAAGGCAGCATGG - Intergenic
1111317531 13:86582067-86582089 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1111947336 13:94679619-94679641 CTGGGCGTGAGAAGACAGGCAGG - Intergenic
1113213767 13:108013553-108013575 CTGGAGGTTAGAAGCCAAAAAGG - Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113319677 13:109221397-109221419 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1113396168 13:109949798-109949820 CTGGGGGAGAGAAGGCAGGGAGG - Intergenic
1114205898 14:20571034-20571056 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1115130725 14:30049526-30049548 CTGGGGGAAAGAAGGCAGGGTGG - Intronic
1115143431 14:30199639-30199661 CTGTGGGGAAGAAGGCAGGGTGG - Intergenic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1116995227 14:51316507-51316529 CTGTCTGTAAGAAGCCAGGAAGG + Intergenic
1117001631 14:51376578-51376600 CTGGGGGAAAGAAGGCAGAGTGG - Intergenic
1117216874 14:53560440-53560462 CTGGGGGAAAGAAGGCAGAGTGG - Intergenic
1117634162 14:57724639-57724661 CTGGGGGGGAGAATGCAGGATGG - Intronic
1118314992 14:64720745-64720767 CTGGAGGTAAGAAGTCAGACTGG + Intronic
1118478013 14:66136442-66136464 CTGGGAGGTAGAAGCCAGAATGG + Intergenic
1118880742 14:69823755-69823777 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1119691538 14:76676508-76676530 CTTGGGGTAAGGAGCAAGGGAGG + Intergenic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120342943 14:83245147-83245169 CTGTGGGTAAGAAGATAGCAAGG + Intergenic
1120835845 14:89037675-89037697 GTGGAGGTAAGAAGCAGGGAGGG + Intergenic
1120973732 14:90231098-90231120 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1121096255 14:91219967-91219989 CTGAGGGGAAGATGCCATGAGGG - Intronic
1122048837 14:99041609-99041631 CTGGAGGTACGGAGCCAGGCTGG - Intergenic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122530922 14:102426430-102426452 CTGGGGGTGAGGAGTCGGGAGGG - Intronic
1122556641 14:102584090-102584112 GTGGGGGTTGTAAGCCAGGAAGG + Intergenic
1122843968 14:104480742-104480764 TTGAGGGGGAGAAGCCAGGAAGG + Intronic
1124614791 15:31233885-31233907 CTGGGTGTGAGAAGCCAGCGGGG + Intergenic
1124718710 15:32093283-32093305 CTTGGGGAATGAAGCCTGGAAGG - Intronic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126505077 15:49395980-49396002 CTGGGGGCGAGGAGCCAAGATGG + Intronic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1128096284 15:64958996-64959018 CTGGGGGAAGGAAGAAAGGAAGG + Intergenic
1128258414 15:66214877-66214899 ATGGGGGTAAGAGGAGAGGAGGG + Intronic
1128850834 15:70954483-70954505 CTGGAGGTAAGAAGACATGCTGG + Intronic
1128980042 15:72179378-72179400 GTGGAGGTATGCAGCCAGGAGGG + Intronic
1129078983 15:73023115-73023137 CAGAGGGTAAGAAGGCAGGTGGG - Intergenic
1131785207 15:95905035-95905057 CTGGGGGTAGGAGGAAAGGATGG - Intergenic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133229361 16:4359386-4359408 CTGCGGGGAAGAAGGCAGGCTGG + Intronic
1133769386 16:8859013-8859035 CTGAGGGTGAGAAACTAGGAAGG - Intronic
1133787838 16:8986786-8986808 TTGAGGGTTAGAAGCCAGGCTGG - Intergenic
1133800686 16:9082680-9082702 CTAGTGGGTAGAAGCCAGGAAGG - Intergenic
1133822180 16:9246583-9246605 ATGGGGATAATAAACCAGGAGGG + Intergenic
1133983566 16:10651239-10651261 CTAGGGCTAAAAAGCCAAGAAGG + Intronic
1134092002 16:11396494-11396516 CTGGAGGTCAGTGGCCAGGATGG - Exonic
1134336291 16:13302628-13302650 CTGGGGGATAGAAGACAGCATGG - Intergenic
1134409323 16:13990297-13990319 CTTGGGGTACCAAGCCAGCATGG - Intergenic
1135319645 16:21484296-21484318 GGGGGTGTAAGAAGGCAGGAAGG + Intergenic
