ID: 1100649317

View in Genome Browser
Species Human (GRCh38)
Location 12:96567442-96567464
Sequence ATTTGAATGAGGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100649313_1100649317 1 Left 1100649313 12:96567418-96567440 CCTGGTTAAATTTGAATTTCCAG 0: 1
1: 0
2: 7
3: 145
4: 2016
Right 1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 30
4: 361
1100649311_1100649317 22 Left 1100649311 12:96567397-96567419 CCTGGGAGTATTAGGGAAGAGCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 30
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100649317 Original CRISPR ATTTGAATGAGGAAGTTGGA TGG Intronic
900761020 1:4470497-4470519 ATTTGAATGAGCCATTTTGATGG + Intergenic
901839911 1:11947718-11947740 ATTTCAATGTGCAATTTGGAGGG + Intronic
902377729 1:16037726-16037748 AGTTGGATGTGGAAGATGGAGGG + Intergenic
902796595 1:18804506-18804528 TTTGTAATGAGGGAGTTGGACGG - Intergenic
905840293 1:41170799-41170821 ATTTGAATGAGGAGATAGTATGG - Intronic
906249759 1:44301912-44301934 ATTTGCATGAGGAATTTGTAGGG - Intronic
906321057 1:44815869-44815891 ATTTAAATGAGGAAATAGGCTGG - Intergenic
906824672 1:48966321-48966343 ATTTGAACAAGGAAATTGAAAGG - Intronic
907718281 1:56948118-56948140 ATTTGAATCAGGGAGCTGGAAGG + Intronic
908431545 1:64063458-64063480 ATTCCACTGAAGAAGTTGGAGGG - Intronic
911237335 1:95425521-95425543 GTTTGAATGGGGAAATTGGCTGG + Intergenic
913247793 1:116885502-116885524 ATGAGAATGAGGAAGTTGAAGGG - Intergenic
913533088 1:119747024-119747046 TGGTGAATAAGGAAGTTGGAGGG + Intergenic
915139061 1:153755227-153755249 ATTTGATTGAGGAATTTGTGGGG + Intronic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
919345313 1:196368771-196368793 ATGTGAAGGAGGAAGTAGTAGGG - Intronic
920370823 1:205478126-205478148 AGATGAATGAGGAAGCTAGAGGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921522838 1:216177723-216177745 ATCTGAATGAGCAAGTTGTAGGG - Intronic
921953341 1:220956426-220956448 AAATGAATGAGGAGGTTGTAGGG + Intergenic
1063170912 10:3509195-3509217 ATATGAGTGATGAACTTGGATGG + Intergenic
1064585027 10:16831489-16831511 ATTTGAATGATGACATTGGTCGG + Intronic
1064918757 10:20492243-20492265 ATTTGTATGAGAAAGATAGATGG + Intergenic
1065178242 10:23099151-23099173 ATATGAATTTGGAAGTTGGCGGG + Intronic
1065369509 10:24969576-24969598 ATTTGAAGAAAAAAGTTGGAGGG + Intergenic
1065385608 10:25130397-25130419 ATTTGTATGAGGAAGTTTGTGGG - Intergenic
1066225741 10:33381444-33381466 ATTTGGATGGGGAATTTTGAGGG + Intergenic
1066359588 10:34717255-34717277 ATAGAAATGAGGGAGTTGGATGG + Intronic
1068321049 10:55416602-55416624 ATTTGAAGGATAAAGTTGGCAGG + Intronic
1068419403 10:56770762-56770784 TGTTGAATGAGAAAGTGGGATGG - Intergenic
1068917131 10:62444596-62444618 ATTTGAATGAAGAAGATGTAAGG - Intronic
1068956628 10:62824254-62824276 TTTTGAGTGAGAAAGGTGGAGGG + Intronic
1069167039 10:65174032-65174054 ATGTGTATGAGAAAATTGGATGG - Intergenic
1069253734 10:66305486-66305508 TTTTGAATCAGGATGGTGGAAGG - Intronic
1069548952 10:69349118-69349140 GATTGAAAGAGGAAGTTGGGAGG + Intronic
1069609492 10:69763284-69763306 AGTTGAGTGGGGAAGTGGGACGG + Intergenic
1069770699 10:70897759-70897781 GTTTGAATGAGTAAATTTGATGG + Intergenic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071930840 10:90467812-90467834 ATTTCAATGAGGGAGTGGGAGGG - Intergenic
1072343591 10:94480277-94480299 CTTTGAATGAGGAAGATGATGGG - Intronic
1072979419 10:100087340-100087362 ATTTGAATCAAGACCTTGGAAGG - Intergenic