1135372482 16:21915785-21915807 GGGGGTGTAAGAAGGCAGGAAGG + Intergenic
1135439304 16:22454919-22454941 GGGGGTGTAAGAAGGCAGGAAGG - Intergenic
1136938818 16:34500759-34500781 CGGGGGGTAAAAAGCCATGGCGG + Intergenic
1136961002 16:34847797-34847819 CGGGGGGTAAAAAGCCATGGCGG - Intergenic
1137721755 16:50631638-50631660 GTGTGGGAAGGAAGCCAGGAGGG + Intronic
1137753236 16:50881947-50881969 CTTGGGGTGTGCAGCCAGGAAGG + Intergenic
1138319324 16:56098459-56098481 CCGGGGGCAAGAGTCCAGGAAGG + Intergenic
1138744190 16:59344285-59344307 CTGGGGGCAAAAAAACAGGAAGG - Intergenic
1138868407 16:60851048-60851070 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1139100437 16:63760391-63760413 CTGGGGGCATAAAGACAGGAAGG - Intergenic
1139381845 16:66537390-66537412 GTGGGTGGGAGAAGCCAGGAGGG + Intronic
1139475084 16:67199098-67199120 CTGGGGGTAGGAAGGTAGGACGG - Exonic
1140275334 16:73503643-73503665 ATGGGGGAAAGAACGCAGGATGG + Intergenic
1140329542 16:74040591-74040613 CTGGTGGGAAGAAGAAAGGAGGG + Intergenic
1140819676 16:78651436-78651458 CTGGAGGTCAGAAGCCATGCAGG + Intronic
1141559514 16:84857772-84857794 CTGGGGGAAAGAAGGCAGGGTGG + Intronic
1141639110 16:85330834-85330856 CCTGGGGTAAGAAGGGAGGAGGG - Intergenic
1203015211 16_KI270728v1_random:350861-350883 GTGGGGGCAAAAAGCCAGGGCGG - Intergenic
1203033546 16_KI270728v1_random:624019-624041 GTGGGGGCAAAAAGCCAGGGCGG - Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1145712818 17:26992506-26992528 CAGGGGGTTTGAAGCCAGGTGGG + Intergenic
1145980551 17:29008654-29008676 CTGGGAGCAAAAAGCCAGGTGGG - Intronic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146379565 17:32318858-32318880 CATGGGGTAAGAAGTAAGGAAGG - Intronic
1147044766 17:37744332-37744354 CTGGGGAGAAGAAGCCCGGTGGG + Intronic
1147316222 17:39621679-39621701 GTTGGGGGAAGAAGGCAGGAAGG + Intergenic
1148215354 17:45831020-45831042 CTGAGGGGAAAAAGCCAGCATGG - Intronic
1148871918 17:50663393-50663415 CAGGAGGTAAGAAGGCAGGCAGG + Intronic
1149555471 17:57570571-57570593 CTGGGGACAAGAAGGCAGGCAGG - Intronic
1151208904 17:72529125-72529147 CCAGGGGTAATAACCCAGGATGG - Intergenic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1152258697 17:79255026-79255048 CTGGGGGCAGGAAGCCAGCAAGG - Intronic
1152319825 17:79602475-79602497 CTGGGGGCACGCAGCCAGGATGG + Intergenic
1152732486 17:81979161-81979183 CTGGGGGTGAGATGAAAGGATGG - Intronic
1152945790 17:83196711-83196733 ATGGGGGGAAGAGGACAGGAGGG + Intergenic
1153089741 18:1330423-1330445 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1154104097 18:11505188-11505210 GTGGGGCTAAGAAGGCAGCATGG + Intergenic
1157119830 18:44898571-44898593 TTTGGGGAAGGAAGCCAGGAAGG + Intronic
1157374252 18:47149109-47149131 CTGGGAGAGAGAAGCAAGGAGGG + Intronic
1157535745 18:48456108-48456130 CTGGAGGGAAGAAGAAAGGAAGG + Intergenic
1157594242 18:48854223-48854245 CTGGGAGTGAGAAGCAGGGAGGG + Intronic
1157693273 18:49700863-49700885 TTAGGGGTACGAAGCCGGGATGG + Intergenic
1158311704 18:56166442-56166464 AAGGGGGAAAGAAGGCAGGAAGG + Intergenic
1160876704 19:1299929-1299951 CTGGGACTAGGAACCCAGGAGGG - Exonic
1160976170 19:1793655-1793677 CGGGGGGTAAGAAGCCGTAAGGG - Intronic
1161520744 19:4722466-4722488 CTGGGGTTTGGCAGCCAGGAAGG - Intronic
1162301639 19:9848186-9848208 CTGAGGGGTAGAGGCCAGGAGGG + Intronic
1162440350 19:10688527-10688549 CTGGGGGAGAGAAGACAGGATGG - Intronic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1164097059 19:22021090-22021112 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
1164117231 19:22234312-22234334 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1164550846 19:29211389-29211411 CTGGAGGTGAGAAGGAAGGAAGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166276724 19:41758933-41758955 CTGGGGGAAAGAGCCCTGGATGG - Intronic
1166369721 19:42294048-42294070 CTTGCGGTAAGAGCCCAGGATGG - Exonic
1166703121 19:44893572-44893594 CAGAGAGTAACAAGCCAGGATGG + Intronic
1167215269 19:48160389-48160411 GTGGGTGTGGGAAGCCAGGATGG + Intronic
1167604920 19:50476526-50476548 CTGGTGGGAAGAAGCCGAGATGG + Exonic
1167679967 19:50913053-50913075 GTGGGGGAAAGAAGTAAGGAAGG - Intergenic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1168189874 19:54730111-54730133 CTGTGGGTGACAGGCCAGGATGG - Intronic
1168191873 19:54744411-54744433 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168196204 19:54775781-54775803 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168204565 19:54840023-54840045 GTGTGGGTGAGAGGCCAGGAAGG - Intronic
1168206810 19:54856236-54856258 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168670734 19:58239281-58239303 CTGGTGGGCAGAGGCCAGGAAGG - Intronic
925306035 2:2848901-2848923 GTGGGGGAAGGAAGCCAGGGAGG + Intergenic
925451726 2:3974696-3974718 CTGGGGGACAGAAGCATGGATGG + Intergenic
927108048 2:19844540-19844562 CTGAGGGTAGGAAGCCTGCAGGG - Intergenic
927131432 2:20063702-20063724 CTGGGGGTAAGAACTGGGGAGGG + Intergenic
927214383 2:20658888-20658910 CTGGGGGTGGGATGTCAGGATGG - Intergenic
927719219 2:25372416-25372438 GTGGAGGAAGGAAGCCAGGAAGG - Intergenic
927922880 2:26986962-26986984 CTAGAGGTAAGAACTCAGGAGGG + Intronic
929199070 2:39216376-39216398 CTTGAGTGAAGAAGCCAGGAAGG + Intronic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
929695433 2:44110896-44110918 CTGAGGGTCAGAAGTCTGGAGGG - Intergenic
930536583 2:52652000-52652022 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932200080 2:69818443-69818465 ATGTGGGCAAGCAGCCAGGAGGG - Intronic
932474096 2:71990389-71990411 CTGGAGGTGAGCAGGCAGGAAGG + Intergenic
934077521 2:88440654-88440676 CTGGAGGTGAGAAGCCAGCAGGG - Intergenic
934189055 2:89768060-89768082 CGGGGGGCAAAAAGCCAGGGCGG + Intergenic
934248536 2:90325902-90325924 CGGGGGGTAAAAAGCCGGGTCGG + Intergenic
934307550 2:91839941-91839963 CGGGGGGTAAAAAGCCATGGCGG - Intergenic
934307630 2:91840253-91840275 CAGGGGGTAAAAAGCCACGGCGG - Intergenic
934331318 2:92072836-92072858 GTGGGGGTAAGAAGCCACGGCGG - Intergenic
934718506 2:96556952-96556974 CTGTGAGTCAGAAGCCAGGCGGG - Intergenic
934734874 2:96685104-96685126 CAGGTGGCAAGAAGCCGGGATGG - Intergenic
935425075 2:102911063-102911085 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
935564280 2:104589989-104590011 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
935794483 2:106628159-106628181 CTGGGGGCAAGAAGCAAGAAGGG - Intergenic
936036593 2:109117769-109117791 CTGGGTGGAAGCAGCCAAGATGG - Intergenic
936525861 2:113241336-113241358 TTGGGTGAAGGAAGCCAGGAGGG + Intronic
936641255 2:114314951-114314973 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
937042376 2:118832656-118832678 GTGGGGGGAGGTAGCCAGGAGGG - Intergenic
937062070 2:118988190-118988212 CTGGAGGTGAGGAGCTAGGAAGG + Intronic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
937582036 2:123498903-123498925 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
939685551 2:145194728-145194750 CTGGGGGTAAGCAGCTAAGGTGG + Intergenic