1073305322 10:102499001-102499023 AATTTAATGAGGAAAATGGAGGG - Intronic
1073568685 10:104557577-104557599 ATTTGAATGGTTTAGTTGGAAGG - Intergenic
1073926070 10:108518443-108518465 ACTTGAAGGAGAAAGTTGGAAGG + Intergenic
1074113784 10:110440765-110440787 ATTTGAACCAGGAATTGGGAAGG - Intergenic
1074416322 10:113270015-113270037 TTTTAAAAAAGGAAGTTGGAAGG + Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1077429493 11:2509014-2509036 ATTTGACTGAGCAATCTGGAAGG + Intronic
1077630716 11:3809311-3809333 AGTAGAATGACCAAGTTGGAAGG + Intronic
1077780608 11:5324909-5324931 ATTTGATTCAGAATGTTGGAAGG - Intronic
1078327751 11:10394230-10394252 ATCTTACTGAGGAAGTCGGAAGG - Intronic
1078434229 11:11311279-11311301 ATTTGAAGCAGGAAGTGGGGAGG - Intronic
1078516841 11:12029765-12029787 ATTTGAATGAGACAGTGGGAAGG - Intergenic
1080006138 11:27409147-27409169 ATTTCACTGAAAAAGTTGGATGG + Intronic
1080117034 11:28632802-28632824 ATTTGAAAGAGGATATGGGAGGG - Intergenic
1080435548 11:32238605-32238627 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1080966791 11:37222983-37223005 ATTTGAAGGAGTCAGTTGTAAGG - Intergenic
1081595816 11:44458676-44458698 TTTTGGATGAGTAAGTTGGTAGG - Intergenic
1082600341 11:55142964-55142986 TTTTGATTGAGAAATTTGGAAGG - Intergenic
1083336709 11:61926424-61926446 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1085450257 11:76627697-76627719 ACGTGAATGAGGAAGTGGGTGGG - Intergenic
1085845851 11:80063784-80063806 ATTAGAGTCAGGAAGTTTGAGGG + Intergenic
1086004442 11:82020934-82020956 TTTTGAATGAGTAAGTTTAATGG - Intergenic
1086022290 11:82245737-82245759 AATTGAATGAGTAAGTTAGATGG + Intergenic
1086943885 11:92825932-92825954 ATGTGAGAGAGGAAGTTAGAAGG + Intronic
1088432325 11:109772418-109772440 ATTTGACTGAGGAAGGAGTAAGG - Intergenic
1088539622 11:110900100-110900122 AGTAGAATGAGGATGTTGGTTGG + Intergenic
1090738928 11:129639106-129639128 ACTTGTATGAGGAAGGAGGAAGG - Intergenic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1093674910 12:21927329-21927351 ATGTGGATAAGGAAGTTGGTTGG + Intronic
1094378476 12:29817188-29817210 ATCTGAAAGAAGAAATTGGAAGG + Intergenic
1094457756 12:30657486-30657508 ATTTGTATGGGTAAGTTTGAAGG - Intronic
1094790646 12:33910377-33910399 ACTTGAATGTGGAGGGTGGAAGG - Intergenic
1096086123 12:48866081-48866103 ATTTGTATTAGGAAGTGGAAAGG + Intergenic
1096254150 12:50052686-50052708 ATTAGAAGGAGGAAGTGGGGAGG + Intergenic
1096257785 12:50073534-50073556 ATTTGCAGGAGGAAGGGGGAAGG - Intronic
1097574768 12:61377889-61377911 ATTTGCAGAAGGAAGTTTGATGG + Intergenic
1098057897 12:66527801-66527823 ATTTGAGGGTGGAGGTTGGAGGG + Intronic
1098229073 12:68354459-68354481 ATTCCAGTGAGGAAGATGGAAGG + Intergenic
1098435378 12:70463349-70463371 TTTTGAATGGGAAAGTGGGATGG - Intergenic
1098848122 12:75562833-75562855 ATTTTAATAAGGAGGTTGAAAGG - Intergenic
1099595214 12:84654411-84654433 CTTTGCTTGAGGAAGTTGCATGG + Intergenic
1100058862 12:90547094-90547116 AATGGAATGAGGAATTTGTAAGG - Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG + Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1102081678 12:110103348-110103370 ATTTGAAAGAAGAACTTGGCGGG + Intergenic
1103058444 12:117839922-117839944 ACTTAAATGAGAAAGTTTGAAGG - Intronic
1104239652 12:126975641-126975663 ACTTAAAGGAGGAAGATGGAAGG + Intergenic
1105433829 13:20360600-20360622 AGTTGGATGAGGAAATGGGAAGG - Intergenic