940335854 2:152526485-152526507 CTGGGAGTGAGAAGCCAGAAAGG - Intronic
940586829 2:155662428-155662450 CTGGGGGTTAGTAGCAGGGATGG + Intergenic
940605890 2:155924024-155924046 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
941405464 2:165082223-165082245 ATGGGGGTCAGAAGACAGTAGGG - Intergenic
941668050 2:168261392-168261414 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
942349747 2:175039763-175039785 TGGGAGCTAAGAAGCCAGGAGGG + Intergenic
943123214 2:183763739-183763761 CTGGGGATAAGAATCCGTGAAGG + Intergenic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
943683210 2:190789506-190789528 CTGGCAGTTAGAAGCCAGGCTGG - Intergenic
945622473 2:212157861-212157883 CTGGAGGTAAGAAGACCAGAGGG + Intronic
945765611 2:213973251-213973273 CTTGGGAGAAAAAGCCAGGAAGG - Intronic
946930032 2:224662114-224662136 GTGGGAGGGAGAAGCCAGGAGGG - Intergenic
947418796 2:229922865-229922887 CTACGGGTAAGAAGCCGGGGTGG - Intronic
947601066 2:231450715-231450737 GGGGGAGTAAGAGGCCAGGAGGG - Intergenic
948850282 2:240702307-240702329 CTGGGAGCAAGAGGCCAGGCAGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168868416 20:1108537-1108559 CTGGTGGAATGAAGTCAGGATGG + Intergenic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1171173477 20:23035061-23035083 CTGAAGGAAAGAAGCCAGGCGGG + Intergenic
1171206229 20:23283372-23283394 TTGAGGGAAAGAAGCCATGAGGG + Intergenic
1172592775 20:36129121-36129143 ATGGGCCTAAGAAGCCAGCATGG + Intronic
1173839683 20:46149275-46149297 CTGGGGGTGGGAGGACAGGATGG + Intergenic
1173900142 20:46581634-46581656 CCAGGGGGAAGAAGCTAGGAAGG + Intronic
1173955491 20:47029186-47029208 CAGGGTGTAAGAAGGCAGAAGGG + Intronic
1175388468 20:58611900-58611922 ATGGGGGAACGAGGCCAGGAAGG - Intergenic
1175890839 20:62315250-62315272 TTGGGGACATGAAGCCAGGATGG - Intronic
1177044971 21:16158014-16158036 CTAGGGGCATGAAGACAGGAAGG + Intergenic
1177913209 21:27056474-27056496 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1177933666 21:27316668-27316690 CTGGGGGAAAGAAGGCAGGGTGG + Intergenic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1179191112 21:39122133-39122155 CCGGGGGAAAGATGCCAGGTTGG - Intergenic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183080557 22:35453108-35453130 CAGAGGGGCAGAAGCCAGGAGGG - Intergenic
1183194042 22:36341002-36341024 CTGTGGGGAAGAAGCAAGAAAGG + Intronic
1183945599 22:41324139-41324161 CTGGAGGCAGGAGGCCAGGAAGG + Intronic
1183949174 22:41343248-41343270 CAGGGAGCAAGTAGCCAGGAAGG + Intronic
1184474721 22:44714295-44714317 GTGGGGTTAAGAACCCAGAAAGG + Intronic
1185360739 22:50405237-50405259 CTGGAGGTGAGAGGCCTGGAGGG + Intronic
949170010 3:986340-986362 CTGGGGGAGAAAAGCCAGGGTGG + Intergenic
949417559 3:3830623-3830645 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
950148437 3:10668051-10668073 CAGGAGGTCGGAAGCCAGGATGG - Intronic
950271654 3:11620761-11620783 CTGGGGGTGAGAGGGAAGGAGGG - Intronic
951970726 3:28441604-28441626 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
953125592 3:40088871-40088893 CTGGAGGCAGGAAGTCAGGAAGG + Intronic
953237637 3:41120255-41120277 ATGGGGATAAGAAGCCCGCAGGG - Intergenic
953707894 3:45245008-45245030 GTGGGGCAAAGAAGCCAGGCAGG + Intergenic
954079892 3:48207450-48207472 CTGGTGGTAAGCGGGCAGGAAGG + Intergenic
954183372 3:48898833-48898855 CTGGGGCTGAGAAGCCAGGACGG - Exonic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954706414 3:52483155-52483177 CAGGGGGTAGGCAGGCAGGAAGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955769177 3:62372242-62372264 CTTGGGGTGAGCAGCCAGGGCGG + Exonic
956703871 3:71982624-71982646 CTGGGGGTGAGAAGGCAGGGTGG + Intergenic
957673423 3:83335612-83335634 GTGGGGTTAAGAAACCAGGCTGG - Intergenic
958790919 3:98650119-98650141 CTAAGGGAAAGAAGCCAAGATGG - Intergenic
959997887 3:112698583-112698605 CTGGGGGAGAGAAGGCAGGGGGG - Intergenic
960378684 3:116933832-116933854 CTGTGGGAAATAAGCCAGCAAGG + Intronic
960618632 3:119618676-119618698 CTGGGGAAAGGATGCCAGGAAGG + Intronic
960912055 3:122659016-122659038 CTGGGAGGCAGAGGCCAGGAGGG + Intergenic
960992356 3:123320245-123320267 CTGGGTGAAAGAAACCAGGTGGG - Intronic
961207953 3:125102266-125102288 CAGGGTGTATGAAGGCAGGAAGG + Intronic
961439618 3:126945113-126945135 CTGGGGAGAAGAGGCCAGGTAGG + Intronic
961444561 3:126973091-126973113 TTGGGGCTCAGAAGCCTGGAGGG - Intergenic
962409195 3:135126612-135126634 CTGGGGCTAGGTGGCCAGGAAGG + Intronic
964486240 3:157187495-157187517 CTGGAGGTAAGAAGACACTATGG - Intergenic
965127023 3:164643991-164644013 CTGGAGGTTAGAAGTCTGGATGG + Intergenic
965226735 3:166000497-166000519 CTGGGGGAGAGAAGGCAGGGAGG + Intergenic
966003452 3:174979001-174979023 TTGGGTGAAAGGAGCCAGGAAGG + Intronic
966413934 3:179670045-179670067 TTGAGGGTAGGAAGCCAGCAGGG - Intronic
966547900 3:181171357-181171379 CTGTGGGTAGGAAGAAAGGAAGG + Intergenic
966921407 3:184613932-184613954 CTGGGGGGAAGAAAACAGGGCGG - Intronic
968231094 3:197004983-197005005 CTGTGGGGAAGATGACAGGAAGG + Intronic
968690438 4:1987281-1987303 CTGGGGGCCAGAGGGCAGGACGG - Intronic
969112417 4:4852155-4852177 CTGGGGGAAAGAGGCAAGGGAGG + Intergenic
969143477 4:5100340-5100362 CTGGGGGGAGGAAGGAAGGAAGG - Intronic
969227472 4:5808178-5808200 CTGGGGGGAGGAAGGCAGGCAGG - Intronic
969264898 4:6057861-6057883 CATGGGGAAAGAAGCCAGGTGGG + Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969872521 4:10113653-10113675 CTGGGGGCAATAAGTCAGGTGGG + Intronic
970457290 4:16237774-16237796 CTAGGAGAAAGAATCCAGGAAGG + Intergenic
970580289 4:17468645-17468667 GTGAGGGGAAGAAGACAGGAAGG + Intronic
971100985 4:23466159-23466181 CTGGGGGAGAGAAGCTAGGGTGG + Intergenic
972872324 4:43314630-43314652 CTGGGAATAAGTAACCAGGAAGG - Intergenic
973271524 4:48267812-48267834 CTAGGGGTAAGAATCTGGGAGGG + Intronic
974262340 4:59542017-59542039 CTGGGGGAAAGAAGGCAGAGTGG + Intergenic
974564819 4:63568572-63568594 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
974727245 4:65812785-65812807 CTTGGGGAGAGAAGGCAGGATGG - Intergenic
975240620 4:72053313-72053335 CTGGGGGAAAGAAAACAGCATGG + Intronic
975367937 4:73550626-73550648 TGGGGGGGAAGAAGCCAAGATGG + Intergenic
975386688 4:73767246-73767268 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
977466030 4:97383637-97383659 CTGGAGGAAAGAAGGCAGGGTGG - Intronic
978284500 4:107060053-107060075 ATGGGGGAAAGAAGACATGAGGG + Intronic
978341559 4:107725286-107725308 CTGGGGGACAGAAGGCAGGGTGG + Intergenic
979767044 4:124474858-124474880 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
980497500 4:133605099-133605121 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
980967996 4:139542233-139542255 CTGGGGAGTAGAAGGCAGGAGGG + Intronic
981830188 4:148990588-148990610 CTGGGGGAAGGAATCCAGGAGGG - Intergenic
983768685 4:171519879-171519901 GTGGGAGTTAGAAGCCAGGAAGG + Intergenic
985631235 5:1015113-1015135 CTTGGGGCAAAAGGCCAGGAAGG - Intronic
985764200 5:1768283-1768305 ATGTGGGTCAGAAGCCAGGTGGG + Intergenic