1106525191 13:30534207-30534229 ATCAGAATGAGGAATTTGGACGG - Intronic
1106760430 13:32862296-32862318 ATGTTAATGAGCAAGATGGATGG - Intergenic
1107739874 13:43438398-43438420 ATTGGAATGTGGAAGTGAGAGGG + Intronic
1110867629 13:80414517-80414539 ACTTGAATGAGGAGATTGGGAGG + Intergenic
1113823231 13:113230452-113230474 AGTTCCATGAGGAAGTTAGAAGG - Intronic
1114962245 14:27908061-27908083 AATTGAATGGAGAAGCTGGAGGG + Intergenic
1115301365 14:31889141-31889163 ATTGGAATGAGGTACATGGAAGG - Intergenic
1116467956 14:45254760-45254782 CTTTGATAGAGGAAGTTTGAAGG + Intergenic
1116609188 14:47045610-47045632 ATTAGATTGAGAATGTTGGAGGG + Intronic
1116757780 14:48969291-48969313 ATTTTAATGAGGAATATGCAGGG - Intergenic
1116767435 14:49089967-49089989 ATTTGGAGGAGGAAGTTTGTCGG + Intergenic
1116910343 14:50456630-50456652 ATTTCAATGAGAAAGTTAAAAGG + Intronic
1116971827 14:51074534-51074556 ATTTGATTGAGAGAGATGGAAGG - Intronic
1117334699 14:54747079-54747101 ATTTGAGTGAGGATGATGTAAGG + Intronic
1117409529 14:55438640-55438662 ATTTGAAGGAGGATGTTTTATGG + Intronic
1118325869 14:64779981-64780003 AGATGAATGAAGAAGATGGAGGG - Intronic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1122287698 14:100661659-100661681 ATGTGAATGAGGATGATTGAGGG + Intergenic
1123099469 14:105786707-105786729 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1124062683 15:26308479-26308501 TGTTGAATGGGGAAGTGGGATGG + Intergenic
1124112227 15:26801725-26801747 ATCTAAATGAGGAAGAAGGAAGG + Intronic
1124431477 15:29612429-29612451 ATTTGAATGTGGTGGTGGGAAGG - Intergenic
1125175952 15:36821961-36821983 ATTTTAATCAGGAGCTTGGAGGG + Intergenic
1125673704 15:41491366-41491388 ATGTGAATGAGGAGGATAGATGG + Intergenic
1126307321 15:47274816-47274838 ATATCAATCAGGAAGTTTGATGG + Intronic
1127128370 15:55835903-55835925 ATTTCAATGAGGGAGAAGGAAGG - Intronic
1128005297 15:64234001-64234023 ATTTGAGAGAGGAAGCGGGAGGG - Intronic
1128286423 15:66440802-66440824 ATTAGAATTAGAAAGTTGTATGG + Intronic
1128846073 15:70896422-70896444 ATCAGAATGGGGAAGATGGAGGG - Intronic
1130785748 15:87094257-87094279 ATTTCAATGAGGATTTTGGAGGG - Intergenic
1131122364 15:89830481-89830503 ATTGGAAGCAGGAAGTGGGAAGG - Intergenic
1132266655 15:100478928-100478950 ATTTGAAGGAGGAGGGTGTATGG + Intronic
1133207575 16:4242466-4242488 ACTGGAAGGAGGAAGTTGTAAGG + Intergenic
1135345737 16:21687050-21687072 ATCTGAAGTAGGAAGTTGGAGGG + Intronic
1136648374 16:31643389-31643411 ACTTGAATGTGGAAGGTGGGAGG - Intergenic
1137306804 16:47208835-47208857 TTTTGATTGAGGAAGTCAGATGG + Intronic
1138432009 16:56975074-56975096 AAAGAAATGAGGAAGTTGGAGGG - Intronic
1138458321 16:57133652-57133674 TTTTCAATGAGGAGGGTGGAGGG - Intronic
1139616548 16:68098382-68098404 ACTTGAACGAGGGAGTTGGGAGG - Intronic
1140148923 16:72341700-72341722 AGTAGAATGAGGAAGTAGGGAGG - Intergenic
1140278181 16:73529741-73529763 CTCTGAATCAGGAATTTGGAGGG - Intergenic
1140842312 16:78851147-78851169 TTCTGAATGAGCAAGTTTGAGGG - Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1142195825 16:88738913-88738935 GCTTGAGTGAGGAAGTAGGAAGG - Intronic
1143893892 17:10122027-10122049 GTTTGAGTGTGGAAGTTGTATGG - Intronic
1145296338 17:21595341-21595363 ATTTGTTTGAGGAAGATAGATGG + Intergenic
1145367446 17:22276726-22276748 ATTTGTTTGAGGAAGATAGATGG - Intergenic
1146111679 17:30095382-30095404 ATTTTATTGAGGAAGCTGGTGGG - Intronic
1147567597 17:41547324-41547346 ATTCCAATGGGGCAGTTGGAGGG - Intergenic