986938305 5:12918487-12918509 CTGGGGGAGAGAAGTCAGGGTGG + Intergenic
987337107 5:16906586-16906608 CTGGATGTCAGAAGCCAGCATGG + Intronic
988169169 5:27632574-27632596 CTGGGGGAGAGAGGCCAGGGTGG + Intergenic
988233262 5:28506826-28506848 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
989045177 5:37267325-37267347 CTGGGGGCGAGAAGGCAGGGTGG + Intergenic
989097858 5:37797583-37797605 CTGGGGGCGAGAAGGCAGGGTGG - Intergenic
989307472 5:39974360-39974382 CTGGGGGACAGAAGGCAGAATGG + Intergenic
989486353 5:41996095-41996117 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
992140359 5:73790484-73790506 CTGGGGAGAAGAAACCAAGATGG - Intronic
992480978 5:77152375-77152397 CTGGGGGTAAGCAGCCCAGTGGG + Intergenic
994876709 5:105432793-105432815 TTGGTGGAAAGAAGCAAGGAAGG + Intergenic
994891949 5:105647556-105647578 CTGGGGATAATAAGCAAGCAAGG + Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995271692 5:110227525-110227547 CTGGGGCTGAGAAGCCAGTGAGG + Intergenic
995452430 5:112316815-112316837 CTGGGCTGAAGAACCCAGGATGG + Intronic
995717808 5:115097394-115097416 ATGGTGCTAAGATGCCAGGATGG - Intergenic
996168662 5:120260539-120260561 TTGGGGAAAGGAAGCCAGGAAGG - Intergenic
997525558 5:134550917-134550939 GGGGGGGTAGGAAGGCAGGAAGG - Intronic
997528899 5:134570314-134570336 GTGGGGGAAGGAAGACAGGAGGG - Intronic
997756833 5:136407354-136407376 CTTGGGTTGAGAGGCCAGGATGG + Intergenic
999162820 5:149518914-149518936 TAGGGGGTAAGAAAACAGGAAGG + Intronic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999615937 5:153424184-153424206 CTGGGGGAAATGAGACAGGAGGG + Intergenic
999880466 5:155857649-155857671 GTAAGGGTAAGAAGGCAGGAAGG + Intergenic
1001015770 5:168139731-168139753 CAGGGTGTAAGAGGCCAGGGAGG + Intronic
1001173629 5:169444908-169444930 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1001234979 5:170021895-170021917 CTGGGGTCTAGAATCCAGGAGGG + Intronic
1001552199 5:172611106-172611128 TTGGGGGTGAGCAGGCAGGATGG + Intergenic
1002078469 5:176723666-176723688 CTGGGGCTGTGAACCCAGGAAGG - Intergenic
1002618933 5:180472788-180472810 CTGGTGGGTAGAAGCCAGGGAGG + Intergenic
1002664013 5:180809969-180809991 GTGGGGGTCAGAGTCCAGGAAGG - Intronic
1002692553 5:181060137-181060159 CGGTGGGCAAGAAGCCAGCATGG + Exonic
1002997996 6:2305011-2305033 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006080139 6:31560381-31560403 CTGGGGGCCAGACACCAGGAAGG - Intergenic
1006112979 6:31759950-31759972 CTTGGGGTACGAATCCAGAATGG + Exonic
1006392260 6:33765454-33765476 CTTGGTGGAAGAAGCCAGCAGGG - Intergenic
1006397822 6:33798540-33798562 GTGGAGGCAAGAAGCCAGGCAGG - Intronic
1006415718 6:33902769-33902791 CGGGAGGAAAGAAGCCAGTAAGG + Intergenic
1006564541 6:34943693-34943715 TTAGGTGAAAGAAGCCAGGATGG - Intronic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1006717773 6:36131104-36131126 CAGGGAGTAGGAAGCCAGGCAGG - Intronic
1007179112 6:39915658-39915680 CTGGGTGTATGCTGCCAGGAGGG - Intronic
1007407942 6:41645460-41645482 CTGGGGGTGAGGAGCAGGGAGGG - Intronic
1007474022 6:42107260-42107282 CAGGGGGAATGAAGTCAGGAGGG + Exonic
1007777757 6:44233273-44233295 TTGGGGTTAGGCAGCCAGGATGG + Intronic
1009660663 6:66606658-66606680 CTGGGGGAAAGAAAACAGGGTGG + Intergenic
1010379275 6:75207040-75207062 CAAGGGGTAGGATGCCAGGATGG - Intergenic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1012920767 6:105219280-105219302 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1012999894 6:106011603-106011625 CGGGGGGTGAGAAGGCAGGAGGG - Intergenic