1147698927 17:42379428-42379450 ATGTGTATGAGTTAGTTGGAGGG - Intronic
1148535677 17:48436719-48436741 ATTTGATGGAGGAAGTTGATGGG - Intergenic
1153433126 18:5040198-5040220 ATTTGACTGAGCAAGTTTGAAGG + Intergenic
1153733806 18:8043802-8043824 ATGAGAATGAGGGAGTAGGAAGG + Intronic
1154043532 18:10882692-10882714 ATATGAATGAGGACATGGGATGG + Intronic
1155258449 18:24018682-24018704 AGTTGAATGAGGAGTTGGGAGGG + Intronic
1155338866 18:24793860-24793882 AATTGAAAGAGGCAGTTGGAAGG + Intergenic
1156765509 18:40649885-40649907 GTTTTAATGAGGGAGGTGGAAGG + Intergenic
1156984216 18:43329801-43329823 GTTTGAATGAGGAAGGTAGCCGG - Intergenic
1158307524 18:56122940-56122962 CTTTAAATGAGCAACTTGGATGG + Intergenic
1158576015 18:58638636-58638658 AGTAAAATGAGGAAGTTGGATGG - Intergenic
1160036753 18:75308952-75308974 ATTAGGATGAGGAAACTGGAGGG - Intergenic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1168419680 19:56193236-56193258 ATTGGGATGAGGGATTTGGAAGG - Intronic
1168421288 19:56205710-56205732 ATTGGGATGAGGGATTTGGAAGG + Intronic
1168426544 19:56243846-56243868 ATTTGGATGAGGGTTTTGGAAGG + Intronic
925651707 2:6097340-6097362 TTTAGAATCAGGAAGTGGGAAGG + Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
927031770 2:19127666-19127688 ATTTGCATGATGAGTTTGGATGG + Intergenic
927698870 2:25254954-25254976 ATGAGAATAAGGAAGTTTGACGG - Intronic
929329477 2:40663242-40663264 ATCTACATGTGGAAGTTGGAAGG + Intergenic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
930397883 2:50846348-50846370 ATTTGAATGAGCAAATTGATTGG - Intronic
930923682 2:56790066-56790088 ATTTTAATAAGAAAGTTGTACGG + Intergenic
931223986 2:60313420-60313442 ATTTCTATGAGGAAGTGAGATGG - Intergenic
932658755 2:73633880-73633902 ACTTGAACCAGGAAGGTGGAGGG - Intergenic
933141956 2:78802429-78802451 ATTTGATTGATGAAATTGTATGG - Intergenic
935488103 2:103683285-103683307 TTTTTAATGAGAAACTTGGAGGG + Intergenic
935499467 2:103820572-103820594 CTTGGAATGAGGAAACTGGAAGG - Intergenic
936934947 2:117830273-117830295 AGTTTAATCAGGAAGTTGGTAGG - Intronic
937213131 2:120290660-120290682 ATTTGAATGAGAAAGTATGCTGG - Intronic
937357705 2:121208778-121208800 AGATGAAGGAGGAAGGTGGAAGG + Intergenic
937635126 2:124146944-124146966 ATTTGAGTGTGGATGTTGGCTGG + Intronic
937665233 2:124479607-124479629 ATTGGAATCAGGGAATTGGATGG + Intronic
938164455 2:129014589-129014611 AGCTGAATGAGGAAGCTGGGAGG - Intergenic
938175992 2:129129273-129129295 TGTTGAATGGGAAAGTTGGATGG + Intergenic
938437429 2:131293246-131293268 TGTTGAATGAGAAAATTGGAGGG + Intronic
938813851 2:134879389-134879411 ATTAGTAGGAGGAAGTAGGAAGG - Intronic
939908464 2:147949531-147949553 ATTTAAATGAGTGAGTTGTATGG + Intronic
941101166 2:161297030-161297052 ATTTGAGTGTTGAAGATGGAAGG - Intergenic
941714956 2:168754182-168754204 ATGAGAACAAGGAAGTTGGAAGG + Intronic
941947588 2:171116767-171116789 ACTTAAATGAGGAATGTGGATGG + Intronic
942256274 2:174102200-174102222 ATCTGAATCAGAAACTTGGAAGG + Intronic
942611785 2:177749586-177749608 ATTTGCCTGAGAAAGTTGGCTGG - Intronic
942824036 2:180152379-180152401 ATTTTATTGAGGAATATGGAAGG - Intergenic
943201428 2:184830941-184830963 ATTTGAAGGAGTAAGCTAGAGGG + Intronic
943427199 2:187751504-187751526 ATTGGATTGAGGAATGTGGAAGG - Intergenic
943593813 2:189831237-189831259 TTTTAAATGAGAAAATTGGAAGG + Intronic
943694934 2:190916653-190916675 ATTTAAATGAGGAAGTATGGGGG + Intronic
944482977 2:200175997-200176019 ATTTCAATAAGAGAGTTGGAGGG + Intergenic
944880213 2:204005512-204005534 ATTTGATGGAGGAAGCTGGCAGG - Intergenic
945366881 2:208965468-208965490 TGTTGAATGAGAAAGTTGGATGG - Intergenic
945749960 2:213769158-213769180 AGTTGAATGAGGAATTGGGGTGG + Intronic
945864036 2:215156625-215156647 AGTTGAATGACTAAGATGGAAGG + Intergenic
946166802 2:217869449-217869471 AGCTGAATGGGGAAGCTGGAGGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
948094912 2:235325626-235325648 ATTTGAATGAGAAAGGAAGAAGG - Intergenic
948242855 2:236452830-236452852 TTTTAAAAAAGGAAGTTGGATGG - Intronic
948328316 2:237144297-237144319 CTTGGAATGAAGAAGTGGGATGG - Intergenic
1169443978 20:5656410-5656432 ATGTGAATGAGGAACGTGCATGG - Intergenic
1170210055 20:13839148-13839170 ATTTGAAGGTGGAAGTAGGAGGG + Intergenic
1170487041 20:16828866-16828888 ATTTCAGTGGGGAAGTGGGAAGG + Intergenic
1170685057 20:18562419-18562441 ATTTCAATGACGGACTTGGAGGG - Intergenic
1170822253 20:19764660-19764682 AATTGATTGAGGAAGTGGAAAGG - Intergenic
1173038838 20:39440893-39440915 ATTTGAATGAGTGAGTTATATGG + Intergenic
1173096283 20:40031751-40031773 ATTTGAAAGTGGAAGTAGTAAGG - Intergenic
1173185156 20:40834774-40834796 TTGTGAATCAGGAACTTGGATGG - Intergenic
1175311337 20:58013681-58013703 AGCTGAAGGAGGAAGGTGGAGGG + Intergenic
1176002319 20:62837993-62838015 ATTTGAATGACGCAATTAGAGGG + Intronic
1177016086 21:15789016-15789038 ATTCCAAAAAGGAAGTTGGAAGG - Intronic
1177372714 21:20225651-20225673 ATATGAATGGGAAATTTGGATGG - Intergenic
1178378339 21:32087187-32087209 ATTTGAGGGAGGAGGTGGGATGG + Intergenic
1183247042 22:36702126-36702148 ATTCCAATGAGGATGTTTGAGGG + Intronic
1183733926 22:39633129-39633151 ATTGGAGAGAGGAAGATGGAAGG - Intronic
1184011693 22:41753534-41753556 ATTTAAATGAGGAAACTGGCCGG + Intronic
950353502 3:12381399-12381421 ATTGCCATGAGGGAGTTGGAAGG - Exonic
951578027 3:24133485-24133507 ATTTAAATGAAGAAGTTGAAGGG + Intronic
952637576 3:35550361-35550383 AGTTAAATGAGAAAGTTAGAAGG + Intergenic
952647259 3:35675510-35675532 ATCTGAATGAGAGAGCTGGATGG - Intronic
953073634 3:39547746-39547768 ATTGGCAGGAGGAATTTGGAGGG + Intergenic
953290950 3:41662174-41662196 TTCTGAGTGAGGAATTTGGAAGG + Intronic
953421098 3:42753905-42753927 ATGTGAATGGGGAAGTTGTATGG + Intronic
953802521 3:46036142-46036164 TGTTGAATGAGAAAGTGGGATGG + Intergenic
954397670 3:50301532-50301554 ACTTGAATCCGGAAGGTGGAGGG + Intronic
954874128 3:53790013-53790035 GTTTTAATGATGAAGATGGATGG - Intronic
955062085 3:55501840-55501862 ATTTGCTTCAGGAATTTGGAGGG - Intergenic
955114733 3:55986429-55986451 ATTTGAACCAGTAAGTTGGATGG + Intronic
955264803 3:57431925-57431947 ATTTGACTGTGGAAATTTGAAGG - Intronic
955298905 3:57758011-57758033 ATTTGATTGAGGTGGTTGAATGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
956326023 3:68054146-68054168 ATTTCAATGTGAAATTTGGAAGG - Intronic
956358036 3:68415482-68415504 GTTGGAGTGAGGAGGTTGGAGGG + Intronic
956687625 3:71844995-71845017 ATCTAAATGAGGAAGGTGGTGGG - Intergenic
956769820 3:72515667-72515689 TTTTTAATGATGAAGCTGGAAGG - Intergenic
959528032 3:107399149-107399171 GCTTGAATTAGGAAGTGGGAGGG + Intergenic
959857083 3:111172188-111172210 ACTAAAATGAGGAAGTTAGAAGG - Intronic
960039372 3:113134030-113134052 ATATAGATGAGGAAGTGGGAGGG + Intergenic
961138459 3:124534672-124534694 ACCTGAATGAGCAAATTGGAAGG + Intronic
962020456 3:131494996-131495018 TTTTGAATGAGGAAGTTAAGTGG - Intronic
963287857 3:143453827-143453849 ATTTCAATGTGAAATTTGGAGGG - Intronic