1013406698 6:109850067-109850089 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1014417015 6:121195650-121195672 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1014499367 6:122165840-122165862 CTGGTGGGAAGGGGCCAGGAAGG - Intergenic
1014622825 6:123690720-123690742 CTGGGGGTAAAAGGTGAGGAAGG + Intergenic
1015399542 6:132773359-132773381 CTGGTGAGAAGAAGCCAGGTTGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1017227778 6:152040827-152040849 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1017388427 6:153911958-153911980 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1018803760 6:167242728-167242750 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019309688 7:353956-353978 CAGGGAGTGAGATGCCAGGAGGG + Intergenic
1019504895 7:1385872-1385894 CTGGGAGTGTGAAGCCAGGAAGG + Intergenic
1019903311 7:4041604-4041626 CTGGGGGTCGGCAGTCAGGAGGG - Intronic
1021451448 7:20786258-20786280 CTGGGAGAAACAACCCAGGATGG - Intronic
1021851698 7:24814863-24814885 AGGGGAGTAAGAGGCCAGGAGGG + Intronic
1021954705 7:25812771-25812793 GTGGTGGTAAGAAGCCAGCCTGG - Intergenic
1022188937 7:27998016-27998038 ATGGGGGGAAGAAGGAAGGAAGG + Intronic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1025235814 7:57234272-57234294 CTGGGGGGACGCAGGCAGGAGGG + Intergenic
1025481688 7:60991927-60991949 CGGGGGGCAAAAAGCCAGGGCGG - Intergenic
1025983397 7:66426529-66426551 CTGGGTGAAAGAGGCCAGGAAGG + Intergenic
1026031802 7:66800785-66800807 TTGGGTGAAAGAGGCCAGGAAGG - Intronic
1026449189 7:70512428-70512450 CCGGGGGCCAGAAGCAAGGAAGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027058167 7:75064735-75064757 GTGGGGGTGAGTAACCAGGACGG - Intronic
1027685828 7:81278219-81278241 GTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1028141764 7:87282246-87282268 CTGGGGGATAGAAGGCAGGGTGG - Intergenic
1029299754 7:99571063-99571085 CAGGGGATAAGAGGCCAAGAAGG - Intronic
1029381687 7:100219548-100219570 CTGGGAGTGGGAAGCCAGCAGGG - Intronic
1029401852 7:100351996-100352018 CTGGGAGTGGGAAGCCAGCAGGG - Intronic
1030313871 7:108094407-108094429 GTGGGGGAAAGAAGCAAGGAAGG - Intronic
1030355518 7:108538329-108538351 CTGGGGGACAGAAGGCAGGGTGG - Intronic
1031117847 7:117687653-117687675 CTGGGGTAAAGAAGGCTGGATGG - Intronic
1031236857 7:119188287-119188309 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1031676587 7:124618627-124618649 CTGGGGGAAAGAAGGCAGGGTGG - Intergenic
1032153074 7:129446694-129446716 CTGGGGGAAAGAAGCCAGGGTGG + Intronic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034090369 7:148358334-148358356 ATGGGGGGAAGAAGGCAAGATGG + Intronic
1034757385 7:153635506-153635528 CAGAGGGAAAGAAGCAAGGAAGG - Intergenic
1035690678 8:1557551-1557573 CTGGCGGCATGAAGGCAGGACGG - Intronic
1035702550 8:1647774-1647796 CTGGGGTTCATAAGCCAGGCAGG - Intronic
1035727461 8:1833778-1833800 ATGGGGGTCAGCGGCCAGGAGGG - Intronic
1037805406 8:22055796-22055818 CTTGAGGGAAGAGGCCAGGAGGG - Intronic
1038076778 8:24084704-24084726 GTGGGGGTCAGAAGACAGAAGGG - Intergenic
1039870661 8:41542449-41542471 ATGGGGTTTAGTAGCCAGGATGG - Exonic
1039884015 8:41645450-41645472 CTGGGTGGAGGATGCCAGGAAGG - Exonic
1041260848 8:56019436-56019458 CTGGGGGTGAGAGGCCAGTGTGG - Intergenic
1042240122 8:66655215-66655237 CTGGGGGTAAAAAGTCAGATAGG - Intronic
1042524457 8:69749864-69749886 ATGGAGGTAAGAAGCCTTGAAGG + Intronic
1044633125 8:94298143-94298165 CTGGGGGAAAGAAGGCAGTGTGG + Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1048580652 8:135727683-135727705 CTGGGGGAAGGAAGAAAGGAAGG + Intergenic