963801071 3:149676883-149676905 AGTTGACTGAGGAGGGTGGATGG - Intronic
963941208 3:151097935-151097957 TTTTGAATCTGGAACTTGGAGGG + Intronic
964903128 3:161685420-161685442 ATTTGAATGAGTAAGAAGGATGG + Intergenic
965515469 3:169616824-169616846 ATCTGTATGTGGAAGTTGGTAGG - Intronic
965576118 3:170220542-170220564 CTTTAAATGAGTAAGTTGTATGG + Intergenic
966061865 3:175767446-175767468 GTTTCAATGAGAAAGTTAGAAGG + Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
968464423 4:743361-743383 ATTTGCATTATGAAGTTTGAAGG - Intronic
969942379 4:10747153-10747175 ATTTTAATGAGGCAGCTGGTAGG + Intergenic
970782432 4:19754241-19754263 ATGGGAAGGAGGAAGATGGAAGG - Intergenic
971579117 4:28310663-28310685 TTTGGAAGGTGGAAGTTGGAAGG + Intergenic
971706536 4:30050425-30050447 ACTTGAATGGGGAAGATGAAAGG + Intergenic
971781601 4:31042147-31042169 ATTTGAATGAGCATGTTTCAAGG + Intronic
972169213 4:36324277-36324299 AGTTGAAGGAGGAAGGAGGAGGG - Intronic
972299757 4:37773598-37773620 TTTTTAAGGAGGAAGTTGCATGG + Intergenic
974810274 4:66937196-66937218 AGTTGAGAGAGAAAGTTGGATGG + Intergenic
977190647 4:93996269-93996291 ATTAGCATGAAGAAGTTGAATGG - Intergenic
977270718 4:94914637-94914659 AGTTGAATGAGGAGGCTGGGAGG + Intronic
977647679 4:99432310-99432332 ATTTGAGGGTGGAAGGTGGAGGG + Intronic
980614318 4:135198630-135198652 ATTTGCATGTGGAAGTAGAATGG + Intergenic
980750495 4:137080577-137080599 ATTTTAAGGAGGAACATGGAGGG - Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984088976 4:175346779-175346801 GATGGAATGAGGGAGTTGGAGGG - Intergenic
984583759 4:181539919-181539941 ATTTCAAGGAGGAATTTTGATGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987432272 5:17849412-17849434 ATTTGAATGAGGAAGATACCGGG - Intergenic
988272558 5:29035264-29035286 AATTAAATGAGGCAGTTTGAAGG - Intergenic
988280679 5:29142630-29142652 CTTGTGATGAGGAAGTTGGAAGG + Intergenic
988422775 5:31026527-31026549 AATTGAATCAGGTAGTTGAATGG + Intergenic
988463572 5:31465601-31465623 ATTTCAATGTGAAATTTGGAGGG - Intronic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
988968687 5:36444712-36444734 AAGAGAATGAGGAAGTGGGACGG - Intergenic
989786838 5:45342613-45342635 ATTTGATTGAGAAATTTGTAGGG + Intronic
990004776 5:50933511-50933533 TTTTCAATGAGTAACTTGGAAGG - Intergenic
990141570 5:52710456-52710478 ATTTGTTTGAGGAAGTGGTATGG + Intergenic
992188727 5:74268965-74268987 ATTTGAAGTGGGAGGTTGGAAGG + Intergenic
993265343 5:85720069-85720091 AGATGAAGGAGGAAGTTGAAAGG - Intergenic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
994303353 5:98173297-98173319 ATGTGCATGTGGAATTTGGAAGG - Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
996937198 5:128962728-128962750 AAGTGACTGAGGGAGTTGGATGG - Intronic
997865612 5:137460171-137460193 ATATGAATCAGGCAGTGGGATGG + Intronic
999089768 5:148925962-148925984 ATTTTAATTATGAAGTTGTAAGG - Intronic
999245101 5:150150023-150150045 ATTAGAATGAAGAAGTGGTATGG + Intronic
1000125964 5:158244502-158244524 ATTGCAATCAGGAAGTAGGAAGG + Intergenic
1000790988 5:165607051-165607073 ATTTGAAGGAGGAAGGTGAGAGG - Intergenic
1001455670 5:171858103-171858125 ATTTGGATGTGGACATTGGAGGG - Intergenic
1001680103 5:173550364-173550386 ATTTGACTGAGAAATTTGGTAGG + Intergenic
1002257900 5:177972448-177972470 AAAAGACTGAGGAAGTTGGAAGG - Intergenic
1003378284 6:5599212-5599234 TTTTAAATGAGGCAGATGGAAGG + Intronic
1004048252 6:12047379-12047401 AGAGGAATCAGGAAGTTGGACGG + Intronic
1004560361 6:16743841-16743863 ACTTGAAGGAGGAAGTGCGATGG + Intronic
1005657934 6:27962720-27962742 TTTTGAATGAGTAAGTTTTATGG - Intergenic
1005715648 6:28544565-28544587 AGTTGGAGGGGGAAGTTGGAGGG + Intergenic
1006235112 6:32623475-32623497 AAATGAATCATGAAGTTGGATGG + Intergenic
1006905441 6:37530204-37530226 AGTTGAAGGAGGGTGTTGGAAGG - Intergenic
1007294967 6:40814652-40814674 ATTAGAGAGAGGAAGTTGGAGGG - Intergenic
1007593480 6:43037566-43037588 ATTTGAGTGGGGAGGTGGGAGGG - Intergenic
1007808678 6:44470935-44470957 ACTAGAATGAGGAATTTGGAAGG - Intergenic
1008853791 6:56056319-56056341 ATTTTGATGAGGACTTTGGAGGG - Intergenic
1008982006 6:57494772-57494794 ATATTATTGAGGATGTTGGAAGG - Intronic
1009988345 6:70809328-70809350 TGTTCAATGAGGAAGTTTGATGG - Intronic
1010207980 6:73339902-73339924 ATTTGACTGAGCAAATTGAATGG + Intergenic
1010377153 6:75184218-75184240 ATTTGAATAAGGAGATTTGAAGG - Intronic
1010596469 6:77769599-77769621 ATCTGCTTGAGGAAGGTGGAGGG + Intronic
1010846004 6:80708706-80708728 ATTTGCAAGAGAAAATTGGAAGG + Intergenic
1011912568 6:92460673-92460695 ACTTGAAAGAGGAAATGGGATGG - Intergenic
1012037107 6:94156159-94156181 ACTTGAGGGTGGAAGTTGGAAGG + Intergenic
1012360790 6:98376971-98376993 ACTTGAGTGAGGAGGTTGGGAGG - Intergenic
1012693269 6:102344882-102344904 ATATCAAGGAGGAAGTTGCAAGG - Intergenic
1014026574 6:116654411-116654433 ATTTGCATGTGTATGTTGGAGGG - Intronic
1015139108 6:129909724-129909746 AATTGAATGGGGAGGTGGGAGGG - Intergenic
1015506296 6:133992365-133992387 ATTAGAGTGAAGAAGTGGGAGGG + Intronic
1015842833 6:137492105-137492127 ATCTGGGTGAGGAATTTGGATGG - Intergenic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1017164829 6:151397950-151397972 GTTTGAACCAGGGAGTTGGAGGG + Intergenic
1018005219 6:159615801-159615823 ATAAGAATGAGGAAGGAGGATGG + Intergenic
1021433692 7:20590000-20590022 ATTCGAGTGAGAAAGATGGAAGG + Intergenic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1024344826 7:48302491-48302513 ATTTGAGGGTGGAGGTTGGAAGG - Intronic
1024577616 7:50777511-50777533 ATTTAAATGAGTAAATTGTATGG + Intronic
1024928481 7:54643466-54643488 ATTTGAATGAGTGAGTAGGAGGG + Intergenic
1026219637 7:68382527-68382549 ATTTCAATGAGAGATTTGGAGGG - Intergenic
1026659667 7:72289329-72289351 ATCTGACTGAGGAAGCTGGGAGG + Intronic
1026733163 7:72928959-72928981 ACTAGAATGAGGCAGGTGGATGG + Intronic
1027455039 7:78379704-78379726 ATTGGAAAGAGAAAGATGGATGG - Intronic
1030865832 7:114700676-114700698 GTTGGAATGAGGAGGCTGGATGG + Intergenic
1031169579 7:118275669-118275691 ATTTCTATAAGGAAGTTTGAAGG - Intergenic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1032474831 7:132204569-132204591 ATTTGAATTAAAAATTTGGAGGG + Intronic
1033439014 7:141361847-141361869 ATTTTAATGATGAAGTGGGCTGG - Intronic
1035377609 7:158415740-158415762 AATTGAATGAGGAAGAGGCATGG - Intronic
1036908916 8:12735489-12735511 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1037506772 8:19538558-19538580 ATTTGCATGGGGAAGTGAGAAGG + Intronic
1037547587 8:19939598-19939620 ATGAGAAGAAGGAAGTTGGAAGG + Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1037706137 8:21316726-21316748 ATTTGACTGGGGAAATTAGATGG - Intergenic
1037872530 8:22511900-22511922 TATGAAATGAGGAAGTTGGAAGG + Intronic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1038660682 8:29494053-29494075 ATTTGAATGAGGAGAAAGGATGG - Intergenic