1049676357 8:143891026-143891048 CTGGGGGTGACAAGGAAGGAGGG - Intergenic
1052442236 9:28512019-28512041 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1053945952 9:43310900-43310922 GCGGGGGTAAGAAGCCACGGCGG - Intergenic
1054407681 9:64774948-64774970 CGGGGGGTAAAAAGCCGTGAGGG + Intergenic
1054900049 9:70359459-70359481 CTGGGTTTAAGAATCCAGGAAGG - Intergenic
1057265447 9:93614356-93614378 CTGGGGTATAGAAGCCAAGAGGG - Intronic
1057438393 9:95063356-95063378 CTGGGGGAAAGAGGTCAGAAAGG - Intronic
1057854697 9:98593545-98593567 CTGAGGTAGAGAAGCCAGGAGGG + Intronic
1058051023 9:100406654-100406676 CTGGGGGGAAGATGACAGGAAGG + Intergenic
1058724362 9:107787919-107787941 CTTGGTGTTAGAAGTCAGGATGG - Intergenic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061397172 9:130349514-130349536 CTGGGGGTGAGAAGGCGTGAGGG - Intronic
1062000203 9:134212040-134212062 CTTGGGGTATGAAGCCAGTGAGG - Intergenic
1062044861 9:134420280-134420302 CTGAGGCTAAGAAGCCAGCCTGG + Intronic
1062403031 9:136380707-136380729 CTTGGGGTGAGAAGTGAGGATGG - Intronic
1203589087 Un_KI270747v1:39480-39502 GCGGGGGTAAGAAGCCACGGCGG - Intergenic
1203616744 Un_KI270749v1:73076-73098 CAGGGGGTAAAAAGCCGCGACGG - Intergenic
1185568864 X:1117237-1117259 CTGTGGGTAAACAGTCAGGAAGG + Intergenic
1186279529 X:7977381-7977403 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1186384068 X:9091499-9091521 CTGGGGGAAAGAAGGCAGGGTGG + Intronic
1186469736 X:9811847-9811869 CTGGGGGAGAGAAGACAGGGTGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187916193 X:24154308-24154330 CTGGAGAAAAGAAGACAGGAAGG - Intronic
1189003124 X:36966376-36966398 CTAGGGGTAGGGAGACAGGATGG - Intergenic
1189154853 X:38746459-38746481 CTGGGGGACAGAAGGCAGGGCGG + Intergenic
1190974856 X:55389281-55389303 CTGGGGCTTAGAAGCAAGCAAGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191095676 X:56670906-56670928 CTGGGGGAGAGAAGACAGGATGG + Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191253690 X:58270859-58270881 CCGGGGGAAAAAAGCCGGGAGGG - Intergenic
1191946381 X:66539273-66539295 CTGGGGGTGAGAAGTCAGGGTGG - Intergenic
1192216069 X:69159145-69159167 TTGGGGGAAAGCAGTCAGGAAGG - Intergenic
1192661536 X:73047500-73047522 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1192673228 X:73168155-73168177 TTGGGGGAGAGAAGGCAGGATGG + Intergenic
1193356283 X:80523384-80523406 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1193447181 X:81619030-81619052 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1193832979 X:86310363-86310385 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1193957319 X:87878478-87878500 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1194179565 X:90695677-90695699 CTGAGGGAAAGAAGGCAGGGTGG + Intergenic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1194343343 X:92731345-92731367 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1194833984 X:98659064-98659086 CTGGGGGAGAGAAGGCAGGCTGG - Intergenic
1197591895 X:128419645-128419667 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1198212815 X:134530986-134531008 CAGGGAGTAAGAGCCCAGGAAGG - Intergenic
1198934072 X:141888140-141888162 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200651699 Y:5848010-5848032 CTGGGGGAGAGAAGACAGGGTGG - Intergenic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201988361 Y:19993990-19994012 CTGAGGGGGAGAAGCCAAGATGG - Intergenic