1039578057 8:38641329-38641351 GTTTGCATGAGGAAGTTGATTGG - Intergenic
1039624833 8:39038232-39038254 AGTGGAATGGGGAAGTTGGAAGG - Intronic
1039864227 8:41487404-41487426 TTTTGAATGAGGAAATTTGAGGG - Intergenic
1040706571 8:50135898-50135920 ACTTGAGGGAGGAGGTTGGAAGG - Intronic
1041638480 8:60171174-60171196 ATTTCAATGTGGATTTTGGAGGG - Intergenic
1041789972 8:61684448-61684470 ATTTTGATGAGTAACTTGGATGG - Intronic
1043014848 8:74925270-74925292 ATTTTAATGTGGAATTTGAAGGG - Intergenic
1043709587 8:83398917-83398939 ATGTGAATGACTAAGCTGGATGG - Intergenic
1044013923 8:87027721-87027743 TGTTGAATGAGAAAGTGGGACGG - Intronic
1046546324 8:115655023-115655045 ATATGAATGAGGATGGTGAACGG + Intronic
1046693814 8:117315993-117316015 ACTTGAATAATGAAGTTGTATGG + Intergenic
1046836198 8:118804459-118804481 ATTTTAAAGATAAAGTTGGATGG + Intergenic
1047507354 8:125490350-125490372 ATTGGGATGGGGAAGTGGGAGGG - Intergenic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1049730461 8:144175018-144175040 ATGTATATGAGGAAGTTTGAGGG - Intronic
1050062432 9:1723952-1723974 CTTTGAATGACAAAGCTGGAAGG - Intergenic
1051362071 9:16289812-16289834 AGCTGAATGGGGAAGTGGGAGGG + Intergenic
1051855248 9:21558652-21558674 ATTTCAATAAGGAAGTTCAAAGG + Intergenic
1051972435 9:22906257-22906279 AATTGACTGTGGAAGTTGCAAGG + Intergenic
1052375923 9:27717425-27717447 TTATGAATGAGGAGGTTGAAGGG - Intergenic
1053384918 9:37679386-37679408 CTTTGAATGAGTAAATTGCATGG - Intronic
1053608370 9:39682806-39682828 ATATGAAGGAGGAAGCTAGAGGG + Intergenic
1053866210 9:42439170-42439192 ATATGAAGGAGGAAGCTAGAGGG + Intergenic
1054245160 9:62659603-62659625 ATATGAAGGAGGAAGCTAGAGGG - Intergenic
1054559288 9:66694134-66694156 ATATGAAGGAGGAAGCTAGAGGG - Intergenic
1054722138 9:68614908-68614930 AATTGAGTGAAGAAGCTGGAAGG + Intergenic
1055542709 9:77329438-77329460 ATTTGAAAGAGGCCATTGGAGGG + Intronic
1056544807 9:87604883-87604905 ATTTGAGTGAGGATGTGGCATGG - Intronic
1058076443 9:100656618-100656640 ATGTGAATGAGGAACTTGTTGGG + Intergenic
1203489444 Un_GL000224v1:89544-89566 ATTTCAATGAGAGATTTGGACGG + Intergenic
1203502065 Un_KI270741v1:31432-31454 ATTTCAATGAGAGATTTGGACGG + Intergenic
1185917976 X:4057156-4057178 TTTTGATTGAGCAATTTGGATGG - Intergenic
1186652428 X:11575285-11575307 ATTGGAATTAGGCATTTGGAGGG - Intronic
1187191593 X:17040819-17040841 ATTAGAATGAGAAAGTTGTTTGG + Intronic
1190750611 X:53358509-53358531 ATTTGAATCAGGGTTTTGGAGGG - Intergenic
1190869310 X:54411823-54411845 ATTTCCATGAGGAAGTGGAAGGG - Intergenic
1190908379 X:54750197-54750219 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1191123484 X:56929890-56929912 ACTTGAATGAGGAAGGTGAGAGG - Intergenic
1192557013 X:72098282-72098304 ATAAGAAAGAGGAAGTTGGCCGG + Intergenic
1193973364 X:88085892-88085914 ACTTGAGTGTGGAAGGTGGAAGG - Intergenic
1194037170 X:88889539-88889561 AGTTGAACAATGAAGTTGGAAGG - Intergenic
1194792156 X:98163813-98163835 TTTTGTATGAGAGAGTTGGAAGG + Intergenic
1198422783 X:136484439-136484461 TTTTGCACTAGGAAGTTGGATGG - Intergenic
1198861466 X:141075294-141075316 ATTTCAATGTGAAATTTGGAGGG - Intergenic
1198901226 X:141512089-141512111 ATTTCAATGTGAAATTTGGAGGG + Intergenic
1199952513 X:152716875-152716897 ACCTGAAGGAGGAAGTGGGAGGG - Exonic
1199957170 X:152751573-152751595 ACCTGAAGGAGGAAGTGGGAGGG + Exonic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic
1202053766 Y:20807792-20807814 ATTTCAATGTGAAATTTGGAGGG - Intergenic